The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	1134491	1236157	4756780	tail,head,plate,transposase,integrase,lysis,terminase,portal,capsid,tRNA	Erwinia_phage(23.21%)	97	1192606:1192621	1212659:1212674
WP_023209822.1|1134491_1135739_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.0e-140
WP_001592532.1|1135988_1136489_-	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	61.3	8.9e-40
WP_023209823.1|1136948_1139282_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
WP_023209824.1|1139296_1139617_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216600.1|1139613_1139841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980374.1|1139837_1140386_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	9.7e-32
WP_001673700.1|1140382_1140649_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	73.9	3.6e-32
WP_023209022.1|1141186_1141924_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	9.9e-80
WP_000984211.1|1141920_1142166_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_023209739.1|1142182_1142749_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	64.3	4.8e-58
WP_023212151.1|1143061_1145803_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_023209741.1|1145827_1147015_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	8.4e-105
WP_077910862.1|1147632_1148796_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023209743.1|1148803_1150984_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533845.1|1150980_1152390_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023209744.1|1152454_1163929_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1164543_1165026_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1165175_1165652_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1165641_1165932_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1166097_1166436_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1166584_1168246_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1168331_1169210_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1169334_1169925_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_088546117.1|1169932_1170148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|1170104_1170563_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_001525071.1|1170671_1171277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127908301.1|1171406_1172693_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023209052.1|1172712_1173504_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1173669_1175031_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1175283_1175532_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023209053.1|1175550_1176099_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469813.1|1176143_1176911_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1176951_1177299_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023209054.1|1177460_1177679_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	79.2	8.0e-30
WP_024146765.1|1177754_1178918_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	80.3	1.4e-168
WP_023209056.1|1178914_1179379_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	69.5	1.8e-58
WP_023209057.1|1179390_1181838_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	75.6	0.0e+00
WP_023209058.1|1181827_1181950_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	9.4e-12
WP_023209059.1|1181982_1182276_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.5	5.9e-28
WP_023209060.1|1182336_1182855_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	1.0e-78
WP_023209061.1|1182867_1184061_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.6	1.1e-184
WP_023209062.1|1184184_1184607_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_023209063.1|1184607_1186512_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	77.5	2.3e-96
WP_023209064.1|1186519_1187053_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.3	4.5e-90
WP_023209065.1|1187045_1187954_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	82.8	1.1e-136
WP_023209066.1|1187959_1188310_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	71.6	4.0e-39
WP_023209067.1|1188306_1188948_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	79.8	1.4e-90
WP_023209068.1|1189144_1190194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209069.1|1190259_1190706_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	3.9e-47
WP_023209070.1|1190698_1191166_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	1.1e-60
WP_023209072.1|1191261_1191687_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.6	5.6e-43
WP_023209073.1|1191683_1192193_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.7	1.2e-79
WP_001354073.1|1192176_1192398_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.4e-26
WP_023209074.1|1192388_1192592_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	80.6	1.1e-25
WP_023209075.1|1192591_1193098_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	4.9e-62
1192606:1192621	attL	CAATACAGCGCGCTTT	NA	NA	NA	NA
WP_023209076.1|1193197_1193947_-|terminase	terminase endonuclease subunit	terminase	A0A0M4QWM0	Salmonella_phage	70.8	1.7e-74
WP_023209077.1|1193950_1195018_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.9	7.9e-171
WP_023209078.1|1195073_1195928_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	74.3	4.8e-118
WP_023209079.1|1196093_1197863_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.1	1.4e-300
WP_023209080.1|1197864_1198893_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	2.5e-169
WP_023209081.1|1199206_1199464_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	51.4	1.3e-15
WP_001222154.1|1199604_1199838_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_023209082.1|1199841_1200024_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	96.7	2.6e-26
WP_023209083.1|1200137_1202366_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.2	0.0e+00
WP_023209084.1|1202356_1202638_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	53.8	2.6e-12
WP_023209085.1|1202634_1202907_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	77.3	7.9e-35
WP_023209086.1|1202907_1203129_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	93.2	3.9e-32
WP_023209087.1|1203128_1203347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023209088.1|1203346_1203574_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	96.0	2.9e-30
WP_023209089.1|1203641_1203980_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	91.1	8.9e-52
WP_023209090.1|1203943_1204144_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.1e-28
WP_023209091.1|1204151_1204661_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	88.2	2.8e-81
WP_162492984.1|1204692_1204824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023209093.1|1205043_1205901_+	helix-turn-helix domain-containing protein	NA	Q6K1G0	Salmonella_virus	54.2	1.4e-85
WP_023209094.1|1205909_1206248_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	62.5	5.4e-33
WP_023209095.1|1206270_1206771_+	PH domain-containing protein	NA	A0A1D9C9Q4	Salinivibrio_phage	60.8	4.4e-47
WP_024146766.1|1206856_1207888_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	81.0	2.0e-166
WP_001030985.1|1208157_1209378_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1209370_1209889_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1210329_1211400_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1211409_1212531_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210992.1|1212588_1213497_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
