The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	1161397	1212000	4669238	integrase,capsid,plate,holin,tail,tRNA	Salmonella_phage(77.55%)	61	1155730:1155744	1169375:1169389
1155730:1155744	attL	GAATTAAAAAACAAA	NA	NA	NA	NA
WP_175268202.1|1161397_1162135_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001535060.1|1162119_1163742_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1164005_1164170_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1164166_1164742_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1164773_1165424_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1165423_1166380_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1166376_1166856_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1167353_1168583_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1168560_1168845_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1168885_1169125_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1169167_1170325_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
1169375:1169389	attR	TTTGTTTTTTAATTC	NA	NA	NA	NA
WP_175268203.1|1170287_1173215_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1173341_1173692_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_175268204.1|1173758_1173872_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.3	2.1e-13
WP_001009037.1|1174270_1174675_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1174804_1175041_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1175006_1175381_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1175465_1176449_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1176451_1177201_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1177211_1177559_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1177555_1178080_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_175268205.1|1178079_1178553_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	4.7e-67
WP_001217666.1|1179417_1179657_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000929788.1|1179991_1180594_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001674644.1|1180593_1180794_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	9.3e-33
WP_001096567.1|1180802_1181444_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	98.6	1.8e-114
WP_001617856.1|1181440_1181587_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001749676.1|1181576_1182374_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	6.8e-151
WP_162264800.1|1182778_1183120_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_080162293.1|1183122_1183737_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.6	4.1e-111
WP_079786452.1|1183733_1184276_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_175268206.1|1184378_1184882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057515247.1|1185185_1185815_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	85.2	6.9e-90
WP_094198603.1|1185817_1187440_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	99.3	0.0e+00
WP_094198602.1|1187439_1188906_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.6	4.0e-282
WP_175268669.1|1188793_1189531_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	98.5	2.4e-110
WP_175268207.1|1189545_1190778_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	4.8e-228
WP_000128057.1|1190782_1191280_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_023203960.1|1191291_1192233_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.4	3.5e-178
WP_001040692.1|1192274_1192643_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	98.4	5.7e-60
WP_001125676.1|1192608_1193016_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	3.0e-70
WP_000008736.1|1193012_1193567_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.8e-94
WP_001142488.1|1193553_1193943_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_023204283.1|1193917_1194481_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	5.8e-80
WP_094198599.1|1194484_1195630_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	2.7e-164
WP_000257261.1|1195641_1196082_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_000393955.1|1196085_1196511_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	58.8	7.0e-38
WP_175268208.1|1196688_1198770_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	56.3	1.3e-204
WP_001166624.1|1199372_1199678_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	50.5	2.1e-20
WP_024153736.1|1199680_1200745_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	66.2	7.5e-137
WP_001216233.1|1200757_1201102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224930.1|1201103_1201880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268209.1|1201860_1202232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122299.1|1202286_1203024_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	62.0	4.9e-87
WP_001270639.1|1203023_1203377_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	2.5e-44
WP_140902828.1|1203377_1204577_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	91.2	1.8e-200
WP_070802312.1|1204573_1205254_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	99.6	2.1e-129
WP_175268210.1|1205253_1206894_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	68.4	7.4e-152
WP_000421115.1|1206908_1207427_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_079812307.1|1208305_1209796_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_000790154.1|1210200_1212000_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
>prophage 2
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	1650770	1659941	4669238	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_076933014.1|1650770_1651718_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1651701_1652433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1652413_1652521_-	protein YohO	NA	NA	NA	NA	NA
WP_175268265.1|1652580_1653312_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1653534_1655220_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1655216_1655936_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_175268266.1|1655982_1656450_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	1.5e-73
WP_175268267.1|1656506_1657037_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	32.4	4.7e-15
WP_000703136.1|1657208_1657667_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_175268268.1|1657907_1659941_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	1817650	1824897	4669238		Morganella_phage(33.33%)	8	NA	NA
WP_080108798.1|1817650_1818070_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	4.2e-35
WP_064013310.1|1818072_1819341_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	1.9e-227
WP_000208509.1|1819807_1820020_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1820030_1820219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080108800.1|1820478_1821657_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.5	8.6e-110
WP_000107437.1|1822306_1822618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377038.1|1822697_1823393_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_079965408.1|1823466_1824897_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 4
