The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053806	Vibrio cholerae strain SP6G chromosome 1, complete sequence	2947818	655796	662290	2947818		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000210573.1|655796_656930_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
WP_171008806.1|656941_658192_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.2	1.2e-98
WP_000543544.1|658291_658741_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_095462320.1|658766_659870_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.0e-43
WP_001959295.1|659874_660528_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	8.9e-32
WP_001122865.1|660568_661678_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_001959298.1|661819_662290_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	8.9e-34
>prophage 2
NZ_CP053806	Vibrio cholerae strain SP6G chromosome 1, complete sequence	2947818	1545117	1571110	2947818		Vibrio_phage(84.62%)	17	NA	NA
WP_000948761.1|1545117_1545429_+	hypothetical protein	NA	E3U9J1	Vibrio_phage	100.0	6.6e-09
WP_175242012.1|1545548_1545920_+	phage protein	NA	G8IRV3	Vibrio_phage	92.7	1.6e-62
WP_175242013.1|1546049_1546496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175242014.1|1546498_1546786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175242015.1|1547499_1547685_-	hypothetical protein	NA	G8IRV2	Vibrio_phage	88.5	1.9e-19
WP_175242016.1|1547693_1549061_-	toxin	NA	Q64EV0	Vibrio_phage	99.3	3.4e-259
WP_001160095.1|1549063_1549408_-	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	100.0	4.8e-61
WP_175242017.1|1549407_1550826_-	hypothetical protein	NA	G8IRU9	Vibrio_phage	70.4	3.1e-146
WP_000672170.1|1550958_1551168_-	hypothetical protein	NA	G8IRU8	Vibrio_phage	81.2	1.1e-20
WP_001896626.1|1551433_1551796_-	DUF1293 family protein	NA	Q783U4	Vibrio_phage	61.0	1.6e-35
WP_000870098.1|1551802_1553098_-	replication initiation factor domain-containing protein	NA	R9TNS0	Vibrio_phage	66.0	2.5e-171
WP_000442957.1|1553094_1553286_-	hypothetical protein	NA	R9TRU0	Vibrio_phage	63.9	1.7e-15
WP_000288489.1|1553410_1553767_+	hypothetical protein	NA	Q9MCC3	Vibrio_phage	57.9	3.7e-32
WP_175242018.1|1554077_1567721_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_001881196.1|1567744_1568206_-	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_001906284.1|1568231_1568579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154401350.1|1569004_1571110_+	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	26.9	1.1e-38
>prophage 3
NZ_CP053806	Vibrio cholerae strain SP6G chromosome 1, complete sequence	2947818	2270776	2277970	2947818		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|2270776_2271205_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_001959105.1|2271409_2272699_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.0	6.5e-34
WP_000872174.1|2272918_2273113_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_175242115.1|2273161_2273500_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_175242116.1|2273513_2275364_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.9	2.0e-105
WP_076008364.1|2275387_2275903_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|2275951_2276275_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|2276335_2276719_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000775249.1|2276755_2277970_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.8	8.8e-33
>prophage 4
NZ_CP053806	Vibrio cholerae strain SP6G chromosome 1, complete sequence	2947818	2509552	2516777	2947818		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001914090.1|2509552_2510440_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	2.4e-56
WP_001892042.1|2510707_2513296_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_000116739.1|2513389_2514397_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_095461793.1|2514470_2515406_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_057550676.1|2515405_2516032_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	5.7e-36
WP_000698374.1|2516024_2516777_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.0e-68
>prophage 5
NZ_CP053806	Vibrio cholerae strain SP6G chromosome 1, complete sequence	2947818	2835105	2841781	2947818		Enterobacteria_phage(50.0%)	7	NA	NA
WP_175242186.1|2835105_2836395_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.0e-14
WP_175242187.1|2836384_2837197_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_175242188.1|2837193_2837751_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.2	6.0e-53
WP_175242189.1|2837750_2838641_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	6.2e-36
WP_069212354.1|2838637_2839516_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.2	6.4e-110
WP_069212353.1|2839539_2840604_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.9	8.1e-99
WP_175242190.1|2840842_2841781_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	35.2	2.8e-34
>prophage 1
NZ_CP053807	Vibrio cholerae strain SP6G chromosome 2, complete sequence	1229641	908257	984659	1229641	integrase,holin,transposase,terminase,portal	Vibrio_phage(35.0%)	61	914967:914989	959388:959410
WP_175242377.1|908257_909333_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	1.1e-42
WP_095462559.1|909307_910288_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	80.5	1.7e-140
WP_175242378.1|910405_911803_-	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	30.3	2.9e-11
