The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	30297	141822	6690584	holin,integrase,terminase,portal,capsid,tail,plate,head	Burkholderia_virus(25.53%)	126	67929:67975	107732:107778
WP_054498492.1|30297_32250_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_006384047.1|32491_33217_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_049055496.1|33368_34049_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_053498776.1|34085_35750_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155871262.1|35804_37334_-	amidase	NA	NA	NA	NA	NA
WP_024068303.1|37522_38902_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_049058827.1|39067_39802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006384053.1|39838_40564_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_006384054.1|40568_40925_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_006384055.1|40921_41731_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_070780632.1|41727_42648_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006384057.1|42644_43772_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.7	1.2e-23
WP_006384058.1|43777_44881_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038503137.1|45031_45763_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_082392015.1|45752_46175_-	group II truncated hemoglobin	NA	NA	NA	NA	NA
WP_155871264.1|46174_48706_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_006388529.1|48831_49806_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_006388528.1|49917_50418_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_006388527.1|50451_51729_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_006388526.1|51850_52141_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_006388525.1|52286_53468_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.4e-22
WP_026382721.1|53524_54466_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	24.9	5.2e-17
WP_083301386.1|54531_55419_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_054505103.1|55442_56006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049051011.1|56018_56549_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_155871266.1|56551_57508_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_173361318.1|57566_58433_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_024068290.1|58559_59489_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006388517.1|59611_60952_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	80.2	1.5e-54
WP_006388516.1|61366_63295_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.5	3.1e-72
WP_020924430.1|63291_64317_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	3.5e-14
WP_024068289.1|64493_65165_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_006388514.1|65230_65710_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024068288.1|65709_66699_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_038503127.1|66700_67498_-	energy transducer TonB	NA	NA	NA	NA	NA
67929:67975	attL	TGGTGGGTGCTACAGGGGTCGAACCTGTGACCTACGCCTTGTAAGGG	NA	NA	NA	NA
WP_155871268.1|68123_68816_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	39.0	7.5e-37
WP_155871270.1|68799_68994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871271.1|69082_69376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871273.1|69385_69604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871275.1|69706_69940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155874023.1|70046_70430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871276.1|70444_70936_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	59.3	1.7e-43
WP_006387653.1|70938_71379_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	35.2	1.2e-08
WP_155871278.1|71473_72139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871280.1|72138_72429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871282.1|72430_75598_-	DUF1983 domain-containing protein	NA	Q6JIL2	Burkholderia_virus	46.0	2.4e-263
WP_155871284.1|75594_76200_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.0	1.2e-51
WP_155871286.1|76203_76977_-	Mov34/MPN/PAD-1 family protein	NA	A4JX14	Burkholderia_virus	51.3	6.5e-66
WP_155871288.1|76979_77708_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	56.6	2.5e-67
WP_155874025.1|77717_78092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871290.1|79449_79788_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	57.1	2.7e-32
WP_155871292.1|79796_83297_-	tape measure protein	NA	A4JX10	Burkholderia_virus	45.7	2.0e-69
WP_155871294.1|83342_83642_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	43.9	6.7e-11
WP_155871296.1|83641_84091_-|tail	phage tail protein	tail	Q6JIM0	Burkholderia_virus	43.5	3.0e-23
WP_155871298.1|84094_84562_-	hypothetical protein	NA	S4TNM8	Salmonella_phage	39.2	1.6e-19
WP_155871300.1|84621_84972_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_155871302.1|84968_85448_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	36.2	6.8e-13
WP_173361319.1|85444_85762_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_155871307.1|85778_86318_-	hypothetical protein	NA	A4JX03	Burkholderia_virus	43.7	2.8e-31
WP_173361320.1|86320_86491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871309.1|86555_87881_-|capsid	phage major capsid protein	capsid	Q8W6U5	Burkholderia_virus	69.2	1.5e-155
WP_155871311.1|87944_88901_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	56.7	1.2e-85
