The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	717049	725520	2766743		Streptococcus_phage(66.67%)	8	NA	NA
WP_002294039.1|717049_717694_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|717708_718038_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002288071.1|718051_718990_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288076.1|719841_720189_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|720257_721130_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|721238_722360_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|722413_723016_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|723330_725520_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 2
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	778530	869267	2766743	capsid,tail,head,transposase,protease,holin,terminase,tRNA,portal,integrase	Streptococcus_phage(26.53%)	110	769010:769025	859598:859613
769010:769025	attL	GAAAAACAACGACAAC	NA	NA	NA	NA
WP_002296621.1|778530_781329_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	2.1e-74
WP_002286618.1|781377_782904_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|782918_783566_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|783749_784079_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|784255_784984_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|784999_786013_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|786012_787290_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|787352_790055_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|790206_790524_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|790553_790874_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|790981_792442_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|792509_792731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|792761_792944_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|792943_793357_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|793479_794661_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|794731_794896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|795191_796331_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|796629_797265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|797377_798013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|798046_798508_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|798637_799069_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_033705783.1|799086_799407_-	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	50.9	2.0e-21
WP_002286578.1|799700_799841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286679.1|800138_800396_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_002286674.1|800366_800675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319777.1|800752_801499_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	51.0	6.8e-60
WP_002296611.1|801513_801717_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002341611.1|801821_802121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002337459.1|802120_802291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010776517.1|802349_802829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061103418.1|802873_803572_+	ORF6C domain-containing protein	NA	D2IYT0	Enterococcus_phage	35.3	6.0e-26
WP_010776519.1|803749_804091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010776520.1|804083_804818_+	DUF1071 domain-containing protein	NA	A0A2I7RDU5	Vibrio_phage	51.6	2.1e-42
WP_061100027.1|804823_805510_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.5	4.9e-89
WP_010724270.1|805512_805740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319843.1|805742_806570_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	54.9	3.9e-40
WP_002286696.1|806581_806851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|806855_807020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|807012_807315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|807311_807473_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|807469_807775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|807774_808131_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002322165.1|808117_808336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|808332_808752_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|808748_809306_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|809302_809599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|809675_810089_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002296602.1|810397_810550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|810546_810822_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|811275_811482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005876810.1|811677_811845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|811870_812215_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|812219_812501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|812603_812918_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|812895_814590_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|814609_815788_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|815750_816437_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|816436_817597_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|817606_818482_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|818478_818790_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|818779_819133_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|819122_819524_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|819516_819921_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002340802.1|819932_820538_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.2	6.7e-34
WP_002286510.1|820559_820922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|820924_821107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705679.1|821123_824555_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|824605_825343_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|825352_827644_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|827667_829794_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002290627.1|829810_829960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|829956_830403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|830404_830542_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|830579_830873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|830869_831094_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|831090_832116_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|833055_834217_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|835140_835548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|835561_835963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|835964_836336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330703.1|836371_836671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293960.1|836676_836907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286921.1|837523_838186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286924.1|838264_841492_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286925.1|841605_841920_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|841932_842307_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286928.1|842316_842661_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286930.1|842731_844084_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286932.1|844143_845286_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|845310_845565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|845820_847005_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|847001_847139_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|847884_849795_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|849898_850123_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|850135_850636_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|850732_852580_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|852582_853479_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|853528_853918_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|853904_856250_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|856342_857530_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289059.1|857830_859960_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
