The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	75727	83406	5048670		Pseudoalteromonas_phage(16.67%)	10	NA	NA
WP_042998301.1|75727_76705_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.0	5.6e-06
WP_042998302.1|76719_77706_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	5.1e-39
WP_109739798.1|77726_78293_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	5.0e-55
WP_044255950.1|78289_78865_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_042325045.1|78833_79388_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_044263650.1|79394_80120_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.9e-22
WP_109739797.1|80167_81601_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025078.1|81623_81911_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_042325036.1|82026_82518_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_012908509.1|82551_83406_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 2
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	1886786	1932885	5048670	terminase,integrase,tail,coat	Salmonella_phage(32.61%)	56	1883487:1883502	1889194:1889209
1883487:1883502	attL	ACCTGTTGCTTGCTCA	NA	NA	NA	NA
WP_109740663.1|1886786_1888016_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	95.8	5.6e-237
WP_109740664.1|1887993_1888278_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	77.7	9.5e-39
WP_042997814.1|1888324_1888564_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	79.2	4.4e-29
WP_090050891.1|1888604_1889687_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	51.5	1.8e-98
1889194:1889209	attR	TGAGCAAGCAACAGGT	NA	NA	NA	NA
WP_109740665.1|1889697_1892706_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	62.4	0.0e+00
WP_109740666.1|1892834_1893122_-	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	83.2	5.1e-40
WP_109740667.1|1893207_1893366_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	94.2	4.5e-22
WP_109740560.1|1893371_1893509_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_109740668.1|1893501_1893774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043001846.1|1894054_1894264_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	3.6e-27
WP_042999727.1|1894291_1894702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042999728.1|1894823_1895210_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	88.1	1.5e-55
WP_109740669.1|1895313_1895547_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	81.8	1.3e-30
WP_109740800.1|1895597_1896092_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	55.9	1.0e-40
WP_090050882.1|1896427_1897408_+	replication protein	NA	H6WRX7	Salmonella_phage	75.4	9.3e-118
WP_109740670.1|1897410_1898160_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	92.8	1.3e-132
WP_109740553.1|1898175_1898946_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	25.2	1.9e-09
WP_109740552.1|1898942_1899488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069731.1|1899484_1899976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081097265.1|1900302_1900806_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	56.1	5.2e-40
WP_016156704.1|1901034_1901292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010299.1|1901288_1903268_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.4	2.7e-201
WP_061069732.1|1903411_1903645_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	84.4	3.5e-31
WP_071888372.1|1903761_1904010_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	93.9	1.3e-39
WP_109740547.1|1904044_1904647_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	93.0	2.8e-104
WP_032645668.1|1904652_1904853_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	66.7	3.7e-21
WP_109740546.1|1904843_1905137_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	98.9	3.7e-46
WP_109740671.1|1905133_1905490_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	89.8	2.1e-59
WP_109740544.1|1905486_1905627_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	91.1	4.2e-16
WP_109740543.1|1905623_1906421_+	antitermination protein	NA	H6WRZ1	Salmonella_phage	93.2	1.5e-142
WP_109740542.1|1907046_1907352_+	hypothetical protein	NA	O64361	Escherichia_phage	83.2	4.4e-42
WP_109740650.1|1907351_1907879_+	lysozyme	NA	G9L6J6	Escherichia_phage	86.0	5.6e-85
WP_162300691.1|1907875_1908418_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	52.0	5.9e-13
WP_042999754.1|1909258_1909630_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	69.5	4.9e-43
WP_109740540.1|1909824_1910457_+	hypothetical protein	NA	F1C5D5	Cronobacter_phage	83.3	4.3e-100
WP_109740539.1|1910489_1910978_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	82.7	6.2e-54
WP_109740672.1|1910974_1912546_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	90.1	1.3e-299
WP_109740673.1|1912549_1913953_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	73.0	1.4e-196
WP_109740674.1|1913939_1915052_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	56.0	5.3e-117
WP_042999761.1|1915156_1915921_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	69.3	9.0e-92
WP_042999762.1|1916007_1917144_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	75.7	2.3e-160
WP_042999764.1|1917521_1917914_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	43.8	3.2e-13
WP_042999765.1|1917915_1918299_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	42.9	8.6e-19
WP_109740675.1|1918300_1918933_+	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	32.4	2.0e-12
WP_109740676.1|1918929_1919322_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_109740677.1|1919348_1920509_+	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	40.9	6.2e-60
WP_109740678.1|1920569_1921037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753859.1|1921186_1921357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740679.1|1921396_1924732_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	36.7	9.0e-96