WP_155871313.1|88897_90154_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	55.3	3.4e-136
WP_155871315.1|90157_90352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871317.1|90348_92037_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	46.0	1.3e-130
WP_155871319.1|92033_92627_-|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	36.4	5.8e-14
WP_155871321.1|92819_93158_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	54.3	2.2e-26
WP_155874027.1|93319_93742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155874029.1|93891_94305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871323.1|94516_95500_-	hypothetical protein	NA	Q8W6P0	Burkholderia_virus	42.8	5.3e-36
WP_155871325.1|95496_95985_-	DUF1364 family protein	NA	NA	NA	NA	NA
WP_155871327.1|96258_96564_-	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	32.1	8.7e-06
WP_155871329.1|96557_97073_-	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	40.5	3.6e-28
WP_155871331.1|97337_97559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155874031.1|97978_98662_+	helix-turn-helix domain-containing protein	NA	H2BDH4	Pseudomonas_virus	32.5	3.3e-21
WP_155871333.1|99077_99281_+	hypothetical protein	NA	A0A0M3MWN3	Stenotrophomonas_phage	57.4	8.6e-10
WP_155871335.1|99316_99514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871337.1|99555_99741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871339.1|99751_100363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871341.1|100647_100881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871343.1|101185_102085_+	recombination-associated protein RdgC	NA	B5AX95	Iodobacteriophage	31.0	6.9e-35
WP_155871345.1|102099_103095_+	hypothetical protein	NA	A1YZR3	Burkholderia_virus	40.5	1.5e-54
WP_155871347.1|103528_103945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871349.1|103941_104322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871351.1|104893_105322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871353.1|105314_105719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871355.1|105702_106011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155874033.1|106204_106522_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155874035.1|106442_107558_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L7DQ84	Ralstonia_phage	29.7	1.3e-22
WP_003812968.1|107954_108227_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	57.8	1.1e-20
107732:107778	attR	TGGTGGGTGCTACAGGGGTCGAACCTGTGACCTACGCCTTGTAAGGG	NA	NA	NA	NA
WP_006388510.1|108660_109341_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	29.1	3.8e-17
WP_024068286.1|109395_110640_-	cystathionine gamma-synthase family protein	NA	NA	NA	NA	NA
WP_155871357.1|110691_111429_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_026384162.1|111562_114028_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.2	7.4e-63
WP_006388506.1|114590_115202_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_006388505.1|115619_116063_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155871359.1|116181_117090_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054499332.1|117121_118066_+	AEC family transporter	NA	NA	NA	NA	NA
WP_155871361.1|118235_119459_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_049054401.1|119648_121319_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_024068279.1|121350_122730_-	cardiolipin synthase B	NA	NA	NA	NA	NA
WP_006388499.1|122828_123161_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_020924444.1|123539_124517_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_024068277.1|124554_125871_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_020924446.1|126273_127185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006388491.1|127344_127536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006388490.1|127665_127920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006388489.1|128167_128359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053514660.1|128377_129286_-	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_026384169.1|129457_129718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054437215.1|129752_131330_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_054437212.1|131672_131945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054437210.1|131925_132456_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	57.4	5.3e-43
WP_164497481.1|132445_132937_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	37.2	6.3e-14
WP_080684492.1|133098_133647_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	52.9	1.0e-12
WP_155871363.1|133559_134591_-|tail	tail fiber protein	tail	A0A0M3ULD8	Salmonella_phage	54.1	6.3e-16
WP_054496611.1|134605_135271_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	60.2	2.1e-73
WP_054496612.1|135272_136454_-|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	62.8	3.4e-130
WP_020924456.1|136450_136804_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	66.7	6.1e-35
WP_155871366.1|136812_137556_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.5	3.3e-83
WP_054505127.1|137590_138601_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	52.6	1.7e-77
WP_006388474.1|138620_138920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026384173.1|138929_139529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871368.1|139521_141195_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006393814.1|141187_141346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024068262.1|141372_141822_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	1.1e-17