859598:859613	attR	GAAAAACAACGACAAC	NA	NA	NA	NA
WP_002289057.1|859956_860964_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|860980_861892_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|862019_862748_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|862744_864154_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289051.1|864481_865603_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|866022_866259_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002343922.1|866211_867165_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|867503_868013_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|868105_869267_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
>prophage 3
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	883178	936113	2766743	tRNA,transposase,integrase	Streptococcus_phage(36.36%)	51	876790:876805	891713:891728
876790:876805	attL	AATGTAATAGGTGATT	NA	NA	NA	NA
WP_002299190.1|883178_884726_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002311683.1|884877_885306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|885292_885535_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|885834_886050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300928.1|886156_886471_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|886574_887753_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|888155_888449_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002305732.1|889291_891619_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002352916.1|891744_892074_+	hypothetical protein	NA	NA	NA	NA	NA
891713:891728	attR	AATCACCTATTACATT	NA	NA	NA	NA
WP_158003446.1|892113_893118_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002288979.1|893114_893561_+	cell wall anchor	NA	NA	NA	NA	NA
WP_002288981.1|893710_894526_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288982.1|894731_895904_+	class C sortase	NA	NA	NA	NA	NA
WP_002288983.1|896065_896560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321037.1|896556_896751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|897145_897568_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288985.1|897733_898927_-	MFS transporter	NA	NA	NA	NA	NA
WP_002288986.1|899150_899528_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|899515_899854_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|899987_900431_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002303949.1|900692_901508_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002321035.1|901517_901733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|901816_902995_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_080251004.1|903058_903526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289620.1|903730_905395_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|905407_906118_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|906247_906745_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|906928_907189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|907550_907790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|908126_909305_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002323892.1|909421_909736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|910843_912022_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002302293.1|912225_912528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086953915.1|913890_915229_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002288592.1|916225_916999_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|917142_917493_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|917473_918190_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|918189_919638_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|919708_920218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|920207_920933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|921265_922561_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288584.1|922677_924798_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.1	2.8e-220
WP_002288581.1|925027_926206_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002288579.1|926221_926980_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|927002_927488_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|927558_928812_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|928928_930278_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|930389_931736_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|932043_932430_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002288571.1|932653_934099_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_002311774.1|935153_936113_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
>prophage 5
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	1120730	1254820	2766743	tRNA,transposase,integrase	Streptococcus_phage(25.93%)	113	1116605:1116621	1261348:1261364
1116605:1116621	attL	CTCAATAAAGAAAATCT	NA	NA	NA	NA
WP_002347285.1|1120730_1122026_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
1116605:1116621	attL	CTCAATAAAGAAAATCT	NA	NA	NA	NA
WP_002288335.1|1122230_1122932_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1122928_1124050_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1124064_1125297_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1125428_1126337_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002288344.1|1126371_1126644_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1126654_1127701_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_033705751.1|1127951_1130561_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002321495.1|1130711_1131398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1131375_1131870_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1131889_1133110_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|1133256_1135092_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|1135185_1136313_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_112020398.1|1136369_1137323_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002347297.1|1137246_1137915_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317192.1|1138056_1138989_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002317191.1|1138970_1140434_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002294893.1|1140430_1140889_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311310.1|1140885_1141860_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311311.1|1142300_1143029_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311312.1|1143046_1144243_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311313.1|1144235_1145231_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311314.1|1145227_1146169_+	hexose kinase	NA	NA	NA	NA	NA