WP_001961306.1|911786_912461_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.7e-30
WP_033931945.1|912626_913124_+	heme-binding protein	NA	NA	NA	NA	NA
914967:914989	attL	TATTGTTGGAAAATCTACCGCAA	NA	NA	NA	NA
WP_000269804.1|915333_915573_+|integrase	tyrosine-type recombinase/integrase	integrase	R9TMP3	Vibrio_phage	78.5	9.4e-32
WP_175242379.1|915938_918515_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000859507.1|918893_919499_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_175242380.1|919634_920528_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000464289.1|920767_920923_-	hypothetical protein	NA	R9TPW0	Vibrio_phage	92.2	4.4e-22
WP_000257156.1|921127_921481_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001260269.1|921480_921735_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_175242381.1|921889_934600_-	PLxRFG domain-containing protein	NA	A0A240F4T3	Ochrobactrum_phage	29.2	0.0e+00
WP_080391399.1|934914_938139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113622214.1|938754_938967_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	58.6	2.4e-15
WP_113622213.1|939273_941490_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	9.0e-60
WP_001889101.1|941573_942551_+|transposase	IS481-like element ISVch1 family transposase	transposase	S5WIU1	Leptospira_phage	24.5	8.1e-05
WP_113622078.1|942656_944135_-	ATPase	NA	M4MHC7	Vibrio_phage	36.6	7.4e-42
WP_000331793.1|944134_944395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000115807.1|944397_944775_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	45.0	6.5e-19
WP_000509008.1|944778_945429_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	45.2	1.2e-39
WP_055064797.1|945428_945770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113622077.1|945810_946173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113622076.1|946177_948154_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	32.7	6.6e-54
WP_001885332.1|948153_949761_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	45.3	1.1e-128
WP_113622075.1|949833_952338_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A240EWW2	Vibrio_phage	30.9	8.7e-19
WP_113622074.1|952352_952982_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	32.9	2.5e-23
WP_113622073.1|952981_953581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000149029.1|953583_954048_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	48.6	1.0e-26
WP_000149719.1|954105_954486_-	hypothetical protein	NA	M4MCI2	Vibrio_phage	31.1	1.8e-08
WP_000207893.1|954500_955706_-	DUF4043 family protein	NA	A0A088CC32	Shigella_phage	58.3	2.7e-135
WP_057563526.1|955768_956773_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	32.6	1.2e-22
WP_113622079.1|956890_957151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228310.1|957162_957741_-	hypothetical protein	NA	A0A1V0E8A2	Vibrio_phage	36.9	1.8e-23
WP_000835319.1|957743_957965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007095.1|958059_958236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175242382.1|958240_958399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460725.1|958408_958927_-	hypothetical protein	NA	Q6VT55	Vibrio_phage	62.6	1.0e-59
WP_001128531.1|958995_959307_-|holin	phage holin family protein	holin	R9TR41	Vibrio_phage	47.4	2.2e-20
WP_069217332.1|959570_963326_-	SIR2 family protein	NA	NA	NA	NA	NA
959388:959410	attR	TATTGTTGGAAAATCTACCGCAA	NA	NA	NA	NA
WP_000457818.1|963604_964861_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	41.9	2.2e-87
WP_001263878.1|964860_965268_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1B1ITQ0	uncultured_Mediterranean_phage	47.5	2.5e-24
WP_069217334.1|965694_966843_-	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_113622072.1|967111_968476_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	34.2	1.3e-53
WP_113622071.1|968609_968795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066466.1|968960_969173_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	69.1	9.6e-20
WP_113622070.1|969467_971555_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	58.2	1.5e-202
WP_113622069.1|971551_973249_-|terminase	terminase	terminase	B0FEF1	Escherichia_phage	65.6	1.8e-217
WP_080390915.1|973241_974087_-	hypothetical protein	NA	A0A2R2Z334	Escherichia_phage	26.4	1.1e-13
WP_113622068.1|974200_975019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113622067.1|975082_976051_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	54.3	4.9e-87
WP_000532438.1|976219_976384_-	hypothetical protein	NA	R9TR53	Vibrio_phage	56.0	5.5e-07
WP_000844441.1|976671_976866_-	hypothetical protein	NA	R9TPV3	Vibrio_phage	81.2	6.9e-25
WP_000196481.1|976941_977655_+	helix-turn-helix domain-containing protein	NA	R9TNM0	Vibrio_phage	85.3	3.7e-116
WP_102787478.1|977906_978170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083583.1|978175_978358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113622066.1|978339_979566_+	DUF3596 domain-containing protein	NA	R9TMP3	Vibrio_phage	78.1	2.5e-189
WP_057573389.1|979628_980492_-	DNA adenine methylase	NA	A0A2K9R7J9	Dishui_lake_phycodnavirus	26.3	4.3e-18
WP_057573388.1|980560_982042_-	hypothetical protein	NA	Q858T2	Yersinia_virus	31.6	2.3e-06
WP_170831666.1|982431_983457_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	92.3	7.7e-22
WP_000092843.1|983465_984659_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	29.1	1.0e-41