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	1929801	1975389	4669238	integrase,plate,head,tail,lysis	Edwardsiella_phage(17.39%)	63	1926299:1926313	1975629:1975643
1926299:1926313	attL	CATATTGCTGTATTT	NA	NA	NA	NA
WP_022742740.1|1929801_1930881_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|1930855_1931134_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022630509.1|1931206_1931623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053445486.1|1931619_1933713_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.6	5.7e-197
WP_053445485.1|1933709_1933967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280164.1|1934060_1934246_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
WP_001126031.1|1934292_1935123_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_079981264.1|1935115_1937806_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	4.8e-116
WP_000799629.1|1937946_1938282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1938357_1938564_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_079981263.1|1938567_1938843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679873.1|1939121_1939364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137975606.1|1939532_1939730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079961102.1|1940031_1940187_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_001224472.1|1940496_1940922_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001033911.1|1941018_1941273_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_078054855.1|1941259_1941754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079981262.1|1941797_1942805_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	6.9e-124
WP_157872077.1|1942716_1943259_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_079981261.1|1943271_1943667_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	2.2e-17
WP_079981260.1|1943663_1943936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1944139_1944295_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000911592.1|1944544_1944793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079981259.1|1944966_1945404_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.8	5.2e-52
WP_000861020.1|1945591_1945873_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_079981257.1|1945869_1946424_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.2	5.4e-62
WP_001534362.1|1946695_1947250_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	2.8e-55
WP_001534381.1|1947491_1947680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|1947848_1948055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742726.1|1948045_1948591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1948782_1949085_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001208105.1|1949062_1949602_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	5.7e-77
WP_175268304.1|1949702_1950167_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.0	4.1e-55
WP_001113128.1|1950392_1950575_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_023257591.1|1950645_1951275_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	2.5e-108
WP_023257592.1|1951277_1952897_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.6	1.7e-262
WP_079961150.1|1952896_1954417_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	7.0e-104
WP_000552017.1|1954457_1955147_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023257595.1|1955143_1956490_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
WP_023257596.1|1956491_1956974_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	48.8	8.3e-27
WP_001031913.1|1956973_1958002_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_023209779.1|1958005_1958353_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.1	1.5e-09
WP_001748492.1|1958359_1958815_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_045717122.1|1958808_1959393_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	4.2e-17
WP_001048637.1|1959389_1959755_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000094504.1|1959739_1960285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023257599.1|1960265_1961750_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.2	1.8e-96
WP_000016414.1|1961750_1962197_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_023257600.1|1962196_1962601_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1962642_1962825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023257601.1|1962808_1964980_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_175268305.1|1964976_1965687_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_000890115.1|1965686_1965989_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1965985_1966855_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_023257603.1|1966835_1967513_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_175268306.1|1967525_1967882_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	5.5e-20
WP_079802220.1|1967878_1969120_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
WP_001181747.1|1969121_1969724_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_175268307.1|1969713_1971168_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	68.2	1.5e-39
WP_079981252.1|1971167_1971743_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	87.4	2.1e-93
WP_175268308.1|1972396_1972954_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	34.0	6.0e-21
WP_175268309.1|1973241_1973442_-	phage virulence factor	NA	NA	NA	NA	NA
WP_080250402.1|1974648_1975389_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.2	2.0e-51
1975629:1975643	attR	CATATTGCTGTATTT	NA	NA	NA	NA
>prophage 5
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	2154087	2160548	4669238		Salmonella_phage(33.33%)	9	NA	NA
WP_000230462.1|2154087_2154894_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_175268323.1|2154895_2155888_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2155887_2156778_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001543117.1|2156901_2157303_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	8.4e-33
WP_080094802.1|2158427_2158673_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	82.5	3.1e-22
WP_175268324.1|2159027_2159168_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.9e-08
WP_080108316.1|2159206_2159506_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	6.5e-14
WP_080094800.1|2159432_2159858_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_079981220.1|2160236_2160548_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.0	1.6e-39
>prophage 6
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	2546881	2591251	4669238	integrase,terminase,transposase,capsid,tRNA,portal,plate,holin,head,tail,lysis	Enterobacteria_phage(71.43%)	52	2538117:2538132	2563171:2563186
2538117:2538132	attL	ACCTGAAATTCGCGCC	NA	NA	NA	NA
WP_175268673.1|2546881_2547835_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	48.6	4.6e-77