>prophage 2
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	844301	882297	6690584	integrase,transposase	Escherichia_phage(22.22%)	35	876964:877023	881529:882349
WP_023103875.1|844301_846245_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	48.2	2.1e-97
WP_020924940.1|846282_847251_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_023106332.1|847369_848023_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009459591.1|848142_848436_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023103878.1|848458_849349_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023093406.1|849833_851048_-	glutathione-independent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_028698648.1|851514_852456_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024086516.1|852904_853885_+|transposase	IS5-like element ISPa26 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	3.2e-94
WP_023835768.1|854137_854569_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_028690943.1|854944_856921_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_023103881.1|857071_857977_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023103882.1|858131_858539_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_028690944.1|858540_859149_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_028690945.1|859145_860036_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_028690946.1|860318_860594_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_011871467.1|860653_861763_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	2.9e-35
WP_023103885.1|861806_862205_+	VOC family protein	NA	NA	NA	NA	NA
WP_023464791.1|862387_863722_+	DUF3422 family protein	NA	NA	NA	NA	NA
WP_023464790.1|863780_864611_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_028690947.1|864629_865937_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_028690948.1|865988_867302_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.3e-77
WP_028690949.1|867362_869228_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.1	3.4e-52
WP_028690950.1|869253_871905_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.9	5.2e-155
WP_028690951.1|871985_873830_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_155871564.1|874149_874776_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_028690952.1|874788_875421_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_028690953.1|875505_875871_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_000480968.1|875994_876831_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
876964:877023	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|877027_877732_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000015696.1|878089_878368_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071533317.1|878393_878579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002310911.1|878575_878914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297013.1|878817_880008_-	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_001038045.1|880100_880760_+	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_001067855.1|881592_882297_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
881529:882349	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 3
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	2704404	2722122	6690584	tail	Burkholderia_virus(33.33%)	18	NA	NA
WP_054470655.1|2704404_2705862_+	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	35.4	6.8e-64
WP_053497387.1|2705914_2706610_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_102949899.1|2706906_2707476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006385689.1|2707726_2708194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054439097.1|2708199_2708673_+|tail	phage tail protein	tail	Q3HQT7	Burkholderia_phage	39.9	7.1e-23
WP_054439099.1|2708672_2708963_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.2	2.7e-12
WP_076467933.1|2709020_2710307_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	30.3	1.6e-13
WP_054472578.1|2710309_2710648_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	48.6	6.4e-26
WP_155872205.1|2710653_2713290_+|tail	tail fiber domain-containing protein	tail	A0A1B1IX43	uncultured_Mediterranean_phage	42.9	4.7e-15
WP_054472580.1|2713292_2714021_+|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	56.6	1.7e-68
WP_054482521.1|2714023_2714803_+	C40 family peptidase	NA	A4JX14	Burkholderia_virus	49.0	5.0e-66
WP_006385697.1|2714799_2715405_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.7	1.0e-50
WP_054472643.1|2715530_2719034_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	45.3	2.2e-262
WP_054472581.1|2719038_2719404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035199492.1|2719384_2719621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006385701.1|2719617_2720214_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	53.0	1.9e-49
WP_026382512.1|2720355_2721285_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155872207.1|2721303_2722122_-	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	49.3	1.4e-10
>prophage 4
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	2828302	2853068	6690584	integrase,transposase	Salmonella_phage(57.14%)	19	2831772:2831788	2839470:2839486
WP_003159550.1|2828302_2828503_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	68.9	2.2e-18
