The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	57134	97484	2177010	transposase	Streptococcus_phage(15.38%)	32	NA	NA
WP_059242688.1|57134_58505_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	3.6e-83
WP_004684033.1|58590_60240_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.8	1.1e-46
WP_059476627.1|60319_60499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242689.1|60735_61680_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059242690.1|61970_62384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242691.1|62477_63164_-	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_059242692.1|65851_66220_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059242693.1|66216_66609_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242694.1|66740_66962_-	PhnA protein	NA	NA	NA	NA	NA
WP_059243950.1|67099_67729_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SEH9	Indivirus	29.9	1.5e-15
WP_059242695.1|67725_68787_-	hypothetical protein	NA	K4JUR1	Caulobacter_phage	43.3	1.1e-66
WP_082253053.1|69594_69804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243951.1|69760_70864_-	linear amide C-N hydrolase	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	31.9	5.7e-31
WP_059242696.1|72204_72702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242692.1|73104_73473_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059242693.1|73469_73862_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242697.1|73875_74217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242698.1|74460_74919_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_008506802.1|75110_75401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242699.1|75424_77443_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.0	3.7e-36
WP_059242700.1|77899_79867_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.5	9.7e-98
WP_008506807.1|80236_81913_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_059242701.1|81980_82433_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.9	6.2e-16
WP_059243952.1|82812_84036_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	6.5e-44
WP_059242702.1|84203_85130_-	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
WP_059242703.1|85834_86650_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_059242704.1|86884_90373_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_059242705.1|91089_92949_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
WP_004684049.1|93388_93598_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	55.4	1.8e-10
WP_008506825.1|93890_94502_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_059242706.1|94751_95954_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_059242707.1|96113_97484_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
>prophage 2
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	107938	223310	2177010	portal,capsid,tail,transposase	Paenibacillus_phage(13.04%)	100	NA	NA
WP_059242707.1|107938_109309_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
WP_082253054.1|109416_109611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025199819.1|109720_110110_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_059242693.1|110163_110556_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242692.1|110552_110921_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059476628.1|111072_111270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242716.1|111175_111757_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_059242717.1|111882_114705_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_059242718.1|114836_115640_+	lytic transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	36.2	2.0e-09
WP_002964621.1|116134_116350_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	48.4	1.3e-08
WP_059242720.1|116766_117279_+	BA14K family protein	NA	NA	NA	NA	NA
WP_059242707.1|117378_118749_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
WP_004683353.1|118916_119174_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_059242721.1|119443_119683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|119679_120027_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_059242722.1|120091_120805_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_006011906.1|121371_122874_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_059242723.1|122918_123986_+	AP endonuclease	NA	NA	NA	NA	NA
WP_082253055.1|124020_124260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242724.1|124344_126036_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_059476629.1|126424_127297_+	DNA polymerase	NA	NA	NA	NA	NA
WP_059242727.1|129902_132554_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_059242728.1|132944_135296_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_059242729.1|135569_137681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242730.1|137725_140677_-	glutamine-synthetase adenylyltransferase	NA	NA	NA	NA	NA
WP_059242692.1|141210_141579_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_082253056.1|141648_143055_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_059242731.1|143051_143759_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_059242732.1|143852_145394_-	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.3e-28
WP_059242733.1|145535_146012_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_059242734.1|146008_148000_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_059242735.1|148019_148517_-	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