WP_058106648.1|2547924_2548236_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_058343723.1|2548330_2548609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268379.1|2548768_2549167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730661.1|2549238_2549481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268380.1|2549486_2549690_+	LapA family protein	NA	NA	NA	NA	NA
WP_020844111.1|2549659_2549851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268381.1|2549926_2550367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730664.1|2550608_2551142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730665.1|2551138_2551417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268382.1|2551413_2552361_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.8	1.5e-64
WP_175268383.1|2552601_2555040_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	49.5	6.2e-171
WP_175268384.1|2555032_2555446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268385.1|2555760_2557119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139762954.1|2557133_2557358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080204499.1|2558343_2559393_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.6	3.9e-154
WP_175268386.1|2559392_2561126_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	74.8	9.3e-262
WP_175268387.1|2561282_2562119_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	1.3e-99
WP_175268388.1|2562140_2563226_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	67.8	9.3e-135
2563171:2563186	attR	ACCTGAAATTCGCGCC	NA	NA	NA	NA
WP_175268389.1|2563272_2564103_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	67.2	4.2e-87
WP_175268390.1|2564204_2564699_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	57.7	1.2e-49
WP_001658929.1|2564698_2564899_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	80.3	1.9e-22
WP_024146654.1|2564929_2565268_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_058112086.1|2565264_2565708_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.9	1.6e-45
WP_175268391.1|2565714_2566206_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	41.9	3.4e-20
WP_175268392.1|2566192_2566669_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.0	1.4e-39
WP_175268393.1|2566665_2567301_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	58.4	1.2e-62
WP_175268394.1|2567297_2567888_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	69.1	3.7e-69
WP_175268395.1|2567884_2568253_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	70.4	3.2e-39
WP_175268396.1|2568239_2569136_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.5	1.7e-105
WP_175268397.1|2569128_2569656_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.9	1.2e-58
WP_175268398.1|2571364_2571940_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.1	6.3e-90
WP_115409529.1|2572593_2573151_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	34.0	4.6e-21
WP_175268399.1|2573413_2573983_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.4	9.0e-97
WP_175268400.1|2574110_2574599_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	2.5e-71
WP_175268401.1|2574612_2577573_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.5	1.9e-254
WP_175268402.1|2577559_2577718_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	6.9e-15
WP_175268403.1|2577723_2578080_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	47.4	1.7e-16
WP_079821767.1|2578122_2578635_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	1.0e-62
WP_023170310.1|2578635_2579823_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	82.5	1.1e-186
WP_175268404.1|2579981_2581112_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.5	2.5e-151
WP_024143245.1|2581157_2581418_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024143244.1|2581651_2581792_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	73.9	8.2e-12
WP_175268405.1|2581988_2583158_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.0e-18
WP_001229266.1|2584084_2584384_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672402.1|2584388_2586776_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|2586791_2587775_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2587911_2587956_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2588076_2588433_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2588483_2588681_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|2588776_2589319_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144226.1|2589322_2591251_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
>prophage 7
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	2680594	2688798	4669238		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2680594_2680834_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_058331232.1|2681051_2681216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024797574.1|2681713_2682523_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	4.6e-62
WP_001277616.1|2682595_2682973_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2683120_2683663_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_011233073.1|2683854_2684583_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_011233074.1|2684599_2685013_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_061383022.1|2685964_2687089_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444508.1|2687547_2688798_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 8
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	2838794	2882510	4669238	integrase,terminase,plate,protease,tail,lysis	Escherichia_phage(44.12%)	56	2839595:2839654	2881352:2881429
WP_175268434.1|2838794_2839475_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	7.5e-82
2839595:2839654	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_024138909.1|2840142_2840334_-	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_001530989.1|2840442_2840877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268435.1|2841804_2842038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175268436.1|2842177_2842753_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	85.8	3.1e-89
WP_175268437.1|2842752_2844462_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	5.8e-91
WP_000729406.1|2844458_2845085_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_046891338.1|2845068_2846295_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	63.6	6.4e-148
WP_175268438.1|2846291_2846624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268439.1|2846620_2847337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046891340.1|2847333_2848374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000061271.1|2848373_2848649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000011138.1|2848645_2849362_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	1.3e-28
WP_175268440.1|2849361_2851416_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	1.3e-20
WP_023136430.1|2851539_2852127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133547.1|2852126_2852564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079948669.1|2852567_2853962_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	9.3e-71
