The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT571436	Neisseria weaveri strain NCTC13585 chromosome 1	2188497	869887	954907	2188497	tail,capsid,plate,transposase,holin,integrase	Burkholderia_phage(24.32%)	97	869791:869821	941072:941102
869791:869821	attL	CAAAGGCCGTCTGAATTTTCAGACGGCCTTT	NA	NA	NA	NA
WP_036494142.1|869887_871408_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.3	1.3e-81
WP_004284620.1|871795_872080_+	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	39.8	2.1e-09
WP_064130479.1|872183_872600_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	53.6	5.5e-35
WP_064130480.1|872826_873267_-	phage virion morphogenesis protein	NA	X4YTG5	Pseudomonas_phage	43.8	2.5e-22
WP_064130481.1|873259_873469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130482.1|873471_874377_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	44.4	6.3e-60
WP_064130483.1|874373_875879_-	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	44.8	2.8e-105
WP_064130484.1|875901_877410_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	68.4	1.3e-198
WP_064130485.1|877406_877952_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	46.9	1.2e-37
WP_064130486.1|877953_878271_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	60.8	7.9e-26
WP_064130487.1|878267_878591_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	36.5	6.2e-10
WP_064130488.1|878595_878823_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	43.6	9.0e-08
WP_064130489.1|878819_879050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172795928.1|879046_879220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130491.1|879236_879647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130492.1|879633_879885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130493.1|879897_880416_-	TIGR02594 family protein	NA	A0A0A1IUP1	Pseudomonas_phage	60.2	1.1e-56
WP_064130494.1|880499_880988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130495.1|880984_881953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130496.1|882269_882815_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_064130497.1|882906_883152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130498.1|883172_883655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082887998.1|883756_883933_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_064130499.1|883943_884240_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.4	8.7e-19
WP_064130500.1|884246_884540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064131011.1|885489_887256_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	47.1	4.9e-141
WP_064130501.1|887260_888400_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	51.0	3.6e-97
WP_064130502.1|888401_888659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130503.1|888655_888847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130504.1|888834_889050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130505.1|889051_889546_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	43.4	5.0e-27
WP_064130506.1|889529_889988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172795929.1|889974_890127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130507.1|890119_890725_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	54.4	1.9e-57
WP_147278330.1|890724_890925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130509.1|890994_891267_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	52.2	1.2e-17
WP_064130510.1|891339_891810_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	32.9	1.8e-10
WP_004282979.1|891809_892157_+	DNA-binding protein	NA	A4JWM4	Burkholderia_virus	45.9	7.1e-20
WP_064130511.1|892387_893530_+	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	39.9	1.4e-64
WP_064130512.1|893556_894492_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	41.1	3.8e-52
WP_064130513.1|894534_894801_+	hypothetical protein	NA	A0MZD7	Enterobacteria_phage	31.9	2.1e-08
WP_064130514.1|894801_895134_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_064130515.1|895136_895427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130516.1|895426_895852_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	30.1	3.6e-10
WP_064130517.1|895853_896366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130518.1|896370_897765_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	45.7	2.6e-105
WP_064130519.1|897787_898303_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	51.8	2.1e-44
WP_064130520.1|898440_898719_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_064131012.1|898756_898894_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_156503410.1|898917_899094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130521.1|899134_901834_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	31.2	7.6e-77
WP_064130522.1|901833_902730_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	38.0	1.3e-20
WP_064130523.1|902726_902945_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	39.7	1.2e-09
WP_064130524.1|902932_904036_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	47.2	1.3e-72
WP_082887999.1|904016_904598_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.4	1.1e-20
WP_064130526.1|904660_905092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064130527.1|905214_905595_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_064130528.1|905585_906728_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	31.9	1.9e-37
WP_064130529.1|906720_907299_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	49.2	6.6e-47
WP_064130531.1|909663_909936_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	47.0	1.9e-12