WP_002311317.1|1146836_1147727_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002311319.1|1147713_1148523_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311321.1|1148536_1148938_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002317189.1|1148983_1149934_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|1150493_1150769_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002294889.1|1150876_1151641_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002296302.1|1151763_1152267_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002296301.1|1152675_1153317_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296300.1|1153486_1154755_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296299.1|1154781_1155981_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296298.1|1156101_1157409_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002294874.1|1157879_1158998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296295.1|1159500_1159821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|1160273_1160474_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002288763.1|1160620_1163410_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002321579.1|1163456_1163984_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002296294.1|1164004_1165195_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|1165234_1166533_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002288769.1|1167708_1168383_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002319756.1|1168379_1168721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|1168750_1169110_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002296577.1|1169634_1171719_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_002288779.1|1172009_1173476_+	amino acid permease	NA	NA	NA	NA	NA
WP_002297185.1|1173946_1175242_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002289037.1|1175489_1176029_+	transcriptional regulator	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002289038.1|1176102_1176543_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|1176555_1176765_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002289041.1|1176764_1178951_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.5e-120
WP_002296533.1|1178970_1181142_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002299544.1|1184162_1184486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1184499_1185348_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002294839.1|1185701_1186514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304701.1|1186667_1186991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|1187064_1187634_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002294831.1|1188070_1188763_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	2.3e-30
WP_086953915.1|1188802_1190142_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|1190251_1191430_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|1191599_1192938_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002305693.1|1193199_1193631_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|1193862_1194120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|1194405_1195656_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
1194301:1194317	attR	AGATTTTCTTTATTGAG	NA	NA	NA	NA
WP_002287105.1|1196065_1197040_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
1194301:1194317	attR	AGATTTTCTTTATTGAG	NA	NA	NA	NA
WP_002347285.1|1197195_1198491_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002296840.1|1199313_1200501_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002326708.1|1200761_1201079_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002289810.1|1201169_1201535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289809.1|1201742_1202225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|1202421_1203312_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002296623.1|1203714_1205010_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296714.1|1205337_1205817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296712.1|1205849_1208078_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002303818.1|1208206_1209850_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_002286070.1|1209922_1210468_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002286069.1|1210490_1210976_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002286068.1|1210965_1211778_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002286067.1|1211916_1213449_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_002286066.1|1213557_1214589_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002286065.1|1215312_1216299_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_002286064.1|1216447_1217788_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002286063.1|1217792_1218467_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_002286061.1|1218688_1219762_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002286060.1|1219767_1220454_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.9e-29
WP_002286057.1|1220461_1221109_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286056.1|1221181_1222573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286055.1|1222829_1226219_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_002286054.1|1226221_1227643_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_002286053.1|1227639_1229517_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_002286052.1|1229608_1230451_+	class C sortase	NA	NA	NA	NA	NA
WP_002286051.1|1230602_1231478_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286050.1|1231684_1232716_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286049.1|1232804_1233110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642200.1|1233288_1235304_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002286047.1|1235305_1235590_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033705652.1|1235615_1236989_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296707.1|1237071_1239087_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_002320890.1|1239108_1240323_-	MFS transporter	NA	NA	NA	NA	NA
WP_002296705.1|1240543_1241488_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002289717.1|1241783_1242728_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002289716.1|1243394_1243793_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_002289715.1|1243789_1244026_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289718.1|1244185_1244470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322737.1|1244640_1246869_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-128
WP_002295867.1|1247042_1247453_-	VOC family protein	NA	NA	NA	NA	NA
WP_002295866.1|1247569_1248733_-	LCP family protein	NA	NA	NA	NA	NA
WP_002289627.1|1248910_1249765_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002289629.1|1250043_1250814_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	9.6e-09
WP_002289631.1|1250816_1251698_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289632.1|1251694_1252744_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002295864.1|1253193_1253817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|1253866_1254820_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
1261348:1261364	attR	CAGAAGAAACTTTCTTT	NA	NA	NA	NA
>prophage 6
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	1415470	1424531	2766743		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1415470_1416049_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002288011.1|1416045_1417098_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1417120_1418560_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1418544_1420767_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1420767_1421439_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1421440_1421695_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1421694_1422423_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1422678_1423056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1423235_1424531_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 7