WP_003158660.1|2828685_2831601_-|transposase	Tn3-like element IS1071 family transposase	transposase	NA	NA	NA	NA
2831772:2831788	attL	CGGTCGCGGATTTCACC	NA	NA	NA	NA
WP_003124096.1|2834481_2835042_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_033865223.1|2835172_2835376_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|2835566_2836580_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_023835631.1|2836681_2837665_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000214125.1|2837881_2839096_+	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_155872237.1|2839261_2842147_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	9.3e-190
2839470:2839486	attR	CGGTCGCGGATTTCACC	NA	NA	NA	NA
WP_023434504.1|2842272_2842941_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.1	5.5e-37
WP_001082319.1|2842952_2843756_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|2843755_2844592_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_173361396.1|2844715_2844781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163574.1|2844777_2845404_-	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001257840.1|2845507_2846683_+	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_001253717.1|2846703_2847495_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155874106.1|2847586_2848969_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052437149.1|2849110_2849974_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_039843394.1|2850009_2850765_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155872239.1|2851538_2853068_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	3537596	3581465	6690584	integrase,holin,terminase,portal,capsid,tail,tRNA,plate,head	Ralstonia_phage(20.59%)	50	3527849:3527867	3571388:3571406
3527849:3527867	attL	GTCGGCGGCCAGGGCGCCG	NA	NA	NA	NA
WP_155874137.1|3537596_3539219_+|tail	phage tail protein	tail	A0A0B5A509	Achromobacter_phage	60.5	3.9e-76
WP_155872481.1|3539352_3540960_+|tail	phage tail protein	tail	A0A0B5A509	Achromobacter_phage	56.1	1.8e-49
WP_155872484.1|3541002_3541989_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_006385528.1|3542240_3543434_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_006385527.1|3543566_3545249_-	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.2	2.9e-26
WP_006385526.1|3545416_3546322_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.6	2.4e-19
WP_024070116.1|3546447_3547431_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.6	2.9e-26
WP_026383153.1|3547497_3547986_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_006385523.1|3548133_3548712_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_006385522.1|3548862_3549891_-	alcohol dehydrogenase AdhP	NA	A0A2P1EIJ9	Megavirus	29.1	7.9e-35
WP_006385521.1|3550102_3550492_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_026383152.1|3550628_3551426_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_006390766.1|3552469_3553498_+|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	38.8	1.6e-56
WP_083827922.1|3553494_3553713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173361348.1|3553771_3555601_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	53.9	3.6e-179
WP_054448001.1|3555600_3555870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155874139.1|3555866_3558542_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	53.3	1.4e-269
WP_054479074.1|3558571_3558805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872487.1|3558890_3559277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173361349.1|3559269_3559557_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_167334262.1|3559553_3559781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872493.1|3559860_3560265_+	helix-turn-helix domain-containing protein	NA	K4NXA8	Burkholderia_phage	60.6	1.2e-13
WP_155872495.1|3560293_3560608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872498.1|3560738_3561029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872501.1|3561040_3562126_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	49.8	1.5e-84
WP_155872504.1|3562125_3562581_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	52.8	2.1e-32
WP_155872507.1|3562593_3565332_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	44.5	1.5e-184
WP_081322395.1|3565335_3565452_-|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	75.8	3.0e-07
WP_081322394.1|3565460_3565820_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	42.9	1.6e-14
WP_058664993.1|3565841_3566357_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	54.1	3.8e-46
WP_155872509.1|3566414_3567596_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A077K9Y4	Ralstonia_phage	65.7	2.3e-147
WP_155872512.1|3567740_3568355_-|tail	tail fiber assembly protein	tail	B5TK80	Pseudomonas_phage	32.8	5.3e-10
WP_155872515.1|3568368_3569634_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	32.3	1.7e-55
WP_155872518.1|3569630_3570269_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	58.0	1.1e-50
WP_155872520.1|3570252_3571170_-|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	54.9	6.3e-76
WP_068980947.1|3571171_3571513_-	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	53.2	1.4e-17
3571388:3571406	attR	GTCGGCGGCCAGGGCGCCG	NA	NA	NA	NA
WP_155872523.1|3571524_3572160_-|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	52.0	9.2e-50
WP_155872525.1|3572221_3572683_-	phage virion morphogenesis protein	NA	Q6K1H7	Salmonella_virus	46.9	1.9e-28