WP_059242736.1|148513_149653_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_059242737.1|149753_150206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242738.1|150299_151610_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_059243955.1|152452_152749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242693.1|152863_153256_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242692.1|153252_153621_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_008508561.1|153754_153961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242739.1|157894_158329_-	peptidase P60	NA	NA	NA	NA	NA
WP_082253057.1|158325_158679_-	hypothetical protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	48.5	6.7e-18
WP_059242741.1|159196_159829_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	1.3e-48
WP_059242742.1|159831_160377_-	hypothetical protein	NA	A0A1B0VMG8	Pseudomonas_phage	40.8	1.1e-06
WP_059242743.1|160596_160938_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_008935501.1|160934_161348_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_006072374.1|161388_161796_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_059242744.1|162253_162820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242745.1|162984_164259_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	43.8	2.6e-83
WP_002967499.1|164934_165312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242746.1|165308_166502_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	39.7	2.0e-66
WP_059242747.1|166533_167793_-	ATP-binding protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.9	2.6e-72
WP_059242748.1|167731_168244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242749.1|168601_170758_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_059242750.1|170764_171376_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_059242751.1|171368_171911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242752.1|172134_173202_+	DUF2336 domain-containing protein	NA	NA	NA	NA	NA
WP_059242753.1|173211_173559_-	DUF1491 domain-containing protein	NA	NA	NA	NA	NA
WP_059242754.1|173572_174541_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_059242755.1|174515_176345_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	1.1e-23
WP_059242756.1|176635_177085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243956.1|177164_177590_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_059242757.1|177630_178968_-	amidase	NA	NA	NA	NA	NA
WP_059242758.1|179058_179853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243957.1|179849_180305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969861.1|180486_180798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004688116.1|181006_181435_-	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_082253058.1|181389_181584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242759.1|182007_184116_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_059242760.1|184233_184569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004689540.1|184739_185339_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.6	6.9e-39
WP_082253059.1|186217_186460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059242761.1|186518_187235_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_059242762.1|187432_188944_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	7.5e-82
WP_059242763.1|189279_189642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242764.1|190937_191615_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059242765.1|191770_192763_+	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_002963708.1|192823_193054_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_059242766.1|193050_193440_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.9	1.7e-06
WP_059242767.1|193436_193907_-	transcription elongation factor	NA	NA	NA	NA	NA
WP_059243958.1|193951_194974_-	asparaginase	NA	NA	NA	NA	NA
WP_059243959.1|195164_195761_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_059242768.1|197582_199046_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_059242769.1|199582_200653_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059242770.1|200904_201936_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_059242771.1|201968_203420_+	xylulokinase	NA	NA	NA	NA	NA
WP_059242772.1|203466_204774_+	xylose isomerase	NA	NA	NA	NA	NA
WP_059243960.1|204974_206147_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_059242773.1|208303_209305_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059242774.1|209325_210861_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	1.8e-14
WP_082253060.1|210859_211072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242775.1|211552_212662_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
WP_059242776.1|212744_213917_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_059242777.1|213949_215374_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	1.5e-52
WP_005969645.1|218553_219108_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_082253061.1|219150_219303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242780.1|220055_221174_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_059242781.1|221304_221544_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059242693.1|221544_221937_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242692.1|221933_222302_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_082253062.1|222371_223310_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	1206778	1270827	2177010	tRNA,tail,transposase	Ochrobactrum_phage(42.86%)	45	NA	NA
WP_059242707.1|1206778_1208149_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
