The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	7424	70464	4172466	tRNA,transposase,integrase	Enterobacteria_phage(23.08%)	48	9699:9714	58420:58435
WP_012372820.1|7424_8957_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014342204.1|9596_10145_+	cation:proton antiporter	NA	NA	NA	NA	NA
9699:9714	attL	GCGGTGATGGGGATGG	NA	NA	NA	NA
WP_012372818.1|10225_10981_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|11150_12011_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|12193_12751_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|12914_15920_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_000743213.1|16412_16637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270765.1|16633_17371_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000813355.1|17584_18856_-|transposase	IS4-like element ISPa13 family transposase	transposase	NA	NA	NA	NA
WP_052259183.1|19158_20064_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_001067855.1|20715_21420_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538080.1|21444_23019_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_001276994.1|23821_25489_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|25485_27594_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|27580_28402_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246586.1|28561_30388_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_004246587.1|30545_31919_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246588.1|32069_32486_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246589.1|32507_33890_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246591.1|33924_34788_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246592.1|34845_36387_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246594.1|36401_36935_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246595.1|36947_37418_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246596.1|37479_37719_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246597.1|37764_38589_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246598.1|38620_38998_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_168725742.1|39612_40239_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246600.1|40235_42134_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004249871.1|42513_42954_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004246603.1|43054_43516_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004246604.1|43676_44669_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_049199595.1|44669_46127_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004249869.1|46134_47634_-	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	1.1e-21
WP_060555976.1|47914_48841_+	ribokinase	NA	NA	NA	NA	NA
WP_012368605.1|48922_50320_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_004249867.1|50400_51087_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628596.1|56983_57721_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004246616.1|57711_59130_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
58420:58435	attR	GCGGTGATGGGGATGG	NA	NA	NA	NA
WP_012368603.1|59133_59826_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_110706855.1|59844_61476_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_004246620.1|61777_63433_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_004246621.1|63429_63741_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004249862.1|63905_65864_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004249861.1|66231_66855_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_012368600.1|66972_67647_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_110706856.1|67727_68144_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
WP_110706857.1|68166_69375_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	9.5e-189
WP_004246627.1|69435_70464_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	100772	141482	4172466	transposase,integrase	Escherichia_phage(46.15%)	34	95907:95921	149097:149111
95907:95921	attL	GAAATTAAAAATAAT	NA	NA	NA	NA
WP_001218908.1|100772_101957_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_119563495.1|102801_103755_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_169774393.1|103983_104788_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	4.4e-33
WP_000429836.1|106756_107191_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|107262_107613_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|107626_107902_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|107937_108360_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|108411_110106_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|110123_110486_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|110482_110719_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|110754_111423_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|112812_113517_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|113577_114414_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|114413_115217_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|115277_116093_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_168725740.1|116400_117252_-	replication protein C	NA	NA	NA	NA	NA
WP_001067855.1|118007_118712_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|118862_119678_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|119867_120572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|121156_122017_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_046788546.1|126032_126434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|126518_127223_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|128147_129032_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|129254_130469_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|130496_130802_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|130913_132407_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|132437_132689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|132971_133787_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|133876_134966_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|135163_135649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|137459_138212_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|138633_139659_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|139887_140664_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|140777_141482_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
149097:149111	attR	ATTATTTTTAATTTC	NA	NA	NA	NA
>prophage 3
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	1282106	1290640	4172466		Mycobacterium_phage(28.57%)	9	NA	NA
