The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053822	Vibrio cholerae strain E7G chromosome 1, complete sequence	3000460	656197	662814	3000460		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000210573.1|656197_657331_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
WP_033932838.1|657342_658593_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.7	1.7e-100
WP_000543544.1|658692_659142_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_175247449.1|659167_660271_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	2.0e-44
WP_071193055.1|660275_660929_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.7	4.0e-32
WP_123011119.1|660969_662079_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_123011118.1|662343_662814_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	8.9e-34
>prophage 2
NZ_CP053822	Vibrio cholerae strain E7G chromosome 1, complete sequence	3000460	1520008	1526296	3000460		Vibrio_phage(66.67%)	10	NA	NA
WP_032479745.1|1520008_1520356_-	DUF1293 family protein	NA	Q783U4	Vibrio_phage	84.3	5.0e-50
WP_175246066.1|1520358_1521549_-	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	70.4	7.0e-160
WP_148512340.1|1521538_1521754_-	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	79.1	1.0e-24
WP_175247507.1|1521937_1522312_+	hypothetical protein	NA	R9TE55	Vibrio_phage	79.8	4.3e-47
WP_000021944.1|1522757_1523147_-	helix-turn-helix transcriptional regulator	NA	Q9MBV1	Vibrio_virus	82.1	8.2e-25
WP_000273561.1|1523270_1524413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000590111.1|1524423_1524705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000022883.1|1524701_1525055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053034453.1|1525123_1525342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021944.1|1525906_1526296_-	helix-turn-helix transcriptional regulator	NA	Q9MBV1	Vibrio_virus	82.1	8.2e-25
>prophage 3
NZ_CP053822	Vibrio cholerae strain E7G chromosome 1, complete sequence	3000460	2262053	2269246	3000460		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|2262053_2262482_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_001959105.1|2262685_2263975_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.0	6.5e-34
WP_000872174.1|2264194_2264389_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124187.1|2264437_2264776_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001959107.1|2264789_2266640_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.9	1.5e-105
WP_001105750.1|2266663_2267179_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|2267227_2267551_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|2267611_2267995_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_175246178.1|2268031_2269246_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	2.0e-32
>prophage 4
NZ_CP053822	Vibrio cholerae strain E7G chromosome 1, complete sequence	3000460	2502328	2509553	3000460		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001914090.1|2502328_2503216_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	2.4e-56
WP_071179763.1|2503483_2506072_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	4.9e-33
WP_123011330.1|2506165_2507173_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	7.8e-35
WP_000177559.1|2507246_2508182_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_057550676.1|2508181_2508808_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	5.7e-36
WP_000698379.1|2508800_2509553_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	8.0e-69
>prophage 5
NZ_CP053822	Vibrio cholerae strain E7G chromosome 1, complete sequence	3000460	2819402	2830309	3000460		Enterobacteria_phage(42.86%)	9	NA	NA
WP_148537409.1|2819402_2821610_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.7	3.8e-18
WP_175247583.1|2821816_2823607_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	27.0	1.3e-21
WP_148537405.1|2823599_2824520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148537403.1|2824522_2825083_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.4	5.1e-36
WP_148537401.1|2825079_2826267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148537399.1|2826274_2827129_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.0	1.6e-28
WP_148537397.1|2827167_2828040_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.9	2.6e-111
WP_175247584.1|2828063_2829128_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	3.6e-99
WP_057558688.1|2829370_2830309_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	35.2	1.6e-34
>prophage 6
