The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_LT598657	Legionella pneumophila strain Lpm7613 isolate Lpm7613 chromosome 1	3261562	940485	947324	3261562		Acinetobacter_phage(42.86%)	9	NA	NA
WP_014326803.1|940485_941262_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.6	1.1e-57
WP_016356786.1|941266_942289_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.3	4.6e-75
WP_014326805.1|942266_942845_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|942878_943604_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_014326806.1|943600_944110_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_014326807.1|944090_944660_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011945955.1|944656_945184_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|945197_946160_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_011215026.1|946526_947324_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.7e-21
>prophage 3
NZ_LT598657	Legionella pneumophila strain Lpm7613 isolate Lpm7613 chromosome 1	3261562	1229311	1235248	3261562		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1229311_1230385_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1230369_1230984_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1230980_1232189_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1232196_1232664_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1232789_1234427_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1234423_1235248_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 4
NZ_LT598657	Legionella pneumophila strain Lpm7613 isolate Lpm7613 chromosome 1	3261562	2139046	2149170	3261562		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2139046_2140735_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2140866_2141874_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2141997_2143323_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2143341_2144490_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2144698_2145811_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2145906_2147046_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2147235_2149170_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 5
NZ_LT598657	Legionella pneumophila strain Lpm7613 isolate Lpm7613 chromosome 1	3261562	2178032	2228875	3261562	transposase,integrase	Wolbachia_phage(33.33%)	53	2177943:2177992	2223424:2223473
2177943:2177992	attL	GGCTTCGAACCAAGGTGTCGGGGGTTCGAGTCCCTCCGAGCGCGCCATTT	NA	NA	NA	NA
WP_014326935.1|2178032_2179193_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	45.8	1.5e-85
WP_014326936.1|2179527_2180532_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	32.9	8.0e-48
WP_027220144.1|2180552_2181038_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016356949.1|2181051_2182326_-	MFS transporter	NA	NA	NA	NA	NA
WP_014326939.1|2182303_2182816_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016356950.1|2182857_2183541_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016356951.1|2183567_2184371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027220146.1|2184454_2184694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011947213.1|2185045_2185441_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_014326944.1|2185455_2187363_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.5	1.1e-143
WP_011947217.1|2187932_2188103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027220149.1|2188367_2190503_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.0	1.0e-145
WP_016356954.1|2190579_2193729_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011947220.1|2193738_2194995_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011947221.1|2194991_2196236_-	TolC family protein	NA	NA	NA	NA	NA
WP_016356955.1|2196499_2197162_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016356956.1|2197346_2198219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027220151.1|2198181_2198547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011947232.1|2198566_2198764_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_011947233.1|2198760_2199195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016356957.1|2199191_2199800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011947235.1|2199792_2200629_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016356958.1|2200630_2201089_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016356959.1|2201079_2201778_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_011947238.1|2201787_2202111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014843982.1|2202113_2202377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016356960.1|2202379_2202766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015961513.1|2202774_2203125_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_014326960.1|2203129_2203792_+	DUF2895 family protein	NA	NA	NA	NA	NA
WP_016356961.1|2203778_2204561_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016356962.1|2204557_2205871_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016356963.1|2205827_2206217_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_016356964.1|2206227_2209002_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_016356965.1|2208976_2209972_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016356966.1|2209981_2211364_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016356967.1|2211365_2212934_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_027220156.1|2212936_2213146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027220157.1|2213159_2213492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014326970.1|2213495_2215502_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_016356968.1|2215503_2215989_+	DUF1845 family protein	NA	NA	NA	NA	NA
WP_025519966.1|2216073_2216283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014326973.1|2216429_2217398_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_016356969.1|2218056_2218860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016356970.1|2218852_2219752_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_014326976.1|2220087_2220348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016356971.1|2220410_2220917_+	antirestriction protein ArdA	NA	U5P3Z5	Mycobacterium_phage	39.5	4.2e-21
WP_014326978.1|2221018_2221636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016356972.1|2221668_2222160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014326980.1|2222170_2222989_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.4e-63
WP_015444229.1|2223593_2225012_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
2223424:2223473	attR	GGCTTCGAACCAAGGTGTCGGGGGTTCGAGTCCCTCCGAGCGCGCCATTT	NA	NA	NA	NA
WP_010947829.1|2225044_2226220_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2226272_2227298_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010947831.1|2227456_2228875_+|transposase	IS4-like element ISLpn4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	1.5e-55