WP_004246075.1|1282106_1283306_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1283914_1284883_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|1284908_1287035_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1287063_1287468_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1287479_1287704_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1287985_1288459_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1288656_1288866_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|1289168_1289657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1290265_1290640_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 4
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	1330295	1375384	4172466	capsid,integrase,tail,lysis,terminase,tRNA	Morganella_phage(33.33%)	66	1330209:1330227	1373661:1373679
1330209:1330227	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_159241546.1|1330295_1331297_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	7.4e-70
WP_004246013.1|1331253_1331499_-	excisionase	NA	NA	NA	NA	NA
WP_168725584.1|1332664_1333345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827452.1|1333416_1333926_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
WP_017827451.1|1333925_1334537_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
WP_017628824.1|1334538_1334859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|1334855_1335008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919938.1|1335004_1335268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165439118.1|1335275_1335431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919939.1|1335484_1335745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628819.1|1335944_1336442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|1336463_1336781_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_036908285.1|1337235_1337601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|1337597_1338377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908281.1|1338411_1339056_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_004247477.1|1339161_1339371_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_049256531.1|1339516_1339864_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	1.1e-36
WP_004251793.1|1339959_1340133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895070.1|1340129_1340897_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_017628813.1|1340896_1342282_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
WP_081215064.1|1342303_1342639_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	38.7	2.3e-23
WP_036919942.1|1342706_1343156_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1343234_1343525_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1343521_1343878_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|1343877_1344510_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|1344821_1345343_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_060555895.1|1345501_1345924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247489.1|1345977_1346247_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_017628809.1|1346246_1346717_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|1346698_1346857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367624.1|1346859_1347321_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	6.3e-24
WP_004247494.1|1347668_1348253_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245978.1|1348452_1348611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049257606.1|1348641_1348905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162837558.1|1348947_1349109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199098.1|1349101_1349284_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.1	8.2e-20
WP_060556615.1|1349300_1349726_+	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_064497288.1|1349709_1350960_+|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	78.7	2.0e-202
WP_165469406.1|1350959_1352315_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.9	1.2e-163
WP_064497286.1|1352265_1353195_+|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.0	4.1e-91
WP_165469407.1|1353198_1354476_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	69.6	2.9e-167
WP_165469408.1|1354475_1354925_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	5.7e-46
WP_060556621.1|1354937_1356032_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.5e-145
WP_004247764.1|1356041_1356215_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_165469409.1|1356272_1356671_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.0e-55
WP_175270662.1|1356670_1357012_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	53.4	7.2e-25
WP_175270663.1|1357013_1357385_+	HK97 gp10 family phage protein	NA	G0ZNE3	Cronobacter_phage	65.9	8.6e-40
WP_175270664.1|1357381_1357750_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	6.4e-11
WP_063073751.1|1357814_1358570_+	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.2e-107
WP_175270665.1|1358619_1359312_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.5	9.9e-90
WP_004245955.1|1360214_1360376_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_060556276.1|1360489_1360747_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_060556275.1|1360743_1361088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556274.1|1361074_1361440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073753.1|1361503_1361884_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_175270666.1|1361947_1365259_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	42.3	2.7e-177
WP_017827415.1|1365274_1365475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827414.1|1365476_1365788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924191.1|1365932_1366262_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	1.3e-42
WP_049199072.1|1366258_1366957_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.6	1.8e-115
WP_175270667.1|1366960_1367680_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.0	1.8e-110
WP_036935929.1|1367616_1368183_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_175270668.1|1368182_1371806_+	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	65.6	0.0e+00
WP_175270669.1|1371821_1373237_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	54.0	9.0e-114
WP_175270670.1|1373241_1373472_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.8	9.1e-32
WP_012367653.1|1373716_1375384_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
1373661:1373679	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 5
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	1541424	1619932	4172466	tRNA,plate,protease	Bacillus_phage(23.53%)	57	NA	NA
WP_004244558.1|1541424_1541739_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1541769_1544064_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1544182_1544401_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1544720_1545413_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1545414_1547166_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	4.0e-18