WP_082253136.1|1208231_1208441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243365.1|1208492_1210679_-	malate synthase G	NA	NA	NA	NA	NA
WP_059243366.1|1210821_1211697_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_059244044.1|1211772_1212417_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_002967872.1|1212690_1213263_+	HNH endonuclease	NA	A0A223W0A5	Agrobacterium_phage	40.9	8.6e-31
WP_004684121.1|1213279_1213798_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_059243367.1|1213910_1214501_-	DedA family protein	NA	NA	NA	NA	NA
WP_059243368.1|1214596_1214830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082253137.1|1214759_1214942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243369.1|1214942_1216394_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_059243370.1|1216511_1217333_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059242693.1|1225848_1226241_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242692.1|1226237_1226606_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059243371.1|1226675_1226993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243372.1|1228852_1229857_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_059243373.1|1230033_1231023_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059243374.1|1231111_1231885_+	D-threitol dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.8	7.3e-09
WP_059243375.1|1231917_1232910_+	dihydroxyacetone kinase	NA	NA	NA	NA	NA
WP_059243376.1|1232921_1233563_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_082253138.1|1233721_1235806_+	3,4-dihydroxy-2-butanone kinase	NA	NA	NA	NA	NA
WP_059244046.1|1235871_1236519_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_059243377.1|1236795_1237077_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_059243378.1|1239318_1240104_-	porin family protein	NA	O11861	Bartonella_henselae_phage	32.7	7.7e-22
WP_059243379.1|1240395_1241010_-	MarC family protein	NA	NA	NA	NA	NA
WP_059243380.1|1242791_1243586_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	NA	NA	NA	NA
WP_082253139.1|1243651_1244566_-	7-alpha-hydroxysteroid dehydrogenase	NA	A0A0M4JSW6	Mollivirus	27.9	1.4e-11
WP_002964713.1|1245129_1245366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243381.1|1246938_1248354_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_082253219.1|1248729_1249833_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059243383.1|1252027_1252849_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059243384.1|1252856_1254794_-	AsmA family protein	NA	NA	NA	NA	NA
WP_082253140.1|1254937_1255183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243385.1|1255533_1258635_-	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.2	9.5e-23
WP_009365134.1|1261609_1262128_+|tail	phage tail protein	tail	A0A219VHB2	Ochrobactrum_phage	97.7	1.6e-97
WP_059244048.1|1262691_1264980_+|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	75.6	8.4e-311
WP_059243386.1|1264980_1265418_+|tail	phage tail protein	tail	A0A219VHA8	Ochrobactrum_phage	93.8	3.4e-72
WP_059243387.1|1265414_1265675_+|tail	phage tail protein	tail	A0A219VHB0	Ochrobactrum_phage	94.2	7.8e-40
WP_059243388.1|1265674_1266649_+	late control protein	NA	A0A219VHA9	Ochrobactrum_phage	93.8	4.8e-175
WP_059243389.1|1266648_1266936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243390.1|1266932_1267253_+	hypothetical protein	NA	A0A219VHA6	Ochrobactrum_phage	89.1	7.4e-48
WP_059243391.1|1267316_1267868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243392.1|1267864_1268146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243393.1|1268586_1269543_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_009362888.1|1269702_1270827_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	31.1	1.4e-29
>prophage 4
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	1349025	1396502	2177010	tRNA,protease,transposase,holin	Streptococcus_phage(22.22%)	44	NA	NA
WP_059244054.1|1349025_1350438_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_059243436.1|1350579_1351206_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_002963625.1|1351606_1352494_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_059243437.1|1352631_1354290_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	36.3	3.2e-09
WP_059243438.1|1354517_1355465_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_004683131.1|1355464_1355650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243439.1|1355669_1356275_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_059243440.1|1356483_1357362_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_004688061.1|1357475_1357859_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_059243441.1|1357855_1358605_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_059243442.1|1358713_1359754_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_059243443.1|1359759_1360740_+	homoserine kinase	NA	NA	NA	NA	NA
WP_002963635.1|1360736_1361201_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.6	1.7e-40
WP_059242707.1|1361616_1362987_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
WP_082253148.1|1363069_1363255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964694.1|1363341_1363617_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_082253149.1|1363921_1365118_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_059243444.1|1365338_1366169_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_059243445.1|1366198_1366546_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082253150.1|1366535_1366763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082253151.1|1366848_1367088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082253152.1|1367003_1367309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243446.1|1369333_1370341_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_082253153.1|1371252_1372110_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	4.2e-05