WP_109740680.1|1924731_1925196_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.4	1.7e-48
WP_109740681.1|1925192_1925675_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	70.6	2.2e-59
WP_109740801.1|1925761_1926247_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_109740682.1|1926316_1926697_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	78.4	1.3e-56
WP_109740683.1|1926693_1929411_+	MoaD/ThiS family protein	NA	A0A286S259	Klebsiella_phage	58.8	0.0e+00
WP_109740684.1|1929467_1931681_+	SGNH/GDSL hydrolase family protein	NA	A0A1B1W279	Salmonella_phage	52.9	1.0e-31
WP_109740685.1|1931823_1932885_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.4	1.4e-10
>prophage 3
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	2158791	2242120	5048670	terminase,tRNA,holin,portal,capsid,head,tail,integrase,protease	Enterobacteria_phage(35.56%)	93	2158576:2158596	2199094:2199114
2158576:2158596	attL	TATCCATTTAACTAAGGGGAC	NA	NA	NA	NA
WP_109740689.1|2158791_2159961_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	83.5	4.3e-194
WP_109740690.1|2160016_2160877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174217525.1|2160901_2161087_-	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	59.6	8.1e-15
WP_109740692.1|2161168_2161588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740693.1|2161591_2161879_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	60.8	1.7e-27
WP_109740694.1|2162531_2162756_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	45.6	2.4e-13
WP_109740695.1|2162752_2162974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740696.1|2162942_2163212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096846328.1|2163208_2163433_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	48.6	3.9e-11
WP_109740698.1|2163551_2164361_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.8	3.1e-74
WP_109740699.1|2164436_2165249_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_109740700.1|2165291_2165651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740701.1|2166032_2167106_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	37.1	7.5e-52
WP_157959978.1|2167322_2167547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740702.1|2167683_2168394_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.2	8.1e-87
WP_109740703.1|2168501_2168696_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	75.8	3.3e-19
WP_109740704.1|2168774_2169230_+	hypothetical protein	NA	K7PKM9	Enterobacterial_phage	52.0	1.1e-36
WP_109740705.1|2169246_2169717_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	5.0e-61
WP_109740706.1|2169752_2170031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740707.1|2170191_2170467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740708.1|2170459_2171989_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.5	3.2e-205
WP_109740709.1|2171985_2172957_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	61.4	3.5e-109
WP_109740802.1|2172926_2173571_+	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	60.0	5.3e-45
WP_109740710.1|2173567_2174212_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.5	1.1e-82
WP_109740711.1|2174201_2174621_+	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	67.2	1.7e-39
WP_109740712.1|2174769_2175117_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	72.0	8.0e-40
WP_109740713.1|2175130_2175613_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	71.3	1.8e-66
WP_109740714.1|2175609_2176179_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	72.0	2.0e-59
WP_109740715.1|2176217_2176418_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	53.3	3.8e-10
WP_109740716.1|2177615_2177852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740717.1|2177861_2178203_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.0	5.1e-47
WP_109740718.1|2178320_2178785_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	2.4e-47
WP_109740719.1|2178738_2180481_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.4	1.2e-136
WP_109740720.1|2180480_2181785_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.8	8.4e-215
WP_109740721.1|2181798_2182647_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	83.2	3.6e-126
WP_109740722.1|2182656_2183874_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.6	3.1e-195
WP_109740723.1|2183915_2184104_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	56.7	4.7e-10
WP_109740724.1|2184103_2184430_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	86.1	5.2e-49
WP_109740725.1|2184493_2184706_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	64.4	5.6e-12
WP_109740726.1|2184707_2185040_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	91.8	2.1e-53
WP_109740727.1|2185032_2185572_+	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	91.6	6.1e-87
WP_109740728.1|2185568_2185934_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	71.1	1.1e-47
WP_109740729.1|2185992_2186490_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	72.5	2.5e-63
WP_109740730.1|2186542_2186923_+|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	75.8	3.4e-44
WP_109740732.1|2187289_2187727_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	31.0	3.3e-06
WP_109740733.1|2187790_2190271_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	51.3	2.4e-194
WP_109740734.1|2190285_2190879_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	87.3	3.7e-101
WP_099433322.1|2190878_2191463_+	hypothetical protein	NA	S4TND4	Salmonella_phage	89.7	2.6e-99
WP_109740735.1|2191469_2191868_+	hypothetical protein	NA	S4TR39	Salmonella_phage	80.3	4.7e-60
WP_109740736.1|2191867_2194585_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	84.9	0.0e+00
WP_109740737.1|2194587_2195550_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	64.7	3.1e-118
WP_104446768.1|2198284_2198524_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	87.3	7.2e-32
WP_044258449.1|2199189_2200131_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	90.2	4.3e-152