WP_017628444.1|1547168_1548938_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004247618.1|1549076_1550036_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_004244566.1|1550578_1551073_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_175270673.1|1551200_1554998_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1555110_1555716_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_110706932.1|1555726_1557076_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	4.0e-79
WP_004244571.1|1557209_1558499_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1558678_1559011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247622.1|1559411_1560461_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_168725593.1|1560533_1561439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1561796_1562537_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1562644_1564927_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1564981_1565836_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036900836.1|1566506_1568264_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1568491_1569529_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_108717050.1|1569603_1570857_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104459796.1|1570993_1572424_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.8	1.5e-07
WP_004244582.1|1572560_1573649_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004252010.1|1573845_1575132_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1575420_1576098_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1576279_1577953_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1578017_1578305_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_143475375.1|1578729_1581099_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1581135_1582881_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|1582877_1583879_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1584374_1584590_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1585004_1585184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1585188_1585950_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004247632.1|1586072_1586903_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004247633.1|1587282_1588056_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1588065_1589388_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1589368_1590100_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_004247635.1|1590096_1594554_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1594835_1595489_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1595895_1596609_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004247638.1|1596951_1598667_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_168725594.1|1598998_1599547_+	DUF882 domain-containing protein	NA	NA	NA	NA	NA
WP_004247640.1|1599596_1600247_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1600339_1600813_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247642.1|1600903_1602640_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244609.1|1602632_1603988_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244610.1|1604025_1607574_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_110706694.1|1607576_1609040_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1609045_1609696_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1609697_1610486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104459791.1|1610489_1613213_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1613221_1613977_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1613969_1615328_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1615329_1615881_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1615882_1617151_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|1617155_1618193_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|1618156_1619932_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	1788242	1864172	4172466	capsid,integrase,tail,lysis,holin,protease,tRNA,terminase,portal,head	Enterobacteria_phage(19.12%)	92	1800378:1800401	1838318:1838341
WP_168725627.1|1788242_1789346_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1789451_1789904_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247841.1|1789896_1790526_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1790664_1791918_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_049217409.1|1792038_1793166_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.6	2.8e-126
WP_036894694.1|1793146_1793389_-	excisionase	NA	NA	NA	NA	NA
WP_175270676.1|1793453_1793984_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	58.0	6.3e-52
WP_175270766.1|1794067_1794940_-	recombination-associated protein RdgC	NA	A0A1P8DTT8	Salmonella_phage	48.1	6.5e-62
WP_049255035.1|1795633_1796359_-	transcriptional regulator	NA	E7C9R0	Salmonella_phage	35.5	7.1e-30
WP_036900996.1|1796427_1796661_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	40.9	2.2e-09
WP_036900998.1|1796712_1797171_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_004247131.1|1797258_1797468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247132.1|1797457_1797637_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_108716954.1|1797649_1798711_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	55.3	7.9e-30
WP_036901006.1|1798710_1799349_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	65.0	1.1e-82
WP_064506369.1|1799345_1799741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270677.1|1799813_1800197_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	52.9	3.3e-26
WP_071425693.1|1800215_1801019_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.7	1.3e-88
1800378:1800401	attL	ACCGCTCCTGAGATCACAGGAGCG	NA	NA	NA	NA
WP_175270678.1|1801015_1802041_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.7	1.7e-85
WP_175270679.1|1802068_1802464_+	antitermination protein	NA	S5M7R9	Escherichia_phage	57.9	3.7e-33
WP_175270767.1|1802617_1802851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049210579.1|1802992_1803187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270680.1|1803260_1804280_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	67.4	6.9e-132
WP_088206692.1|1804593_1805163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207259.1|1805454_1805760_+|holin	holin	holin	F1C5D1	Cronobacter_phage	52.4	5.1e-22
WP_104836860.1|1805791_1806145_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	79.8	6.7e-42
WP_175270681.1|1806150_1806597_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	32.4	2.4e-12
WP_175270682.1|1807116_1807494_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	52.7	1.3e-19