WP_155872527.1|3572675_3573179_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	52.9	2.8e-33
WP_155872529.1|3573277_3573700_-	hypothetical protein	NA	Q9ZXL5	Pseudomonas_virus	31.7	2.3e-09
WP_155872531.1|3573696_3574506_-	DUF3380 domain-containing protein	NA	E5FFI0	Burkholderia_phage	56.0	1.1e-76
WP_155872533.1|3574498_3574798_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_006390739.1|3574794_3575157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006390738.1|3575162_3575369_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	1.1e-15
WP_155872535.1|3575368_3575839_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	51.6	1.1e-36
WP_155872537.1|3575931_3576627_-	hypothetical protein	NA	A0A2H4J948	uncultured_Caudovirales_phage	41.3	7.5e-37
WP_155872539.1|3576629_3577637_-|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	61.4	1.3e-114
WP_155872542.1|3577681_3578548_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	43.5	1.3e-49
WP_155872545.1|3578688_3580443_+|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	67.7	6.6e-231
WP_155872548.1|3580439_3581465_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	62.4	1.8e-127
>prophage 6
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	4455684	4463623	6690584	tRNA	Moraxella_phage(33.33%)	8	NA	NA
WP_155872873.1|4455684_4456272_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.8	7.0e-20
WP_006388150.1|4456305_4456680_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	27.8	1.9e-10
WP_006388152.1|4458282_4458639_+	VOC family protein	NA	NA	NA	NA	NA
WP_006388153.1|4458723_4460016_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.4e-65
WP_006388154.1|4460124_4461156_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	1.4e-92
WP_006388155.1|4461225_4461867_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_020927471.1|4462055_4462814_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	1.5e-67
WP_006388157.1|4462858_4463623_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.2	2.3e-31
>prophage 7
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	5609545	5682700	6690584	integrase,terminase,protease,capsid,portal,tRNA,tail,head	Pseudomonas_phage(18.42%)	88	5608805:5608824	5678120:5678139
5608805:5608824	attL	CCGGCGCCTCGCGCGGCATC	NA	NA	NA	NA
WP_006386145.1|5609545_5611069_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.2	1.2e-82
WP_020928310.1|5611084_5611408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054507257.1|5611464_5612973_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_020928313.1|5613148_5614402_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_020928314.1|5614398_5615226_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_110059104.1|5615245_5615899_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038503902.1|5615895_5617050_-	thiolase family protein	NA	NA	NA	NA	NA
WP_155873435.1|5617046_5618900_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-48
WP_026384304.1|5618896_5619691_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.6	1.2e-11
WP_006386155.1|5619731_5620913_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020928318.1|5620954_5621992_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006386157.1|5621994_5622873_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_169538040.1|5622872_5623670_-	ATP-binding cassette domain-containing protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	25.5	3.9e-05
WP_049050888.1|5623927_5624731_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_155873437.1|5626727_5626994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873439.1|5626977_5627526_-	hypothetical protein	NA	A0A0H5BBZ5	Pseudomonas_phage	54.8	9.7e-32
WP_054447769.1|5627528_5627972_-	hypothetical protein	NA	A0A0A1IVG1	Pseudomonas_phage	36.2	1.7e-10
WP_026384313.1|5628089_5628782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873441.1|5629083_5632257_-	DUF1983 domain-containing protein	NA	A4JX16	Burkholderia_virus	47.0	1.9e-276
WP_155873443.1|5632253_5632868_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	57.1	2.0e-54
WP_155873445.1|5632871_5633645_-	Mov34/MPN/PAD-1 family protein	NA	A4JX14	Burkholderia_virus	51.3	3.5e-67
WP_155873447.1|5633647_5634286_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	41.5	4.2e-42
WP_155873449.1|5634300_5635029_-|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	55.7	8.0e-66
WP_155874241.1|5635037_5635421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054506194.1|5636784_5637123_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	49.1	3.1e-28
WP_155873451.1|5637119_5640560_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.5	3.1e-83
WP_155873453.1|5640561_5640813_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	45.7	1.8e-12
WP_006387896.1|5640869_5641208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873456.1|5641217_5641868_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	56.5	3.8e-59
WP_155873458.1|5641925_5642276_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_155873460.1|5642268_5642697_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_026384553.1|5642693_5643023_-|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	45.0	2.1e-13
WP_155873462.1|5643019_5643439_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_155873464.1|5643441_5643828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873466.1|5643894_5645133_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	49.4	3.4e-101