WP_010835739.1|2853967_2854906_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.5	1.9e-51
WP_031604700.1|2854889_2855300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114360.1|2855317_2855743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001643824.1|2855755_2856241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268441.1|2856305_2857337_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	8.7e-74
WP_023181116.1|2857354_2858227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406012.1|2858247_2859822_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	1.3e-20
WP_050194918.1|2859822_2860698_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.8	1.5e-55
WP_001150142.1|2860669_2862100_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
WP_010835733.1|2862099_2863371_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	5.1e-84
WP_010835732.1|2863360_2864332_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	33.2	2.0e-24
WP_058108913.1|2864427_2864643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268442.1|2864757_2865261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088759388.1|2865589_2866033_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.7	4.7e-53
WP_175268443.1|2866053_2866542_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	67.5	3.9e-56
WP_001526513.1|2866519_2866822_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|2867024_2867213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268444.1|2867605_2868184_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.4	4.0e-44
WP_000717784.1|2868180_2868474_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2868470_2869067_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2869135_2869327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268445.1|2869510_2869849_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	84.8	5.4e-49
WP_023228212.1|2870015_2870618_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	2.3e-98
WP_175268446.1|2870610_2870859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042827231.1|2870862_2871543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001643784.1|2871580_2872969_-	replication protein P	NA	Q76H51	Enterobacteria_phage	47.1	2.0e-105
WP_175268447.1|2872965_2873946_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	4.0e-44
WP_001195066.1|2873948_2874173_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_000429172.1|2874195_2874642_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	1.9e-25
WP_000364674.1|2874706_2874940_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_024136813.1|2875048_2875504_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	1.7e-34
WP_000387662.1|2876190_2876514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039520540.1|2876521_2876767_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	52.5	7.7e-13
WP_175268448.1|2876796_2879070_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.3	2.2e-106
WP_175268449.1|2879066_2879621_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	58.8	3.7e-47
WP_000916251.1|2879623_2879806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196401.1|2880018_2880243_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_039520531.1|2880243_2881263_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.6e-91
WP_000374046.1|2881850_2882510_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2881352:2881429	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 9
NZ_CP054827	Salmonella enterica subsp. enterica serovar Adjame strain 389598 chromosome, complete genome	4669238	4255957	4297208	4669238	holin,tail,plate,tRNA	Burkholderia_phage(44.44%)	43	NA	NA
WP_001182233.1|4255957_4256956_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4257043_4258354_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4258600_4259116_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4259215_4259425_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4259446_4259560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175268618.1|4259556_4260882_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4261060_4261669_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4261777_4262146_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4262316_4264737_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4264835_4265708_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4265721_4266219_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4266399_4267317_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4267480_4268839_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4268927_4270037_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4270398_4271589_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_175268619.1|4271720_4273265_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4273279_4274170_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4274335_4274746_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_175268620.1|4274888_4276985_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_076727770.1|4276984_4277722_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_175268621.1|4277718_4278387_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4278420_4278663_-	outer membrane protein	NA	NA	NA	NA	NA
WP_175268622.1|4279106_4280756_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4281144_4282494_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4282621_4282969_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4283543_4283831_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_076936134.1|4283833_4284439_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_175268623.1|4284451_4284766_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
WP_175268624.1|4284925_4285381_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_088524143.1|4285377_4285575_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	54.9	3.0e-07
WP_023181260.1|4285564_4286992_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
WP_175268625.1|4286991_4287516_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	7.3e-69
WP_001003637.1|4287567_4287885_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4287844_4287973_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_175268626.1|4288069_4290436_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.7	1.5e-65
WP_076936123.1|4290435_4291389_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.9e-36
WP_076936121.1|4291388_4291598_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	4.4e-17
WP_175268627.1|4291585_4292626_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.3	7.9e-75
WP_000679392.1|4292635_4293358_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_175268628.1|4293456_4293816_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	63.3	1.1e-34
WP_175268629.1|4293806_4294922_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.5	3.7e-102
WP_076936113.1|4294914_4295547_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_076936111.1|4295549_4297208_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	1.2e-53