NZ_CP053822	Vibrio cholerae strain E7G chromosome 1, complete sequence	3000460	2857413	2864954	3000460	integrase	Stx2-converting_phage(33.33%)	7	2853070:2853086	2861509:2861525
2853070:2853086	attL	CCAAGACTATGGCCACA	NA	NA	NA	NA
WP_175246280.1|2857413_2858670_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1W6JPG6	Morganella_phage	38.8	4.8e-74
WP_175246281.1|2858671_2859010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075607785.1|2859206_2859509_+	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	33.0	8.9e-11
WP_000354815.1|2859540_2859912_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	56.4	1.2e-30
WP_175246282.1|2859937_2862364_+	DEAD/DEAH box helicase family protein	NA	G0T5H3	Wiseana_iridescent_virus	27.0	9.3e-26
2861509:2861525	attR	CCAAGACTATGGCCACA	NA	NA	NA	NA
WP_095481607.1|2863457_2864660_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	57.4	7.6e-29
WP_001197622.1|2864669_2864954_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	58.1	1.7e-24
>prophage 1
NZ_CP053824	Vibrio cholerae strain E7G plasmid pE7G, complete sequence	80726	437	19088	80726	integrase	Vibrio_phage(42.86%)	26	8786:8813	10071:10098
WP_095490183.1|437_1349_+	recombination-associated protein RdgC	NA	A0A2I7RNT5	Vibrio_phage	59.0	3.1e-99
WP_032072018.1|1339_2128_+	trans replication factor (TrfA)	NA	NA	NA	NA	NA
WP_032072017.1|2185_2536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072016.1|3268_3808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080527608.1|3984_4344_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	39.8	2.7e-14
WP_032072014.1|4393_4636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072013.1|4708_5032_-	hypothetical protein	NA	Q6V7U0	Burkholderia_virus	30.6	5.4e-06
WP_175247732.1|5089_5902_-	3'-5' exoribonuclease	NA	A0A1I9KF44	Aeromonas_phage	38.2	2.2e-27
WP_032072011.1|5960_6908_-	hypothetical protein	NA	A0A291L9Z9	Bordetella_phage	27.7	6.0e-21
WP_175247733.1|6957_8148_-	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	27.2	8.9e-14
WP_032072009.1|8196_8394_-	hypothetical protein	NA	NA	NA	NA	NA
8786:8813	attL	TAAATCCTGTACAATGTACAGGATTTTT	NA	NA	NA	NA
WP_175247734.1|8849_10040_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	37.1	2.5e-64
WP_175247735.1|10083_10650_+	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	28.2	1.8e-09
10071:10098	attR	TAAATCCTGTACAATGTACAGGATTTTT	NA	NA	NA	NA
WP_175247736.1|10664_11252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175247737.1|12278_13010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175247738.1|13012_13495_+	hypothetical protein	NA	A0A1W6JPA7	Morganella_phage	39.6	1.9e-23
WP_175247739.1|13507_13750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175247740.1|13908_14160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175247741.1|14239_15649_+	DEAD/DEAH box helicase	NA	A0A1X9HX80	Ruegeria_phage	43.3	1.9e-100
WP_175247742.1|15662_16106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175247743.1|16108_16864_+	hypothetical protein	NA	R9VWB9	Serratia_phage	43.2	5.8e-43
WP_080527605.1|16860_17178_+	hypothetical protein	NA	A0A2I7QIG7	Vibrio_phage	50.5	2.7e-18
WP_095490167.1|17174_17489_+	hypothetical protein	NA	A0A2D0YGQ8	Vibrio_phage	46.4	3.4e-21
WP_175247773.1|17551_18001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032071992.1|18340_18589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080527603.1|18656_19088_+	transglycosylase SLT domain-containing protein	NA	M4R0Y9	Tetraselmis_viridis_virus	50.7	1.4e-28
>prophage 2
NZ_CP053824	Vibrio cholerae strain E7G plasmid pE7G, complete sequence	80726	43832	51516	80726		Escherichia_phage(75.0%)	10	NA	NA
WP_032071946.1|43832_45431_+	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	29.2	4.5e-69
WP_175247762.1|45504_45903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175247763.1|45902_47453_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	32.2	9.7e-61
WP_032071943.1|47465_48137_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	32.1	9.5e-13
WP_032071942.1|48141_48786_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	35.9	1.0e-24
WP_032071941.1|48799_49297_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	31.4	5.8e-15
WP_175247764.1|49296_49860_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	39.7	2.0e-24
WP_032071939.1|49869_50217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080527595.1|50209_50716_+	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	34.7	6.9e-16
WP_032071937.1|50718_51516_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	31.7	4.4e-25