WP_059243447.1|1372106_1372955_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	3.2e-21
WP_059243448.1|1373228_1374275_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.2	1.0e-21
WP_059243449.1|1374444_1375281_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_059243450.1|1375368_1376337_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_059243451.1|1376772_1377969_+	DUF2333 domain-containing protein	NA	NA	NA	NA	NA
WP_059243452.1|1379309_1380395_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	57.6	7.6e-20
WP_059243453.1|1380576_1380927_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_059243454.1|1383863_1385111_+	peptide transporter	NA	NA	NA	NA	NA
WP_059243455.1|1385149_1386148_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_059243457.1|1386395_1387067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243459.1|1387088_1388540_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_082253154.1|1388572_1388755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243460.1|1388858_1390175_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_059244056.1|1390569_1391859_+	cell wall hydrolase	NA	A0A218MLD1	uncultured_virus	45.0	1.8e-23
WP_008508103.1|1392129_1392528_+	ATP synthase subunit	NA	NA	NA	NA	NA
WP_059243462.1|1392635_1393385_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_059243464.1|1393452_1393680_+	ATP F0F1 synthase subunit C	NA	NA	NA	NA	NA
WP_008508118.1|1393851_1394478_+	F0F1 ATP synthase subunit B'	NA	NA	NA	NA	NA
WP_059243466.1|1394488_1394968_+	ATP F0F1 synthase subunit B	NA	NA	NA	NA	NA
WP_059242707.1|1395131_1396502_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
>prophage 5
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	1582209	1624619	2177010	tRNA,transposase	Paenibacillus_phage(27.27%)	48	NA	NA
WP_006072570.1|1582209_1583538_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	27.1	8.8e-10
WP_059243586.1|1583534_1584848_+	lipoprotein-releasing system transmembrane subunit LolC	NA	NA	NA	NA	NA
WP_059243587.1|1584847_1585531_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	4.0e-27
WP_059243588.1|1586188_1589680_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	37.6	8.0e-188
WP_002963959.1|1589720_1589918_+	DUF3008 domain-containing protein	NA	NA	NA	NA	NA
WP_059243589.1|1589962_1590361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082253173.1|1590308_1590491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059244077.1|1590793_1591765_-	extensin	NA	NA	NA	NA	NA
WP_002967582.1|1592099_1592717_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002969416.1|1593225_1594107_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	56.4	7.2e-77
WP_059244078.1|1594093_1594909_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_002963966.1|1595139_1596405_-	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
WP_082253174.1|1596388_1596589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243590.1|1596657_1597008_-	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
WP_059243591.1|1597189_1597426_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_059243592.1|1597695_1599918_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.3	9.7e-163
WP_059244079.1|1600104_1600506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243593.1|1600565_1601213_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_059243594.1|1601464_1602136_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002963973.1|1602158_1602401_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_004688254.1|1602516_1603281_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	41.7	3.1e-44
WP_076770561.1|1603305_1603500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243595.1|1603536_1603860_+	DUF1476 domain-containing protein	NA	NA	NA	NA	NA
WP_059243596.1|1604741_1605308_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_059244080.1|1605576_1606452_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_059243597.1|1606498_1606990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243598.1|1606970_1608272_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.9	1.8e-20
WP_059243599.1|1608298_1608976_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_059242692.1|1609104_1609473_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059242693.1|1609469_1609862_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059244081.1|1609908_1610697_-	amino acid ABC transporter	NA	NA	NA	NA	NA
WP_059243600.1|1610952_1611636_+	glycerol-3-phosphatase	NA	NA	NA	NA	NA
WP_059243601.1|1611632_1612772_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_059243602.1|1612775_1613507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243603.1|1613707_1614625_+	sugar kinase	NA	NA	NA	NA	NA
WP_059243604.1|1614621_1615644_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_082253224.1|1615596_1615851_+	endonuclease	NA	NA	NA	NA	NA
WP_059243605.1|1615860_1616622_+	acetylmuramidase	NA	A0A088F6V6	Sulfitobacter_phage	42.1	1.9e-33