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	1679156	1735922	2766743	transposase,protease	Streptococcus_phage(20.0%)	51	NA	NA
WP_002287598.1|1679156_1681391_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|1681538_1681859_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002323555.1|1682063_1682237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296623.1|1682381_1683677_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002295394.1|1683996_1685577_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|1685977_1687354_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|1687481_1688600_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002290819.1|1688741_1689176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002290817.1|1689253_1689787_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|1689880_1691059_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|1691051_1691849_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|1691955_1693338_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|1693511_1694090_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_002296956.1|1694411_1694882_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|1694989_1696216_-	LCP family protein	NA	NA	NA	NA	NA
WP_002292860.1|1696969_1697170_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|1697303_1697912_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|1697996_1698467_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|1698514_1699429_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|1699574_1700378_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|1700555_1701503_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002303172.1|1701570_1701864_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|1701891_1702557_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_033705668.1|1702696_1703329_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|1703335_1704403_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|1704399_1705131_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|1705299_1705779_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|1705914_1707090_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|1707293_1708463_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002349576.1|1708729_1710364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1710593_1711772_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1712844_1713798_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|1714286_1715582_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289372.1|1715755_1716703_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002289370.1|1716707_1717460_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289368.1|1717460_1718369_-	dehydrogenase	NA	NA	NA	NA	NA
WP_002289366.1|1718368_1719346_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002326811.1|1719358_1720501_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289363.1|1720490_1721168_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002289362.1|1721140_1722289_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002292874.1|1722285_1723290_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289359.1|1723301_1724309_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292875.1|1724321_1725743_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002302730.1|1725729_1726800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292877.1|1726801_1728229_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002289068.1|1728221_1729184_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002289069.1|1729216_1730302_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289071.1|1730320_1731361_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289073.1|1731376_1732768_-	sugar transferase	NA	NA	NA	NA	NA
WP_002289074.1|1733145_1734129_+	serine hydrolase	NA	NA	NA	NA	NA
WP_002326809.1|1734626_1735922_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
>prophage 8
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	1757364	1795944	2766743	tail,capsid,head,transposase,protease,holin,terminase,portal,integrase	Enterococcus_phage(31.03%)	56	1780141:1780156	1795965:1795980
WP_002286470.1|1757364_1757565_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286680.1|1757813_1758116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1758151_1758523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1758524_1758926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|1758939_1759347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|1760269_1761432_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286484.1|1762371_1763397_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286683.1|1763393_1763618_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002286686.1|1763614_1763908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|1763945_1764083_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002286491.1|1764084_1764531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290627.1|1764527_1764677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286495.1|1764693_1766820_-	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002296595.1|1766843_1769135_-|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286500.1|1769144_1769882_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_033705679.1|1769932_1773364_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002305377.1|1773380_1773563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286510.1|1773565_1773928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340802.1|1773949_1774555_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.2	6.7e-34
WP_002286516.1|1774566_1774971_-	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002296598.1|1774963_1775365_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|1775354_1775708_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_002286523.1|1775697_1776009_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286524.1|1776005_1776881_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286525.1|1776890_1778051_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|1778050_1778737_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|1778699_1779878_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286533.1|1779897_1781592_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
1780141:1780156	attL	TTGATTAATAAAAAGG	NA	NA	NA	NA
WP_010829634.1|1781569_1781884_-	hypothetical protein	NA	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002343579.1|1781986_1782268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|1782272_1782617_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_005876810.1|1782642_1782810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010738779.1|1782846_1783221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010829633.1|1783567_1783981_-	ArpU family phage transcriptional regulator	NA	C9E2P5	Enterococcus_phage	82.5	3.0e-57
WP_033705815.1|1784091_1784436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705813.1|1784456_1784765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705812.1|1784761_1784965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705817.1|1785200_1785518_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	2.1e-10
WP_002311437.1|1785517_1785808_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.8e-13
WP_104835027.1|1785801_1786113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705807.1|1786109_1786271_-	antitoxin	NA	NA	NA	NA	NA