WP_070486613.1|1808270_1808783_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	4.3e-58
WP_070486615.1|1808795_1809290_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	66.3	1.6e-49
WP_175270683.1|1809286_1811389_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.8	5.0e-294
WP_004247869.1|1811385_1811601_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_064506398.1|1811597_1813088_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.4	1.1e-191
WP_175270684.1|1813053_1815042_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	63.1	6.3e-246
WP_175270685.1|1815130_1815472_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
WP_063073894.1|1815483_1815756_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
WP_063073895.1|1815765_1816329_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_036973524.1|1816328_1816724_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_074153257.1|1816735_1817257_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.2e-65
WP_070486629.1|1817268_1817658_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	41.5	8.2e-17
WP_083297149.1|1817678_1817999_+|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	40.0	5.7e-16
WP_175270686.1|1817967_1820982_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	29.3	3.0e-82
WP_110229326.1|1820982_1821312_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	53.7	4.3e-27
WP_004247884.1|1821406_1821982_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	34.1	4.9e-18
WP_049206339.1|1822034_1822739_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.6	4.6e-66
WP_110229325.1|1822760_1823489_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	2.3e-89
WP_049209898.1|1823392_1824043_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	46.3	1.3e-46
WP_175270687.1|1827788_1829177_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	54.9	7.3e-116
WP_071891016.1|1829287_1830514_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_058336134.1|1830520_1831177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058336135.1|1831173_1832295_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.6	3.7e-17
WP_060556847.1|1832800_1833934_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.8	1.0e-155
WP_017628380.1|1833908_1834160_-	excisionase	NA	NA	NA	NA	NA
WP_060556846.1|1834245_1834770_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.6	1.0e-54
WP_049217153.1|1835158_1835806_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	65.1	2.9e-75
WP_049217157.1|1835909_1836104_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	61.0	6.5e-15
WP_060556845.1|1836141_1836618_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	3.0e-45
WP_036976728.1|1836680_1836890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628377.1|1836879_1837059_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_060556894.1|1837616_1838132_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_060556844.1|1838153_1838960_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.5	1.8e-90
1838318:1838341	attR	CGCTCCTGTGATCTCAGGAGCGGT	NA	NA	NA	NA
WP_060556843.1|1838956_1839982_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.5	9.2e-84
WP_049219743.1|1840009_1840408_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_004244726.1|1840748_1840961_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_060556842.1|1841292_1841751_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_060556841.1|1842244_1843060_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_060556840.1|1843049_1846157_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_175270688.1|1846587_1847010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|1847063_1847333_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_168725628.1|1847332_1847803_+	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	63.4	4.7e-51
WP_175270689.1|1847945_1848407_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.7	1.1e-12
WP_168725631.1|1848403_1848772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725632.1|1849465_1849816_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	92.9	4.6e-59
WP_168725633.1|1849812_1850214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725634.1|1850404_1850899_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	75.6	4.5e-68
WP_168725635.1|1850895_1852626_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	82.3	4.1e-294
WP_049212495.1|1852635_1852815_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	54.7	1.7e-09
WP_168725636.1|1852814_1854044_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	72.2	7.2e-176
WP_175270768.1|1854021_1854666_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.0	8.1e-94
WP_168725638.1|1854679_1855888_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	69.1	1.1e-155
WP_063109140.1|1855969_1856278_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	40.2	4.8e-12
WP_168725639.1|1856274_1856604_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_168725640.1|1856593_1857067_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	1.6e-11
WP_109372567.1|1857072_1857414_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_109880550.1|1857423_1858089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088495854.1|1858153_1858570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270690.1|1858614_1858845_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_168725641.1|1858886_1862165_+|tail	phage tail tape measure protein	tail	A0A2I2L6P9	Escherichia_phage	27.7	2.5e-42
WP_161739356.1|1862165_1862762_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	2.1e-51
WP_115370344.1|1862761_1863343_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
WP_049219722.1|1863359_1863695_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_168725642.1|1863773_1864172_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	1.2e-31
>prophage 7
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	2667736	2686605	4172466	lysis,plate,holin	Burkholderia_phage(26.67%)	22	NA	NA
WP_012368081.1|2667736_2670175_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_049213336.1|2670186_2670804_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	4.4e-89
WP_004243611.1|2670807_2671584_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2671699_2672242_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2672810_2672990_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_108716900.1|2673129_2674365_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