2199094:2199114	attR	TATCCATTTAACTAAGGGGAC	NA	NA	NA	NA
WP_044258452.1|2200421_2201177_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_042999959.1|2201238_2202579_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_042317736.1|2202952_2203237_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_099434018.1|2203417_2204728_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_109740445.1|2204727_2206887_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_042999962.1|2207079_2207565_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_042999963.1|2207782_2208334_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_042999964.1|2208502_2209435_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_054175943.1|2209461_2210547_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	7.0e-90
WP_109740444.1|2210550_2211375_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_042999967.1|2211374_2212184_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_044258458.1|2212183_2212732_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_042999969.1|2212763_2213048_+	YfcL family protein	NA	NA	NA	NA	NA
WP_082366160.1|2213484_2213727_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_061069817.1|2214064_2215009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740443.1|2215056_2216472_+	pilus assembly protein N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109740442.1|2216487_2217633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042999974.1|2217693_2218983_+	CpaF family protein	NA	NA	NA	NA	NA
WP_109740441.1|2218933_2219893_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_157959979.1|2220050_2220752_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_109740439.1|2220745_2222026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042999976.1|2222160_2222523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150546940.1|2222612_2223134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042999978.1|2223152_2223647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740438.1|2223695_2224130_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_044258470.1|2224131_2224644_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_109740437.1|2224852_2225539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740436.1|2225579_2227307_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_109740435.1|2227372_2228029_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_042999984.1|2228370_2228898_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_042999985.1|2228938_2229298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157959980.1|2229522_2231961_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_109740433.1|2232117_2234118_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_044258478.1|2234276_2235494_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_042999989.1|2235534_2236065_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_109740432.1|2236811_2237990_+	MFS transporter	NA	NA	NA	NA	NA
WP_043001872.1|2237986_2238988_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_044258488.1|2239091_2240228_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	1.2e-18
WP_042999992.1|2240294_2241308_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_042999993.1|2241307_2242120_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	2445445	2453868	5048670	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_109740398.1|2445445_2446393_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.7e-07
WP_109740397.1|2446376_2447108_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042318015.1|2447088_2447196_-	protein YohO	NA	NA	NA	NA	NA
WP_043000151.1|2447255_2447987_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	89.9	8.3e-103
WP_043000152.1|2448210_2449899_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.5	2.4e-278
WP_043000153.1|2449891_2450611_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_043001885.1|2450657_2451128_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.8	3.1e-63
WP_043000154.1|2451172_2451631_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	66.7	1.1e-49
WP_043000155.1|2451834_2453868_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.7	3.0e-54
>prophage 5
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	2511087	2519326	5048670		Enterobacteria_phage(42.86%)	8	NA	NA
WP_109740375.1|2511087_2512491_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.9	1.8e-21
WP_044266075.1|2512668_2513562_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.4	1.3e-46
WP_109740374.1|2513942_2515028_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_109740373.1|2515027_2515927_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_109740372.1|2515978_2516857_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	9.3e-109
WP_157959988.1|2516859_2517417_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.7	5.1e-52
WP_157959981.1|2517533_2518721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740369.1|2518717_2519326_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	29.9	2.9e-08
>prophage 6
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	2547269	2587140	5048670	terminase,holin,portal,capsid,head,tail,integrase,protease	Salmonella_phage(23.4%)	55	2544779:2544794	2550899:2550914
2544779:2544794	attL	TTCCGTCTGGCCGCTG	NA	NA	NA	NA
WP_044257009.1|2547269_2548451_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	89.8	3.0e-211
WP_044257011.1|2548431_2548623_-	AlpA family phage regulatory protein	NA	A0A0M4RTZ2	Salmonella_phage	78.7	2.3e-20
WP_044257093.1|2548776_2549067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069903.1|2549348_2549594_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	53.8	2.0e-16
WP_109740741.1|2549694_2549919_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.1	1.1e-18