WP_002321420.1|1786285_1786645_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_033705806.1|1787510_1788344_-	phage replisome organizer N-terminal domain-containing protein	NA	J7KBV5	Streptococcus_phage	75.4	1.7e-48
WP_010722869.1|1788350_1789037_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	1.7e-89
WP_002286557.1|1789042_1789714_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_010725024.1|1789706_1790048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112020401.1|1790226_1790952_-	ORF6C domain-containing protein	NA	D2IYT0	Enterococcus_phage	34.7	5.6e-27
WP_002323904.1|1791004_1791412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002306340.1|1791525_1791699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|1791729_1791978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|1791990_1792176_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002315392.1|1792479_1792854_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_002350678.1|1792858_1793287_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010725020.1|1793336_1793990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002339928.1|1794125_1794692_+	Ltp family lipoprotein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
WP_010725018.1|1794807_1795944_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	5.0e-54
1795965:1795980	attR	CCTTTTTATTAATCAA	NA	NA	NA	NA
>prophage 9
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	2072242	2085875	2766743	tail,capsid,head,terminase,portal,integrase	Staphylococcus_phage(28.57%)	18	2071148:2071174	2085955:2085981
2071148:2071174	attL	TCTATTCTTCTTCTTCCGCCATGAATG	NA	NA	NA	NA
WP_002296483.1|2072242_2072578_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|2072564_2072849_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|2072904_2074428_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|2074420_2075596_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|2075599_2075785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296488.1|2077440_2077914_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296489.1|2077982_2078138_-	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002304527.1|2078271_2078652_-	HNH endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296491.1|2078655_2078871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296492.1|2078873_2079281_-	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296493.1|2079546_2081022_-	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296494.1|2081011_2081860_-	bifunctional DNA primase/polymerase	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296495.1|2081896_2082259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296496.1|2082259_2082418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|2083179_2083491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296500.1|2083534_2083828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296501.1|2084021_2084669_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296502.1|2084729_2085875_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
2085955:2085981	attR	TCTATTCTTCTTCTTCCGCCATGAATG	NA	NA	NA	NA
>prophage 10
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	2204007	2212323	2766743	tRNA,transposase	Planktothrix_phage(33.33%)	7	NA	NA
WP_002289325.1|2204007_2206017_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
WP_002289337.1|2206284_2206563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289327.1|2206659_2207481_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.8	2.7e-25
WP_002297218.1|2207736_2209032_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289328.1|2209287_2210298_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	40.8	2.8e-56
WP_002289330.1|2210309_2211263_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	3.0e-20
WP_002289332.1|2211252_2212323_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.5e-20
>prophage 11
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	2297293	2330748	2766743	transposase,protease,bacteriocin	uncultured_virus(15.38%)	31	NA	NA
WP_002296840.1|2297293_2298481_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288864.1|2298893_2300519_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|2300569_2300854_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_033705730.1|2301078_2301744_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288858.1|2301819_2303112_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288856.1|2303281_2303911_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2304013_2304823_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|2304877_2305747_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_002288852.1|2305747_2307064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288851.1|2307060_2308896_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288850.1|2308900_2309605_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288847.1|2309794_2310655_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002322652.1|2310641_2311211_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|2311840_2312794_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002321654.1|2312790_2312937_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002287810.1|2313040_2313352_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002304799.1|2313353_2313551_-	enterocin	NA	NA	NA	NA	NA
WP_002287807.1|2313944_2315672_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002287805.1|2315664_2316858_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287801.1|2317044_2317689_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002290587.1|2317782_2317917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287799.1|2317918_2320051_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002287797.1|2320047_2320521_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287795.1|2320921_2321146_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287793.1|2321304_2323464_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287792.1|2323513_2324479_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287791.1|2324567_2325707_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287788.1|2326015_2326729_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287787.1|2326982_2327684_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002290558.1|2327917_2329450_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002295743.1|2329839_2330748_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	2494682	2505507	2766743	tRNA,transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_002297218.1|2494682_2495978_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285916.1|2496125_2498540_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002285913.1|2498966_2500985_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	7.5e-13
WP_002285911.1|2501354_2502011_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2502010_2502967_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2502966_2503533_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002285885.1|2503737_2505507_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
>prophage 13
NZ_LN999987	Enterococcus faecium isolate EFE11651 chromosome I	2766743	2634434	2651330	2766743		Streptococcus_phage(92.86%)	19	NA	NA
WP_002297366.1|2634434_2634749_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2634761_2635136_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2635145_2635481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321809.1|2635563_2636904_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.4	2.4e-164