WP_002963985.1|1616822_1617104_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_059243606.1|1617251_1618433_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_008505494.1|1618434_1619712_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_059243607.1|1619793_1620822_+	NADPH:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_059243608.1|1620835_1621762_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_059242693.1|1621877_1622270_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242692.1|1622266_1622635_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059243610.1|1622881_1623634_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_059242693.1|1623861_1624254_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059242692.1|1624250_1624619_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	1642647	1654551	2177010	tRNA	uncultured_Mediterranean_phage(80.0%)	13	NA	NA
WP_059243625.1|1642647_1643499_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.9	2.0e-31
WP_059243626.1|1643491_1644217_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	46.2	3.0e-44
WP_002964012.1|1644362_1644581_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_059244083.1|1644692_1645247_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964014.1|1645243_1646068_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_059244082.1|1646144_1647428_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	2.6e-104
WP_059243627.1|1647578_1648346_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.5	1.0e-39
WP_059243628.1|1648342_1649011_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1J0MC50	Streptomyces_phage	31.8	5.0e-14
WP_059243629.1|1649155_1649341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243630.1|1649389_1650688_+	peptidase M24	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_059243631.1|1650736_1651603_-	DUF815 domain-containing protein	NA	NA	NA	NA	NA
WP_002964021.1|1651762_1652104_+	immunogenic membrane protein YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_082253176.1|1652223_1654551_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	8.0e-51
>prophage 7
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	1687788	1747366	2177010	portal,protease,transposase,integrase,tRNA,tail,head	Brucella_phage(32.0%)	63	1687604:1687663	1754357:1754498
1687604:1687663	attL	TCAGACTGCTGACAAACCTCGGGCAGGGTCAAAATGGCCTCAGATTCACGGAACGTCACA	NA	NA	NA	NA
WP_059243653.1|1687788_1689042_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.6	7.6e-64
WP_059243654.1|1689157_1690279_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_009363452.1|1690275_1690608_-	multidrug transporter	NA	E5E3Y9	Acinetobacter_phage	33.7	1.0e-07
WP_059243655.1|1690719_1691397_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059244086.1|1691601_1692780_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.0	5.5e-24
WP_059243656.1|1692960_1694484_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004688299.1|1694551_1695307_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.5	1.2e-08
WP_059243657.1|1695320_1696598_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_059243658.1|1696679_1697924_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.9	3.5e-101
WP_059243659.1|1697920_1698340_+	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_059243660.1|1698373_1699345_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_059243661.1|1699771_1700545_+	NAD kinase	NA	NA	NA	NA	NA
WP_059243662.1|1700872_1702321_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	2.9e-51
WP_059243663.1|1702556_1702937_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	33.7	1.2e-09
WP_059243664.1|1703129_1703753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243665.1|1703833_1704034_+	copper chaperone	NA	NA	NA	NA	NA
WP_044286316.1|1704186_1704369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964067.1|1704362_1705031_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_059243666.1|1705169_1706540_+	transporter	NA	NA	NA	NA	NA
WP_059243667.1|1706791_1707523_+	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_082253180.1|1707617_1707821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243668.1|1707813_1710546_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.9	4.3e-144
WP_059243671.1|1713990_1714866_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059243672.1|1715686_1716520_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_059243673.1|1716522_1717245_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009363100.1|1717260_1717440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243674.1|1717487_1718294_-	amino acid ABC transporter	NA	NA	NA	NA	NA
WP_004689665.1|1718638_1719142_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_082253181.1|1719138_1719804_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_004689666.1|1719979_1721014_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
WP_059243676.1|1721200_1721560_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_059244087.1|1723077_1724697_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_059242692.1|1724985_1725354_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059242693.1|1725350_1725743_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059243677.1|1725850_1727851_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_082253182.1|1728583_1728766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683734.1|1728798_1729050_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_059243678.1|1729517_1730543_-|integrase	integrase	integrase	A0A141GEZ3	Brucella_phage	37.8	9.6e-49