WP_109740742.1|2549919_2550261_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	76.1	1.4e-44
WP_109740743.1|2550260_2551007_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	85.4	1.3e-116
2550899:2550914	attR	TTCCGTCTGGCCGCTG	NA	NA	NA	NA
WP_109740744.1|2551003_2551285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740745.1|2551284_2551692_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.6	2.7e-26
WP_109740746.1|2551881_2552136_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	78.6	1.7e-31
WP_109740747.1|2552128_2552494_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	86.0	4.8e-51
WP_109740748.1|2552486_2552678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740749.1|2552785_2553172_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.0	5.4e-37
WP_109740750.1|2553238_2553544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740751.1|2553733_2554393_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	69.9	6.5e-91
WP_109740752.1|2554503_2554719_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109740753.1|2554746_2555688_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	71.2	9.6e-104
WP_109740754.1|2555702_2556584_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	65.3	4.6e-84
WP_104446606.1|2556580_2557963_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	69.8	6.2e-176
WP_099433526.1|2557949_2558315_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	62.3	1.8e-37
WP_109740755.1|2558314_2559097_+	antitermination protein	NA	F1C595	Cronobacter_phage	77.5	2.2e-109
WP_044257038.1|2559300_2559495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081097267.1|2559668_2559998_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	94.5	9.3e-54
WP_044257042.1|2559984_2560404_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.4	5.7e-40
WP_044257044.1|2560406_2560940_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	1.9e-11
WP_044257046.1|2560979_2561180_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	2.2e-18
WP_109740756.1|2561239_2561575_+	hypothetical protein	NA	S4TTH3	Salmonella_phage	66.7	3.8e-39
WP_109740757.1|2562302_2562530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740758.1|2562549_2564007_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	83.5	7.8e-246
WP_109740759.1|2563988_2564579_+	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	88.8	3.3e-102
WP_044257058.1|2564575_2564917_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	92.9	1.1e-60
WP_109740760.1|2564916_2565117_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	59.6	1.4e-12
WP_044257060.1|2565267_2565753_+	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	96.9	3.2e-79
WP_044257061.1|2565759_2567274_+|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	99.8	8.0e-294
WP_044257062.1|2567273_2568548_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.1	3.6e-247
WP_109740761.1|2568565_2569243_+|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.1	3.5e-124
WP_109740762.1|2569245_2570403_+|capsid	phage major capsid protein	capsid	K7PJR8	Enterobacterial_phage	98.4	3.2e-210
WP_109740763.1|2570435_2570762_+|head,tail	phage head-tail connector protein	head,tail	K7PGU9	Enterobacterial_phage	99.1	9.8e-56
WP_109740764.1|2570761_2571100_+|head	phage head closure protein	head	K7PLS1	Enterobacteria_phage	97.3	9.2e-57
WP_044257068.1|2571096_2571546_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	97.3	4.9e-74
WP_109740765.1|2571542_2571890_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	99.1	3.8e-58
WP_109740766.1|2571943_2572414_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	1.3e-80
WP_109740767.1|2572468_2572870_+|tail	phage tail assembly chaperone	tail	K7PGV0	Enterobacterial_phage	98.5	7.3e-69
WP_109740768.1|2572893_2573157_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	93.1	2.3e-39
WP_058681844.1|2573229_2573571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740769.1|2573612_2576870_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	85.5	0.0e+00
WP_109740770.1|2576884_2577478_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	86.3	4.1e-100
WP_044257086.1|2577477_2578062_+	hypothetical protein	NA	S4TND4	Salmonella_phage	89.2	8.3e-98
WP_109740771.1|2578068_2578467_+	hypothetical protein	NA	S4TR39	Salmonella_phage	81.8	1.6e-60
WP_109740772.1|2578466_2581178_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	84.9	0.0e+00
WP_109740773.1|2581185_2582148_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	64.7	7.0e-118
WP_157959982.1|2582157_2584485_+|tail	tail fiber domain-containing protein	tail	A0A0A7DVB5	Escherichia_phage	41.6	1.2e-118
WP_109740774.1|2584782_2585169_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	63.0	3.8e-38
WP_044258215.1|2585275_2585524_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	75.6	1.7e-28
WP_109740356.1|2585967_2587140_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	7.6e-199
>prophage 7
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	3685503	3774282	5048670	lysis,terminase,tRNA,plate,capsid,portal,head,tail,integrase,protease	Salmonella_phage(64.15%)	94	3739341:3739356	3775152:3775167
WP_043001203.1|3685503_3686796_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	6.6e-95
WP_043001204.1|3686888_3688232_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.4	6.6e-82
WP_044256345.1|3688240_3688852_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_109740094.1|3688963_3692947_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_000228469.1|3693081_3693576_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_043001206.1|3694122_3695091_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	5.5e-62
WP_090050621.1|3695205_3696972_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	9.2e-23
WP_109740093.1|3696971_3698693_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.5e-14