WP_155873468.1|5645202_5645943_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	C7BGG9	Burkholderia_phage	56.2	1.5e-56
WP_155873470.1|5645908_5647249_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	37.4	1.9e-57
WP_155873472.1|5647248_5648946_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	61.8	9.9e-200
WP_070668504.1|5648991_5649318_-	hypothetical protein	NA	Q2NPI9	Xanthomonas_virus	45.7	4.2e-06
WP_155873474.1|5649475_5649811_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_155873476.1|5649813_5650047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873478.1|5650043_5650430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873480.1|5650433_5650643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054506208.1|5650842_5651028_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	47.5	3.1e-06
WP_155873482.1|5651096_5651507_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	40.3	1.0e-17
WP_155873484.1|5651508_5652279_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	73.8	2.4e-113
WP_155873487.1|5652443_5652617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873489.1|5652731_5653325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873492.1|5653321_5653702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173361405.1|5653712_5654039_-	hypothetical protein	NA	A0A0P0IKL1	Acinetobacter_phage	45.7	4.8e-18
WP_155873496.1|5654110_5655838_-	toprim domain-containing protein	NA	A0A0F7L6A5	uncultured_marine_virus	37.7	2.7e-104
WP_155873498.1|5655834_5656911_-	hypothetical protein	NA	U6C6J3	Ralstonia_phage	73.9	5.8e-28
WP_155873500.1|5656922_5657168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873502.1|5657272_5657473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873504.1|5657475_5657808_-	hypothetical protein	NA	K7PH30	Enterobacteria_phage	48.2	5.4e-09
WP_155873506.1|5657800_5658130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873508.1|5658115_5658934_+	helix-turn-helix domain-containing protein	NA	A0A0R6PHL1	Moraxella_phage	33.8	4.2e-31
WP_155873510.1|5659129_5659450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026383231.1|5659446_5659746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873512.1|5659742_5659994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026383229.1|5659990_5660275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873514.1|5660271_5660511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873516.1|5660507_5660717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873519.1|5660713_5661031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873521.1|5661023_5661284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873523.1|5661280_5661523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873525.1|5661519_5662194_+	DNA polymerase III subunit beta	NA	A0A1L7DQD4	Ralstonia_phage	35.5	2.1e-15
WP_155873527.1|5662190_5662406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873529.1|5662402_5662705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873531.1|5662701_5663481_+	phage antirepressor	NA	C8CLG1	Xylella_phage	60.5	4.2e-28
WP_155873533.1|5663477_5664740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873535.1|5664736_5664937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873537.1|5664895_5666092_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.2	3.2e-59
WP_006386163.1|5666921_5667812_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_006386165.1|5667915_5668110_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_006386167.1|5668109_5668451_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_054497502.1|5668460_5670323_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.3	2.2e-99
WP_006386171.1|5670388_5670901_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_006386172.1|5670904_5671228_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	3.0e-25
WP_006386173.1|5671230_5671635_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	8.2e-52
WP_006386174.1|5671668_5672880_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_006386175.1|5672898_5673441_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_042794076.1|5673633_5674125_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_165595766.1|5674374_5676357_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_006386178.1|5676584_5677784_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024069438.1|5677938_5678589_+	transcriptional repressor LexA	NA	A0A2K9V3G4	Faecalibacterium_phage	32.6	2.0e-15
5678120:5678139	attR	CCGGCGCCTCGCGCGGCATC	NA	NA	NA	NA
WP_020928331.1|5678699_5681150_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	7.8e-222
WP_006386181.1|5681401_5682700_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.1	1.7e-130
>prophage 8
NZ_LN890477	Achromobacter xylosoxidans isolate R8 chromosome BN2910	6690584	6428773	6483345	6690584	integrase,terminase,portal,capsid,protease,tail,tRNA,head	Burkholderia_virus(19.23%)	65	6460025:6460041	6466522:6466538
WP_047991707.1|6428773_6429253_-	hypothetical protein	NA	A0A0A1IVG1	Pseudomonas_phage	32.0	2.3e-08
WP_155873854.1|6429357_6429774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873856.1|6431325_6432216_-	hypothetical protein	NA	R9TJ58	Synechococcus_phage	34.9	4.2e-40
WP_155873858.1|6432212_6437819_-|tail	phage tail length tape measure family protein	tail	A0A1V0E8B0	Vibrio_phage	47.9	1.8e-72