WP_002297358.1|2636981_2637656_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297357.1|2637648_2637813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2637888_2638323_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2638323_2639031_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2639020_2639311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112020403.1|2639569_2640754_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.4	2.5e-141
WP_002317225.1|2640750_2640888_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2641633_2643544_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2643647_2643872_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2643884_2644388_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2644447_2644837_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297348.1|2644823_2647271_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002297347.1|2647275_2649399_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_033705733.1|2649395_2650400_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.2	3.6e-117
WP_002297345.1|2650418_2651330_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	192533	1682	65698	192533	holin,integrase,transposase,bacteriocin	Paenibacillus_phage(15.79%)	58	2292:2351	48514:49507
WP_073120200.1|1682_1979_-|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
2292:2351	attL	ATTTTGTGTAAATAAATTGTCCTCCTGCAAAATAATTAGTTACTCAGTAAACATTGAAAC	NA	NA	NA	NA
WP_002285758.1|3367_3562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|3551_3905_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|4006_5554_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002313174.1|6112_6373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301811.1|6646_7939_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_087043335.1|8507_9669_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301131.1|10440_11175_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301130.1|11190_12360_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301128.1|12375_13371_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002298736.1|13449_14376_+	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301126.1|14394_15645_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001015311.1|15805_16486_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000222572.1|16592_17546_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301591.1|17653_18739_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002287870.1|20814_21333_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_087043335.1|22450_23612_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002300328.1|24110_24587_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|24599_26102_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|26115_26805_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|26965_27784_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301718.1|28829_29285_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_112020404.1|29527_30953_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	8.7e-48
WP_002302077.1|31123_32086_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002302078.1|32087_33527_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002352509.1|33711_35658_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002305879.1|35921_36794_+	ROK family protein	NA	NA	NA	NA	NA
WP_002322465.1|37809_38409_-	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002301839.1|38472_39072_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002300846.1|40025_40208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305884.1|40191_40377_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|40619_42140_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002300842.1|42326_42899_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300841.1|42905_43568_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300840.1|43583_44099_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300838.1|44100_44385_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300836.1|44418_45747_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300835.1|45760_46216_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300833.1|46218_48165_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000997695.1|48552_49731_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
48514:49507	attR	ATTTTGTGTAAATAAATTGTCCTCCTGCAAAATAATTAGTTACTCAGTAAACATTGAAACTAATGTATCGGTTACCTGTTGAAAACCTTTATGGCTTCTGTTTAGAAATTTTTGATTGTATGTATCAAAAATGCTGACTAGAAAGCGTTCTAGTGATTCTTCATTTTGAAACTGCTCTTTTCTACGGCTGTATCTTTTAATTTGCTTATTGAAAGACTCGATTAGATTGGTTGAGTAAATGGTTCTACGAATGCTAGGTGGAAAATCATAAAAAGTTAATAAGTCTTGGTTTTCTATGAGTGACTGCGTCACTTTAGGATAGTTTTTCTTCCATTTCTCAATCATGCCGGATAAGAAGGTATTCGCTTCTTCTTTTGAGTTAGCTTGATAAACAGCCTTAAAGTCATCACAGATTTCTTTTCGGTCTTTGACACGTACTTTATGAGCGATGTTACGAGATACATGGATACAACAATGCTGATATTTTGCTTTAGGATAAATTTGATGGATAGTATCTTTCATGCCTTTTAAGCCGTCCGTAATAAAAAGCAAGACTTCTTGAACTCCTCTGGAGTTAATATCCTGTAGCAGCTCATTCCAAACGTATGTTGATTCAGTTGGAGCAATCGCATAACTCAGTACTTCTTTAGTGCCGTCTTCTCGTATACCAATGGCAATATAAATCGCTTCTTTGGATACGGTTTGACGTTTTAGTGGAATGTAAGTAGCGTCCATAAAAATAGCGACATACTTATCATTTAAGGCTCTGGATTTAAAGGCATTTACTTCTTCAGTCAGAACTTTAGTCATGTTGGACATGGTTTGTGGAGTATAGTGATGACCGTACATTTTTTCGATCAAATCAGCAATTTCAGACATCGTAACACCTTTTTCGAATAAATGGATAATAGTGGTTTCCAATGTATCGTTTGTTCTTTTGTAGGCTGGTAAAGTTTGTTGTTTAAACTCACCATTACGATCTCTAGGTATTTCC	NA	NA	NA	NA
WP_002300807.1|50102_50366_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000222572.1|50486_51440_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002311569.1|52408_52765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|52823_53003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|53447_53720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300799.1|53729_53885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|53900_54152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|54151_54358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305809.1|54800_55025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|55214_55337_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303482.1|55495_55729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002352365.1|56261_57161_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002299811.1|57173_57770_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002295632.1|57850_58000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303486.1|58115_60125_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002313123.1|60135_61605_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002317424.1|61665_64038_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	32.5	1.8e-13
WP_002323390.1|64447_65698_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	6.8e-113
>prophage 2
NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	192533	70895	127719	192533	transposase	Streptococcus_phage(42.86%)	51	NA	NA
WP_087663845.1|70895_72058_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	3.5e-79
WP_002323677.1|72346_72577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323678.1|72599_73406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321287.1|73416_74061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323679.1|74076_75282_-	glucosaminidase domain-containing protein	NA	Q6SEC2	Lactobacillus_prophage	42.4	1.1e-32
WP_002340490.1|75281_77306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340492.1|77468_78062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340493.1|78062_78395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330441.1|80819_83432_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_033705674.1|83431_85495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002310968.1|85564_85867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002310967.1|85884_86127_-	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002310966.1|86123_86588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002310965.1|86614_88705_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002310964.1|88701_88962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320589.1|88974_89730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002316053.1|89745_90498_-	class C sortase	NA	NA	NA	NA	NA