WP_109740092.1|3698737_3699442_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3699737_3699956_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_058587856.1|3700031_3700943_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109740091.1|3701049_3701910_+	pirin family protein	NA	NA	NA	NA	NA
WP_043001212.1|3702466_3704743_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	1.1e-166
WP_042320277.1|3704774_3705095_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_042284847.1|3705418_3705640_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_109740090.1|3705715_3707662_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.9	5.0e-38
WP_102948068.1|3707658_3708771_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_109740089.1|3708922_3709873_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_043001216.1|3709869_3711528_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_044264251.1|3711941_3712637_+	aquaporin Z	NA	NA	NA	NA	NA
WP_090050837.1|3712783_3713683_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_109740088.1|3713826_3715479_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_044264207.1|3715489_3716458_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_044327093.1|3716490_3716925_-	DoxX family protein	NA	NA	NA	NA	NA
WP_109740087.1|3717076_3718795_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	4.4e-30
WP_109740086.1|3718833_3719835_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_109740085.1|3719845_3721282_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_043001223.1|3721374_3722388_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109740084.1|3722384_3723215_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_042320310.1|3723211_3723535_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043001225.1|3723663_3724179_+	lipoprotein	NA	NA	NA	NA	NA
WP_043001226.1|3724407_3725136_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.9	5.1e-28
WP_109740083.1|3725152_3725884_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043001228.1|3725890_3726607_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_109740082.1|3726606_3727275_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_043001230.1|3727444_3728176_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044256376.1|3728270_3729416_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	1.6e-28
WP_109740081.1|3729456_3729945_-	YbjO family protein	NA	NA	NA	NA	NA
WP_042320333.1|3730004_3730850_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_043001233.1|3730846_3731800_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_044264253.1|3731809_3732943_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_043001234.1|3733039_3734152_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_043001235.1|3734516_3734993_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_044256380.1|3735083_3735986_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.4e-37
WP_104446264.1|3736046_3736769_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_043001238.1|3736752_3737040_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_109740080.1|3737212_3737476_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	69.2	7.7e-27
WP_099433408.1|3737515_3737893_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_043001240.1|3738161_3739847_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3739341:3739356	attL	CTGATGATCGGCATGA	NA	NA	NA	NA
WP_109740621.1|3740825_3741071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016760.1|3741145_3741361_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	1.2e-22
WP_109740079.1|3741428_3742529_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.9	8.4e-184
WP_063886510.1|3742525_3743011_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	96.2	2.0e-65
WP_109740078.1|3743007_3745800_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	73.4	4.9e-297
WP_000763315.1|3745792_3745912_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_060773291.1|3745926_3746229_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	2.3e-43
WP_094464801.1|3746283_3746799_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.7	3.3e-90
WP_109740077.1|3746808_3747981_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.6	6.2e-209
WP_109740075.1|3748235_3748832_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	59.1	2.4e-68
WP_109740074.1|3748831_3750151_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	83.2	1.4e-121
WP_069907130.1|3750147_3750753_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.0	8.9e-111
WP_069907131.1|3750745_3751654_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	1.8e-144
WP_069907132.1|3751640_3752000_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	91.5	1.6e-54
WP_109740620.1|3751996_3752575_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	95.3	4.5e-104
WP_094464785.1|3752675_3753371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740073.1|3753372_3753822_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	85.1	4.1e-60
WP_109740072.1|3753814_3754246_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	6.0e-69
WP_109740070.1|3754341_3754770_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	94.3	3.7e-63
WP_109740069.1|3754766_3755282_-	lysozyme	NA	E5G6N1	Salmonella_phage	78.4	1.8e-75
WP_000171565.1|3755262_3755478_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|3755481_3755685_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_109740068.1|3755684_3756149_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.1	2.7e-83
WP_109740067.1|3756242_3756893_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	1.1e-114
WP_109740066.1|3756896_3757976_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	95.4	2.0e-185
WP_109740065.1|3757992_3758826_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	83.4	1.9e-119
WP_109740064.1|3758967_3760734_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
WP_109740063.1|3760733_3761768_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.0	1.5e-182