WP_004243615.1|2674370_2675027_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_017628010.1|2675023_2676211_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2676203_2676548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2676544_2677237_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2677239_2678052_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2678020_2678341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971128.1|2678346_2678841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107337176.1|2678843_2681147_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.0e-14
WP_004243627.1|2681229_2681688_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2681747_2682200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107337175.1|2682210_2683698_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	4.2e-77
WP_110706591.1|2683706_2684219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918597.1|2684255_2684705_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_110706590.1|2684701_2685106_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	1.1e-24
WP_168725667.1|2685108_2685357_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	53.8	8.9e-17
WP_036918599.1|2685789_2686605_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.3	2.1e-54
>prophage 8
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	3181390	3228897	4172466	tail,holin,plate,terminase,head	Acinetobacter_phage(30.61%)	70	NA	NA
WP_049201132.1|3181390_3182017_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	31.1	4.4e-12
WP_004244239.1|3182207_3182879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270707.1|3184045_3184276_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	4.8e-33
WP_156733215.1|3184276_3184897_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_175270769.1|3184896_3185352_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	51.0	4.2e-28
WP_175270708.1|3186484_3187117_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	49.0	2.5e-47
WP_175270709.1|3187116_3188307_-|plate	baseplate J/gp47 family protein	plate	E2GM17	Acinetobacter_phage	40.4	2.2e-76
WP_049206563.1|3188303_3188657_-	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	52.1	9.4e-28
WP_175270710.1|3188658_3189351_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	41.4	4.8e-28
WP_175270711.1|3189331_3190219_-	hypothetical protein	NA	E2GM20	Acinetobacter_phage	40.8	1.8e-59
WP_049206569.1|3190205_3190481_-	hypothetical protein	NA	A0A1X9SFF3	Acinetobacter_phage	47.2	6.4e-16
WP_175270712.1|3190481_3191174_-	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	54.4	4.7e-47
WP_132587798.1|3191269_3192640_-	Fic family protein	NA	NA	NA	NA	NA
WP_175270713.1|3192942_3193251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270714.1|3193523_3193988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270715.1|3194052_3196443_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	39.4	3.0e-125
WP_175270716.1|3196696_3197107_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	40.7	1.9e-19
WP_129037599.1|3197106_3197553_-	hypothetical protein	NA	A0A1V0DZ74	Acinetobacter_phage	51.0	9.7e-38
WP_175270717.1|3197565_3199023_-	DUF3383 domain-containing protein	NA	H9C0W5	Aeromonas_phage	34.5	1.0e-67
WP_175270718.1|3199034_3199520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270719.1|3199507_3199888_-	hypothetical protein	NA	K4I3A0	Acinetobacter_phage	42.6	1.2e-23
WP_175270720.1|3199874_3200333_-	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	31.0	2.2e-08
WP_175270770.1|3200325_3200784_-	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	44.7	9.7e-17
WP_175270721.1|3200810_3201128_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.0	3.7e-07
WP_175270722.1|3201187_3202186_-	DUF2184 domain-containing protein	NA	I2GUD7	Acinetobacter_phage	52.3	1.6e-85
WP_175270723.1|3202195_3202681_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	43.0	1.2e-17
WP_175270724.1|3202693_3203908_-	DUF2213 domain-containing protein	NA	A0A1X9SFH3	Acinetobacter_phage	55.5	6.2e-55
WP_175270725.1|3203920_3204712_-|head	phage head morphogenesis protein	head	A0A0D4DCM6	Acinetobacter_phage	40.5	4.5e-54
WP_175270726.1|3204683_3206216_-	DUF1073 domain-containing protein	NA	A0A192RWX3	Acinetobacter_phage	51.2	4.7e-116
WP_175270727.1|3206215_3207739_-|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	49.9	1.3e-129
WP_175270728.1|3208328_3209015_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	77.6	1.2e-98
WP_175270729.1|3209453_3209723_-	peptidase	NA	Q8SBD8	Shigella_phage	46.4	9.3e-12
WP_175270730.1|3209610_3209988_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	32.5	2.2e-06
WP_036976899.1|3209989_3210322_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_175270731.1|3210308_3210602_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3210598_3210988_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_175270732.1|3211576_3212416_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	43.8	1.0e-56
WP_049199110.1|3212412_3212604_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	2.3e-28
WP_107336910.1|3212756_3213350_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	89.2	3.7e-85
WP_159046734.1|3213321_3213465_-	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	87.2	2.7e-18
WP_175270733.1|3213461_3214124_-	metallophosphoesterase	NA	K7P721	Enterobacteria_phage	62.3	1.2e-73
WP_155120990.1|3214120_3214264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270734.1|3214266_3214710_-	recombination protein NinB	NA	K7P7B8	Enterobacteria_phage	54.6	8.1e-37
WP_175270735.1|3214786_3215086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894660.1|3215172_3215337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270736.1|3215382_3215592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074561840.1|3215578_3215806_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152964332.1|3215821_3215989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270737.1|3216008_3217385_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	59.0	4.5e-158
WP_175270738.1|3217384_3218482_-	replication protein	NA	E5AGE9	Erwinia_phage	56.5	1.6e-102
WP_049199128.1|3218474_3218654_-	hypothetical protein	NA	G9L679	Escherichia_phage	59.6	2.9e-09
WP_175233712.1|3218646_3218823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175270739.1|3218919_3219267_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	33.3	4.9e-05
WP_071233781.1|3219372_3219600_-	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
WP_175270740.1|3219704_3220430_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	42.6	4.9e-47
WP_149127671.1|3220667_3221012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270741.1|3221658_3221895_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	84.8	4.6e-07
WP_175270742.1|3221910_3222498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245997.1|3222769_3222952_+	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
WP_175270743.1|3223079_3223334_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	98.8	1.0e-39