1212659:1212674	attR	AAAGCGCGCTGTATTG	NA	NA	NA	NA
WP_000200077.1|1213457_1214618_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1214718_1214766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1214869_1215208_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1215479_1216217_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1216348_1217329_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_023209097.1|1217325_1218057_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1218186_1220760_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000502119.1|1220948_1221407_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_023209423.1|1227893_1229195_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264478.1|1229191_1229515_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1229559_1230915_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082639.1|1231029_1233690_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183649.1|1233743_1234424_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1234496_1234916_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_023209424.1|1235119_1236157_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	1618200	1647769	4756780	tail,protease,holin	Salmonella_phage(33.33%)	32	NA	NA
WP_023209631.1|1618200_1618695_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228065.1|1619108_1619600_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1619589_1619853_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778090.1|1619849_1622336_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091679.1|1622342_1623038_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1623024_1623894_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1624009_1624459_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1624468_1625071_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_064173735.1|1625091_1625709_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	8.2e-11
WP_000990027.1|1625705_1626365_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_064173736.1|1626416_1627154_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074113.1|1627150_1627363_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_023209262.1|1627359_1627839_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_023209263.1|1627835_1629767_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1629763_1630321_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_064173723.1|1630317_1631361_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1631404_1632052_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1632781_1633345_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001142121.1|1633536_1633725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023209199.1|1633711_1633900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624225.1|1634028_1634820_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1635117_1635321_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1635489_1637856_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_010989045.1|1639187_1639556_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1639584_1640916_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1641212_1641542_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1642133_1643375_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1643377_1643905_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1644282_1644726_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1644779_1646609_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1646947_1647238_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1647265_1647769_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	1719821	1728992	4756780	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1719821_1720769_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1720752_1721484_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1721464_1721572_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1721631_1722363_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1722585_1724271_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1724267_1724987_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1725033_1725501_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1725557_1726088_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1726259_1726718_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1726958_1728992_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	1797262	1807768	4756780		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023209799.1|1797262_1798666_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.2	5.2e-21
WP_000981469.1|1798843_1799737_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1800113_1801199_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1801198_1802098_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_023194347.1|1802145_1803024_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1803024_1803576_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018227.1|1803581_1804574_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1804570_1805344_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1805348_1806428_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1806454_1807768_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	1901705	1908955	4756780		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1901705_1902125_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1902127_1903396_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1903850_1904063_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1904073_1904262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1904521_1905715_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1906364_1906676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377048.1|1906755_1907451_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
WP_001157315.1|1907524_1908955_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	2015171	2066751	4756780	head,tail,holin,plate,lysis,integrase	Salmonella_phage(20.83%)	63	2016252:2016281	2062770:2062799
WP_064173738.1|2015171_2016251_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.0e-101
WP_001575998.1|2016225_2016504_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
2016252:2016281	attL	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
WP_000743301.1|2016564_2016993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280163.1|2017091_2017277_-	DUF1187 family protein	NA	NA	NA	NA	NA
WP_001126031.1|2017323_2018154_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_064173739.1|2018146_2020837_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_000799627.1|2020977_2021313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613374.1|2021387_2021672_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_001674119.1|2022053_2022209_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_023165607.1|2022518_2022944_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_001033909.1|2023040_2023295_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001669257.1|2023281_2023776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020839439.1|2023820_2024696_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	58.5	1.2e-31