WP_059243679.1|1730529_1730730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002971459.1|1730732_1730948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|1730944_1731148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243680.1|1731144_1731348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082253183.1|1731337_1731526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243681.1|1731509_1731929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243682.1|1732160_1732811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082253225.1|1732937_1733594_-	DUF550 domain-containing protein	NA	A0A076G6W7	Sinorhizobium_phage	75.2	4.9e-46
WP_059243683.1|1733866_1734097_-	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	42.7	7.2e-05
WP_059243684.1|1734093_1734471_-	HNH endonuclease	NA	A0A141GF07	Brucella_phage	41.7	2.6e-07
WP_059243685.1|1734636_1735038_-	hypothetical protein	NA	A0A1I9KFA6	Aeromonas_phage	37.6	8.2e-12
WP_059243687.1|1735729_1736239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243688.1|1736235_1736451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082253226.1|1737154_1738120_+|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	62.0	4.5e-72
WP_059243689.1|1738126_1738789_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	53.6	6.0e-60
WP_059243690.1|1740098_1740278_+	hypothetical protein	NA	A0A2H4JDE5	uncultured_Caudovirales_phage	63.0	3.5e-07
WP_059243691.1|1740281_1740848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243692.1|1740850_1741216_+|head,tail	head-tail adaptor protein	head,tail	A0A141GEW5	Brucella_phage	81.6	1.3e-45
WP_059243693.1|1741193_1741631_+	hypothetical protein	NA	A0A141GEW6	Brucella_phage	55.7	1.6e-37
WP_059476646.1|1742030_1742234_+	hypothetical protein	NA	A0A141GEW8	Brucella_phage	97.0	3.0e-31
WP_059243694.1|1742312_1742765_+	hypothetical protein	NA	A0A141GEW9	Brucella_phage	88.0	3.8e-74
WP_059243695.1|1742764_1743160_+	gene transfer agent family protein	NA	B4UTQ4	Rhizobium_phage	62.3	1.3e-33
WP_059243696.1|1743344_1744919_+	hypothetical protein	NA	B4UTQ6	Rhizobium_phage	35.8	3.0e-57
WP_059243697.1|1744936_1745695_+	hypothetical protein	NA	A0A141GEX2	Brucella_phage	56.5	2.4e-44
WP_059244088.1|1746973_1747366_+	hypothetical protein	NA	A0A141GEY4	Brucella_phage	92.3	3.5e-68
1754357:1754498	attR	TGTGACGTTCCGTGAATCTGAGGCCATTTTGACCCTGCCCGAGGTTTGTCAGCAGTCTGAGCCGCCCACTGAGGCGGCTTTTTCTTTGCCGAAAGGAAATCACCAATGGCTAAGGGAACCTTTGCCAAAGCGATGCCGCATG	NA	NA	NA	NA
>prophage 8
NZ_LN997863	Brucella sp. F60 genome assembly BVF60, chromosome : 1	2177010	2107677	2157878	2177010	tRNA,protease,transposase	Bacillus_virus(14.29%)	50	NA	NA
WP_059242790.1|2107677_2108634_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_059476649.1|2108571_2108949_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_059244111.1|2109321_2110251_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_082253201.1|2110284_2110551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243911.1|2111678_2112458_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.5	2.7e-11
WP_059243912.1|2112472_2113282_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059243913.1|2113375_2113798_+	ribose ABC transporter	NA	NA	NA	NA	NA
WP_059242693.1|2113890_2114283_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	4.1e-16
WP_059243045.1|2114279_2114525_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_006173995.1|2114525_2114648_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059243914.1|2119091_2120159_-	glycoside hydrolase family 43	NA	NA	NA	NA	NA
WP_082253232.1|2120138_2120318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964466.1|2120395_2120632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059244112.1|2120704_2121949_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_059243915.1|2122775_2123078_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_059243916.1|2123126_2123606_+	urease subunit beta	NA	NA	NA	NA	NA
WP_059243917.1|2125412_2126018_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_059244113.1|2125989_2126721_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_002964473.1|2126736_2127375_+	Urease accessory protein UreG 2	NA	NA	NA	NA	NA
WP_059243918.1|2127374_2128289_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_059243919.1|2128298_2129348_+	urea transporter	NA	NA	NA	NA	NA
WP_059243920.1|2129374_2130133_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_059243921.1|2130152_2130788_+	cobalamin biosynthesis protein CbiM	NA	NA	NA	NA	NA
WP_059243922.1|2130784_2131411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243923.1|2131407_2132172_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_059243924.1|2132168_2132888_+	cobalt ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.2	1.8e-17
WP_059243925.1|2132908_2133721_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_059243926.1|2133733_2134123_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_059243927.1|2134392_2135418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059244114.1|2136100_2136535_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_059243928.1|2136583_2137510_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_059243929.1|2137614_2138346_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_059243930.1|2138365_2139475_-	endonuclease	NA	NA	NA	NA	NA
WP_059244115.1|2139659_2140067_+	BA14K family protein	NA	NA	NA	NA	NA
WP_059243931.1|2140273_2141506_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_006642931.1|2141638_2141863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059243932.1|2141940_2142960_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_015799671.1|2143015_2143657_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059243933.1|2143865_2145821_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.9	8.2e-73