WP_175270744.1|3223330_3224149_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	97.1	2.0e-158
WP_175270745.1|3224141_3224948_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	98.1	3.3e-145
WP_175270746.1|3225482_3225806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270747.1|3225802_3226258_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	27.8	9.3e-12
WP_175270748.1|3226333_3227047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270749.1|3227093_3227348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124725260.1|3227340_3227709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270750.1|3227872_3228046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175270751.1|3228038_3228362_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	73.3	3.0e-33
WP_175270752.1|3228351_3228897_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	62.6	4.6e-58
>prophage 9
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	3491932	3500812	4172466		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3491932_3493501_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3493901_3494582_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3494678_3495254_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3495330_3495909_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3495976_3497002_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3497036_3497492_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_143475448.1|3497516_3498689_-	TerD family protein	NA	NA	NA	NA	NA
WP_004245609.1|3498689_3499274_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|3499666_3500812_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 10
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	3590356	3641522	4172466	protease,integrase,transposase,holin	Salmonella_phage(22.22%)	40	3581883:3581897	3643570:3643584
3581883:3581897	attL	GTCATGGCTTTTGAT	NA	NA	NA	NA
WP_109880364.1|3590356_3592387_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_060554886.1|3592609_3595279_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_060554887.1|3595278_3598896_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_060554888.1|3599052_3602730_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_004249341.1|3602748_3603333_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_049194747.1|3603329_3603929_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_156868342.1|3603938_3604865_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001259346.1|3607879_3608587_-	DsbC family protein	NA	NA	NA	NA	NA
WP_000606835.1|3608735_3614222_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000118520.1|3614949_3615267_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001221666.1|3615263_3615797_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_175270758.1|3615890_3617036_-	CMY-2 family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001339197.1|3618136_3619345_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_072156948.1|3619685_3619880_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001520030.1|3619984_3620704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049218683.1|3620804_3621098_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_049218680.1|3621775_3622975_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_049218678.1|3623276_3623678_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_060555124.1|3624094_3624496_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_060555123.1|3624577_3624931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555122.1|3625002_3625251_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_060555121.1|3625700_3626048_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_060555120.1|3626047_3626347_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_060555126.1|3626467_3626656_+	DUF5397 family protein	NA	NA	NA	NA	NA
WP_060555119.1|3626659_3626938_+	virulence factor	NA	NA	NA	NA	NA
WP_060555118.1|3627404_3628895_+	YadA-like family protein	NA	S4TRP0	Salmonella_phage	33.3	4.6e-07
WP_060555117.1|3629306_3629513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555116.1|3629509_3630133_-	ParA family protein	NA	A0A222ZPP5	Mycobacterium_phage	31.8	5.7e-12
WP_060555115.1|3630601_3631120_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_109880811.1|3631370_3632021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520048.1|3632062_3632371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|3633348_3634557_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_004249335.1|3634840_3635749_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	27.5	2.8e-07
WP_156868445.1|3636237_3636390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249334.1|3636388_3636838_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_036973679.1|3636845_3638114_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.2	1.2e-141
WP_008305549.1|3638124_3638568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3639032_3640007_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_004249313.1|3640009_3640279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249312.1|3640280_3641522_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.1	3.8e-76
3643570:3643584	attR	ATCAAAAGCCATGAC	NA	NA	NA	NA
>prophage 11
NZ_CP046048	Proteus mirabilis strain HN2p chromosome HN2p, complete sequence	4172466	4145046	4161194	4172466	transposase,integrase	Stx2-converting_phage(22.22%)	16	4134613:4134625	4156176:4156188
4134613:4134625	attL	CAGCAGGGCAGTC	NA	NA	NA	NA
WP_000080195.1|4145046_4146660_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|4146690_4147041_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000981822.1|4147037_4147442_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	84.3	1.4e-30
WP_096043063.1|4147404_4148421_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_000412211.1|4149540_4150200_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|4150400_4150778_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|4150844_4153811_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|4153813_4154374_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4154499_4154850_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|4155052_4156066_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|4156210_4156708_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
4156176:4156188	attR	CAGCAGGGCAGTC	NA	NA	NA	NA
WP_001336345.1|4156819_4157110_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|4157115_4157907_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|4158070_4158418_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_175270761.1|4158411_4159248_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000050481.1|4159652_4161194_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