WP_023209016.1|2024702_2025455_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	76.5	6.5e-103
WP_001604747.1|2025472_2025868_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	5.8e-18
WP_024146760.1|2026133_2027285_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001237395.1|2027681_2029661_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_079902958.1|2030348_2030597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209019.1|2030660_2031260_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	5.5e-97
WP_021000145.1|2031256_2031451_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_023209020.1|2031447_2031750_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	78.3	8.0e-36
WP_001204682.1|2031749_2032112_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	1.3e-53
WP_058656906.1|2032232_2034506_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_000658042.1|2034865_2035054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209768.1|2036154_2036457_+|holin	phage-holin protein	holin	NA	NA	NA	NA
WP_023209769.1|2036434_2036974_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.1	1.1e-75
WP_023209770.1|2037282_2037747_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	77.9	1.8e-58
WP_023209771.1|2037921_2038122_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_023209772.1|2038185_2038812_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.1	6.8e-106
WP_023209773.1|2038814_2040434_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.4	8.7e-262
WP_023209774.1|2040433_2041954_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.1	1.2e-106
WP_023209775.1|2041994_2042684_+|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	46.7	7.6e-50
WP_023209776.1|2042680_2044027_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.9	6.0e-67
WP_023209777.1|2044028_2044511_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
WP_023209778.1|2044510_2045539_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	49.1	3.5e-83
WP_023209779.1|2045542_2045890_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.1	1.5e-09
WP_023209780.1|2045896_2046352_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_023209781.1|2046345_2046930_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	5.5e-17
WP_023209782.1|2046926_2047292_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.9e-21
WP_000094504.1|2047276_2047822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209784.1|2047802_2049287_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.6	2.0e-95
WP_023209785.1|2049287_2049734_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	1.8e-20
WP_000101348.1|2049733_2050138_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|2050179_2050362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209786.1|2050345_2052517_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	70.9	8.3e-50
WP_023209787.1|2052513_2053224_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_023209788.1|2053223_2053526_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	5.9e-23
WP_023209789.1|2053522_2054392_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	2.0e-31
WP_001534334.1|2054372_2055050_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	2.7e-31
WP_001191865.1|2055062_2055419_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|2055415_2056657_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181748.1|2056658_2057261_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_023209790.1|2057250_2058702_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.7	8.6e-43
WP_023209791.1|2058701_2059277_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.1	1.1e-89
WP_071785559.1|2059343_2059580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071785561.1|2059878_2059995_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	100.0	1.7e-10
WP_023209792.1|2060126_2060828_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_064173740.1|2061689_2062769_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.2	5.7e-100
WP_072209490.1|2062765_2063872_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	66.7	1.1e-55
2062770:2062799	attR	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
WP_001013467.1|2063902_2064133_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2064186_2064720_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2064976_2065144_-	lytic enzyme	NA	NA	NA	NA	NA
WP_000275418.1|2065869_2066751_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
>prophage 7
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	2867555	2965696	4756780	tail,holin,lysis,terminase,portal,protease,tRNA	Salmonella_phage(40.0%)	97	NA	NA
WP_023196027.1|2867555_2868236_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	66.8	1.5e-74
WP_000374046.1|2868854_2869514_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_001587004.1|2869600_2869930_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072882.1|2869926_2870208_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2870256_2871036_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2871061_2871610_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2871824_2873036_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2873093_2873411_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2873455_2873869_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2874042_2874705_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2874799_2875258_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_023209443.1|2875293_2877348_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2877471_2877918_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_023194292.1|2877936_2880090_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2880076_2880682_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2880898_2881408_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2881765_2882818_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2882889_2883342_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2883527_2885288_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2885356_2885875_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2885974_2886142_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2886397_2886961_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2886957_2888598_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2888602_2889856_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_023209444.1|2889870_2891778_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	1.9e-53
WP_001086485.1|2891790_2893899_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2893997_2895107_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2895103_2895646_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2895811_2896822_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193787.1|2897029_2899642_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	2.2e-20
WP_000497441.1|2900068_2900260_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2900530_2901217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209446.1|2901576_2902248_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023209447.1|2902240_2903509_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	98.3	6.4e-244
WP_023209448.1|2903511_2903931_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	6.5e-36