WP_064130532.1|910622_911630_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_064130533.1|918255_918549_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_064130534.1|918627_919641_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_064130535.1|920378_921005_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_172795930.1|921008_921875_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_064130537.1|921890_923774_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_064130538.1|923770_924445_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_064130539.1|924611_927422_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_064130540.1|927559_929854_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_064130541.1|929883_930153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036494370.1|930195_930390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004284067.1|930711_931191_-	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_004284068.1|931241_932042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004284069.1|932147_932399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004285521.1|932501_933290_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004285522.1|933503_934457_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_050809986.1|934566_937767_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_172795931.1|937905_938589_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004284077.1|938997_939282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004284078.1|939419_941045_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.9	9.3e-155
WP_004284080.1|941387_941753_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
941072:941102	attR	CAAAGGCCGTCTGAATTTTCAGACGGCCTTT	NA	NA	NA	NA
WP_004285524.1|941892_942753_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_004284082.1|942890_943151_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004285525.1|943228_943975_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_036494373.1|944015_944552_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004285527.1|944631_945924_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	2.8e-21
WP_064130542.1|946046_946721_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004284088.1|946871_947354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064131013.1|947522_948455_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	53.2	7.3e-80
WP_004284090.1|948565_949171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064130543.1|949290_950142_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_004284093.1|950701_951025_+	TonB family protein	NA	NA	NA	NA	NA
WP_064130544.1|951202_951685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004284096.1|951921_952662_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_064130545.1|952663_954007_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004284098.1|954233_954485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004284099.1|954496_954907_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NZ_LT571436	Neisseria weaveri strain NCTC13585 chromosome 1	2188497	1120631	1128920	2188497	tRNA	Serratia_phage(16.67%)	8	NA	NA
WP_064130620.1|1120631_1121387_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	24.8	9.4e-09
WP_004284187.1|1121598_1121904_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.5	5.3e-11
WP_064130621.1|1121977_1124338_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.7	1.6e-06
WP_064130622.1|1124485_1125475_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.2	3.3e-30
WP_004284179.1|1125761_1126118_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004284178.1|1126130_1126328_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_172795973.1|1126467_1127001_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.0	5.4e-11
WP_064130623.1|1127006_1128920_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	4.5e-124
>prophage 3
NZ_LT571436	Neisseria weaveri strain NCTC13585 chromosome 1	2188497	1269910	1277158	2188497		Enterobacteria_phage(28.57%)	8	NA	NA
WP_064130676.1|1269910_1270924_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.0	3.3e-86
WP_004285872.1|1270975_1271521_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.6	6.9e-46
WP_004282874.1|1271542_1272412_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	60.8	6.0e-100
WP_064130677.1|1272408_1273479_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.3	1.1e-98
WP_064130678.1|1273500_1274292_-	glycosyltransferase family 25 protein	NA	M1PHE5	Moumouvirus	29.4	4.4e-09
WP_064130679.1|1274310_1275231_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_004282870.1|1275243_1276260_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.2	1.3e-13
WP_064130680.1|1276291_1277158_-	glycosyltransferase family 25 protein	NA	A0A1D8KNF8	Synechococcus_phage	27.2	1.0e-06
>prophage 4
NZ_LT571436	Neisseria weaveri strain NCTC13585 chromosome 1	2188497	1396905	1405841	2188497		Gordonia_phage(16.67%)	7	NA	NA
WP_004285802.1|1396905_1398261_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	28.9	2.8e-35
WP_004282747.1|1398609_1400535_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	48.1	1.6e-92
WP_064130724.1|1400659_1403368_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.2	3.1e-14
WP_064130725.1|1403510_1404143_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1V0DYC7	Dinoroseobacter_phage	34.8	3.1e-13
WP_064130726.1|1404147_1404570_-	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	43.9	4.0e-25
WP_004282743.1|1404629_1405130_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_064130727.1|1405184_1405841_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	53.2	3.3e-58