WP_059243934.1|2146183_2146924_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_082253233.1|2147222_2147621_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_059243936.1|2147621_2148743_-	ATP-binding protein	NA	A0A291LA07	Bordetella_phage	52.9	1.1e-103
WP_059243937.1|2148922_2149495_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_082253202.1|2149513_2151337_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	32.2	3.6e-54
WP_082253203.1|2151319_2151505_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_059243938.1|2151602_2152517_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_059243939.1|2152534_2153434_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_059244117.1|2154706_2156281_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	8.2e-23
WP_002964504.1|2156770_2156956_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_059243940.1|2156975_2157878_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 1
NZ_LN997864	Brucella sp. F60 genome assembly BVF60, chromosome : 2	1061127	517200	590747	1061127	transposase	Streptococcus_phage(20.0%)	56	NA	NA
WP_059242707.1|517200_518571_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
WP_059244626.1|518952_520170_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_059244628.1|520422_522720_-	GGDEF-domain containing protein	NA	G3MA91	Bacillus_virus	26.9	4.3e-12
WP_059244630.1|523085_523835_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	1.9e-17
WP_059244634.1|524878_525874_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_059244636.1|525959_526979_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_082253267.1|527125_527617_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059244638.1|527795_528566_+	creatininase	NA	NA	NA	NA	NA
WP_059244640.1|528801_529926_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_059244642.1|530044_531019_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_059244643.1|531138_532023_-	carboxylesterase	NA	NA	NA	NA	NA
WP_059244646.1|532427_533387_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_059244647.1|533388_534051_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002965659.1|534267_534612_-	RidA family protein	NA	NA	NA	NA	NA
WP_059245347.1|534685_535639_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059244650.1|535635_536595_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002968592.1|538134_539202_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059244654.1|539503_540298_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059244656.1|540392_541574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059244659.1|541741_543772_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_059244660.1|543869_544277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059244662.1|544417_544804_-	VOC family virulence protein	NA	NA	NA	NA	NA
WP_059244664.1|544986_545592_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_059244666.1|545695_546997_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_059244668.1|547161_548328_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.0	2.6e-18
WP_059244670.1|548502_549735_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_059244672.1|549890_550889_+	3'-5' exonuclease	NA	U5Q053	Bacillus_virus	28.9	1.6e-08
WP_059244675.1|552075_552924_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.1e-21
WP_059244677.1|552920_553946_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	2.3e-18
WP_002965640.1|553942_554803_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_008511275.1|554799_555753_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059476656.1|555850_557329_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059244680.1|558144_559638_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025198526.1|559621_560308_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059244682.1|560678_562058_+	MFS transporter	NA	NA	NA	NA	NA
WP_059242707.1|562439_563810_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	1.2e-83
WP_004682439.1|565234_565579_-	RidA family protein	NA	NA	NA	NA	NA
WP_002965630.1|565661_565886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002965629.1|565886_566021_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004692143.1|566070_566496_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_059244688.1|566485_568318_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_082253268.1|568242_568479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059244690.1|568517_569321_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_059245349.1|569491_570382_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_059244692.1|570428_571133_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_011005564.1|571194_572025_-	3-isopropylmalate dehydrogenase	NA	A0A1D8KU27	Synechococcus_phage	31.9	1.3e-11
WP_002965622.1|572243_573098_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_012460498.1|573241_573493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082253269.1|573492_573825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059244694.1|574078_575266_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_059244696.1|575327_575933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242693.1|576021_576414_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059242692.1|576410_576779_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.4	4.0e-21
WP_082253270.1|576749_577730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243255.1|585306_586263_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_059242967.1|589790_590747_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