WP_023209449.1|2904102_2904321_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.1	8.9e-29
WP_023209450.1|2904905_2905424_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	49.7	1.4e-43
WP_023209451.1|2905438_2908117_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	66.0	5.8e-154
WP_000178849.1|2908170_2908413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2908451_2909327_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2911873_2912578_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2912475_2913213_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2913222_2913918_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2914007_2914541_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000978295.1|2914966_2915299_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077910844.1|2915295_2918283_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.9	8.2e-266
WP_010989009.1|2918362_2918692_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2918688_2919087_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2919132_2919882_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|2919893_2920295_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|2920291_2920858_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2920838_2921138_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_023209454.1|2921130_2921454_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_077910846.1|2921544_2923626_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	6.3e-265
WP_023209456.1|2923549_2925097_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.2e-177
WP_000196190.1|2925093_2925300_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077910840.1|2925296_2927435_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.5	2.2e-289
WP_000371784.1|2927391_2927925_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_023209458.1|2928132_2928645_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	88.7	8.4e-70
WP_021000642.1|2928641_2929256_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	2.0e-110
WP_021000643.1|2929255_2929537_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294875.1|2929523_2929913_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_000798706.1|2930129_2930579_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2930714_2930840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749676.1|2931238_2932036_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	6.8e-151
WP_001617856.1|2932025_2932172_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_023203964.1|2932168_2932780_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	3.6e-91
WP_020898613.1|2932988_2933591_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.2e-109
WP_001217669.1|2934005_2934239_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_077910841.1|2934530_2934821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023209460.1|2935061_2935370_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	95.9	5.4e-48
WP_023209461.1|2935380_2936130_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	2.1e-138
WP_023209462.1|2936132_2937116_-	replication protein	NA	H6WRX7	Salmonella_phage	99.0	2.4e-161
WP_010835408.1|2937200_2937575_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000370145.1|2937540_2937780_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2937899_2938310_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077910842.1|2938353_2938620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917690.1|2938612_2938783_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	3.9e-08
WP_023209463.1|2938923_2941839_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	93.4	0.0e+00
WP_077951018.1|2941801_2942959_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	6.1e-217
WP_023209464.1|2943001_2943241_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	1.3e-36
WP_000065276.1|2943281_2943530_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262314.1|2943574_2944867_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.5	1.3e-252
WP_000191406.1|2945061_2946264_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893197.1|2946344_2947778_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544856.1|2948023_2949238_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|2949555_2950017_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023209465.1|2950217_2951618_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	1.3e-80
WP_000977709.1|2952223_2953315_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2953499_2954690_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2954751_2955399_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2955426_2955975_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925877.1|2956234_2958082_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572733.1|2958426_2962893_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|2962892_2963597_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2963577_2964900_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|2964892_2965696_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	3016083	3023394	4756780	protease,integrase	Ralstonia_phage(16.67%)	7	3010881:3010895	3022130:3022144
3010881:3010895	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_024146804.1|3016083_3016488_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.7	2.0e-21
WP_001117984.1|3016621_3016819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3017031_3019308_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3019338_3019659_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3019981_3020203_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3020332_3022279_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
3022130:3022144	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201750.1|3022275_3023394_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_LT571437	Salmonella enterica subsp. enterica serovar Java strain NCTC5706 chromosome 1	4756780	4101712	4114400	4756780	integrase,transposase	Enterobacteria_phage(80.0%)	13	4110945:4110961	4119454:4119470
WP_102136070.1|4101712_4102823_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	8.4e-06
WP_023209281.1|4104471_4106805_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_023209280.1|4106819_4107140_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023209279.1|4107136_4107397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023209278.1|4107469_4107919_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	71.7	4.1e-44
WP_023209277.1|4107911_4108211_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.7	1.4e-27
WP_023209276.1|4108200_4108803_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	75.2	6.2e-48
WP_023209275.1|4108799_4109066_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_023209022.1|4109616_4110354_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	9.9e-80
WP_000984211.1|4110350_4110596_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_023209937.1|4110612_4111179_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	62.2	5.0e-55
4110945:4110961	attL	GCCCGCGATGATAAAAA	NA	NA	NA	NA
WP_023225535.1|4111579_4112506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023209933.1|4113122_4114400_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.4e-73
4119454:4119470	attR	TTTTTATCATCGCGGGC	NA	NA	NA	NA