WP_155874291.1|6437854_6438163_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_068951791.1|6438162_6438480_-|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	52.9	3.2e-27
WP_155873860.1|6438567_6439215_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	57.7	2.5e-63
WP_155873862.1|6439312_6439750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873864.1|6439746_6440097_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_155873866.1|6440089_6440584_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_054498349.1|6440580_6440919_-|head	phage head closure protein	head	Q3HQT3	Burkholderia_phage	39.3	9.3e-09
WP_155873868.1|6440929_6441250_-|head,tail	phage head-tail connector protein	head,tail	S5FKK6	Shigella_phage	36.8	1.1e-11
WP_054498351.1|6441287_6442520_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	59.0	8.1e-135
WP_155873870.1|6442532_6443150_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	62.7	2.4e-63
WP_155873872.1|6443160_6444378_-|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	66.7	7.0e-155
WP_162838313.1|6444374_6444530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873874.1|6444531_6446256_-|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	80.3	2.9e-279
WP_155873876.1|6446259_6446742_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	62.0	3.0e-53
WP_155873878.1|6446942_6447326_-	HNH endonuclease	NA	Q6JIE9	Burkholderia_virus	53.0	1.9e-26
WP_155873879.1|6447514_6448297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873880.1|6448430_6448952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873881.1|6449553_6449994_-	VRR-NUC domain-containing protein	NA	W6ARB7	Acinetobacter_phage	38.7	1.1e-14
WP_155873882.1|6450037_6451000_-	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	58.2	1.4e-25
WP_155873886.1|6450996_6451485_-	DUF1364 family protein	NA	Q8W6N7	Burkholderia_virus	42.7	2.4e-13
WP_155873887.1|6451475_6451781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873888.1|6451773_6452079_-	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	34.5	1.3e-06
WP_060721558.1|6452072_6452600_-	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	36.8	2.0e-18
WP_155873889.1|6453000_6453177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873890.1|6453402_6453753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054506804.1|6453804_6454020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873894.1|6454090_6455197_+	LexA family transcriptional repressor	NA	A0A1B0VRI7	Pseudomonas_phage	29.7	3.4e-07
WP_155873896.1|6455649_6456132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873898.1|6456772_6457177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070780976.1|6457327_6457741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873899.1|6457999_6458725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873901.1|6458993_6459236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873903.1|6459284_6459674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873905.1|6459731_6460727_+	hypothetical protein	NA	A1YZR3	Burkholderia_virus	41.7	7.6e-59
6460025:6460041	attL	GCGCGCCATCGCCGCCG	NA	NA	NA	NA
WP_155874293.1|6460807_6461143_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	44.7	5.4e-17
WP_155873907.1|6461139_6461346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873909.1|6461687_6462026_+	DUF4406 domain-containing protein	NA	L7TKQ2	Pseudomonas_virus	59.8	2.4e-25
WP_155873911.1|6462028_6463348_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7RFJ9	Vibrio_phage	36.3	3.1e-60
WP_082884045.1|6463513_6463762_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_155873913.1|6463758_6465048_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	C7BGE7	Burkholderia_phage	55.5	1.9e-134
WP_026384427.1|6465289_6467890_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	20.1	1.8e-22
6466522:6466538	attR	GCGCGCCATCGCCGCCG	NA	NA	NA	NA
WP_020928923.1|6467886_6469080_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006386500.1|6469298_6469526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873915.1|6469526_6469697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006386499.1|6469730_6470855_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_006386498.1|6470872_6471778_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_006386497.1|6471865_6472513_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_006386496.1|6472574_6473201_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_006386495.1|6473290_6474145_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	38.1	2.1e-36
WP_006386494.1|6474325_6474862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006386493.1|6474858_6475626_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_006386492.1|6475668_6475941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873917.1|6476166_6476817_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006386490.1|6476921_6477662_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026384423.1|6477749_6479030_+	MFS transporter	NA	NA	NA	NA	NA
WP_026384422.1|6478989_6479622_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_045953661.1|6479745_6480231_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006386486.1|6480260_6480455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165601568.1|6480934_6481105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873919.1|6481274_6482915_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_006386483.1|6482973_6483345_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