WP_109740062.1|3761787_3762765_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_109740061.1|3762936_3763674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109740060.1|3763666_3764191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150547003.1|3764546_3765692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740057.1|3765781_3766015_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	92.2	6.4e-33
WP_001154444.1|3766026_3766215_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_109740056.1|3766374_3768783_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.5	0.0e+00
WP_109740055.1|3768773_3769631_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.7	2.1e-129
WP_109740054.1|3769627_3769855_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	4.7e-33
WP_001244241.1|3769854_3770088_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.1e-32
WP_000963480.1|3770155_3770497_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_109740619.1|3770460_3770661_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	93.9	1.5e-30
WP_109740053.1|3770668_3771178_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	98.8	8.1e-89
WP_012016743.1|3771210_3771432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164566081.1|3771527_3772121_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.1	2.1e-35
WP_109740052.1|3772130_3773210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109740051.1|3773262_3774282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.2e-104
3775152:3775167	attR	CTGATGATCGGCATGA	NA	NA	NA	NA
>prophage 8
NZ_LT556084	Citrobacter amalonaticus strain 86 chromosome CITRO86	5048670	4714163	4760029	5048670	transposase,integrase,protease,tRNA	Shigella_phage(33.33%)	49	4744477:4744492	4765831:4765846
WP_044255652.1|4714163_4714664_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_044263980.1|4714755_4715463_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_042998055.1|4715542_4716274_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_044255655.1|4716286_4717234_+	glutathione synthase	NA	NA	NA	NA	NA
WP_042998057.1|4717408_4717972_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_109739854.1|4717971_4718388_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_061070563.1|4718401_4719382_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_061070564.1|4719399_4720104_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_042998061.1|4720122_4720689_+	YggT family protein	NA	NA	NA	NA	NA
WP_044255664.1|4720685_4720976_+	YggU family protein	NA	NA	NA	NA	NA
WP_044263976.1|4720983_4721577_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_042998064.1|4721569_4722706_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_109739853.1|4722737_4723745_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_042998066.1|4723878_4724925_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_109739852.1|4725114_4725834_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_042998068.1|4725886_4726213_-	YggL family protein	NA	NA	NA	NA	NA
WP_042998069.1|4726212_4726932_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_109739851.1|4727094_4728147_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_042998071.1|4728174_4728450_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_072040062.1|4728523_4729606_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_044255678.1|4729818_4731075_+	nucleoside permease	NA	NA	NA	NA	NA
WP_109739850.1|4731170_4733306_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_042998075.1|4733733_4734441_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_058799362.1|4734898_4735852_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058799363.1|4735892_4737431_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_058799416.1|4737721_4738189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058799364.1|4738365_4739382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058799365.1|4739469_4740687_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_058799366.1|4740744_4741290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058799367.1|4741325_4741973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676634.1|4741969_4742248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058799368.1|4742341_4743517_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	53.1	7.5e-114
WP_109739849.1|4744093_4745233_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4744477:4744492	attL	GATAATTGAATACAGG	NA	NA	NA	NA
WP_072209264.1|4745236_4746895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109739848.1|4746891_4748730_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058799372.1|4749086_4749812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058799373.1|4749902_4750835_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_038992388.1|4750831_4751350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057393355.1|4751357_4752323_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001515173.1|4752505_4752829_+	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	41.7	7.5e-08
WP_109739847.1|4752831_4753698_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000493293.1|4754271_4755225_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_058799375.1|4755316_4756309_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.2e-51
WP_058799376.1|4756404_4757028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676630.1|4757109_4757418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058799377.1|4757572_4757938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058799378.1|4758026_4758443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058799379.1|4758900_4759146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058799380.1|4759138_4760029_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
4765831:4765846	attR	CCTGTATTCAATTATC	NA	NA	NA	NA