WP_033705675.1|90512_92489_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002338747.1|92541_93213_-	class A sortase	NA	NA	NA	NA	NA
WP_002322851.1|94298_94538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347362.1|94603_94843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002375758.1|95009_95351_-	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	65.2	1.6e-37
WP_002322486.1|95969_96302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295675.1|97126_98167_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_002290397.1|100453_100708_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_112020405.1|100708_101023_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001015311.1|101060_101741_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_050580236.1|101782_102217_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002307675.1|102209_102506_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002331324.1|102525_103155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705792.1|103094_104000_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002290085.1|105052_105319_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_002290081.1|105333_106677_+	PFL family protein	NA	NA	NA	NA	NA
WP_077933103.1|106752_107277_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002310932.1|107594_108044_-	DIP1984 family protein	NA	NA	NA	NA	NA
WP_002310930.1|108346_109240_-	zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.8	7.1e-32
WP_002308003.1|109453_109681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010738666.1|109684_111091_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_010738665.1|111087_111519_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002308010.1|111531_111813_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033705728.1|115036_115864_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_002292290.1|117635_117884_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002292291.1|118083_118488_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002292292.1|118635_119679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294754.1|119693_120257_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002295743.1|120811_121720_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311063.1|122086_123385_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002329884.1|124440_125124_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	2.9e-126
WP_002307459.1|126053_126587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002307460.1|126598_126802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002336218.1|127038_127719_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
>prophage 1
NZ_LN999989	Enterococcus faecium isolate EFE11651 plasmid III, complete sequence	32402	15134	24010	32402	transposase	Streptococcus_phage(100.0%)	9	NA	NA
WP_001015311.1|15134_15815_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_001255866.1|16281_17190_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000627290.1|17186_17729_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|17821_18616_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002321977.1|18891_19434_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	98.3	2.4e-91
WP_001015311.1|19463_20144_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000228166.1|20561_21431_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000567888.1|21533_21779_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_002296623.1|22714_24010_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
>prophage 1
NZ_LN999990	Enterococcus faecium isolate EFE11651 chromosome IV	38742	4013	33118	38742	tail,protease,capsid,head,integrase,portal,terminase	Bacillus_phage(38.46%)	41	17311:17326	33139:33154
WP_002296595.1|4013_6305_-|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286500.1|6314_7052_-|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	31.9	6.8e-20
WP_033705679.1|7102_10534_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002305377.1|10550_10733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286510.1|10735_11098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340802.1|11119_11725_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.2	6.7e-34
WP_002286516.1|11736_12141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296598.1|12133_12535_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|12524_12878_-|head	phage head closure protein	head	A0A1B1P760	Bacillus_phage	38.5	6.1e-11
WP_002286523.1|12867_13179_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286524.1|13175_14051_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286525.1|14060_15221_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|15220_15907_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|15869_17048_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286533.1|17067_18762_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
17311:17326	attL	TTGATTAATAAAAAGG	NA	NA	NA	NA
WP_002343579.1|19157_19439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|19443_19788_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_005876810.1|19813_19981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010738779.1|20017_20392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010829633.1|20739_21153_-	ArpU family phage transcriptional regulator	NA	C9E2P5	Enterococcus_phage	82.5	3.0e-57
WP_112020410.1|21263_21563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705813.1|21629_21938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705812.1|21934_22138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705817.1|22373_22691_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	2.1e-10
WP_002311437.1|22690_22981_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.8e-13
WP_104835027.1|22974_23286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705807.1|23282_23444_-	antitoxin	NA	NA	NA	NA	NA
WP_002321420.1|23458_23818_-	DUF1064 domain-containing protein	NA	A0A1P8BMB7	Lactococcus_phage	52.3	9.5e-20
WP_033705806.1|24683_25517_-	phage replisome organizer N-terminal domain-containing protein	NA	J7KBV5	Streptococcus_phage	75.4	1.7e-48
WP_010722869.1|25523_26210_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	1.7e-89
WP_002286557.1|26215_26887_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_112020401.1|27400_28126_-	ORF6C domain-containing protein	NA	D2IYT0	Enterococcus_phage	34.7	5.6e-27
WP_002323904.1|28178_28586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002306340.1|28699_28873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|28903_29152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|29164_29350_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002315392.1|29653_30028_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	50.0	2.1e-17
WP_002350678.1|30032_30461_+	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	36.1	4.8e-10
WP_010725020.1|30510_31164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002339928.1|31299_31866_+	Ltp family lipoprotein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
WP_010725018.1|31981_33118_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	5.0e-54
33139:33154	attR	CCTTTTTATTAATCAA	NA	NA	NA	NA
