The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	0	1825	4203751		Enterobacter_phage(50.0%)	2	NA	NA
WP_121909391.1|454_679_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	73.9	6.8e-24
WP_063073731.1|1531_1825_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
>prophage 2
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	5132	16815	4203751	integrase	Salmonella_phage(27.27%)	23	7939:7955	29427:29443
WP_063073726.1|5132_5465_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_036895075.1|5600_5786_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_064506002.1|5881_6592_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	61.7	5.6e-80
WP_175246620.1|6745_7156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246621.1|7531_7825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220845.1|7835_8072_+	hypothetical protein	NA	NA	NA	NA	NA
7939:7955	attL	ATGATATTTTAGAATTA	NA	NA	NA	NA
WP_071233777.1|8043_8325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175246622.1|8491_8767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246623.1|8884_9826_+	cell envelope biogenesis protein TolA	NA	A0A2I7R804	Vibrio_phage	45.6	1.3e-20
WP_063108488.1|10046_10322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693267.1|10318_10573_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	5.0e-39
WP_175246624.1|10569_11394_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0M5M5Y6	Salmonella_phage	68.2	4.3e-108
WP_036976946.1|11393_11948_+	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	64.9	2.0e-61
WP_142836750.1|11947_12487_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	58.7	2.5e-56
WP_153274246.1|12502_12664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142836744.1|12705_12924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246625.1|12959_13253_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	42.7	2.9e-14
WP_175246626.1|13245_13437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073714.1|13607_13976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246627.1|14132_14321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043071.1|14313_14670_+	DUF2591 family protein	NA	K7PH48	Enterobacterial_phage	33.9	2.3e-10
WP_036905342.1|15470_15662_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_102086786.1|15639_16815_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	76.3	7.6e-183
29427:29443	attR	ATGATATTTTAGAATTA	NA	NA	NA	NA
>prophage 3
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	23110	23413	4203751		Morganella_phage(100.0%)	1	NA	NA
WP_004243781.1|23110_23413_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	37.9	6.0e-07
>prophage 4
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	31561	46072	4203751		Streptococcus_phage(33.33%)	13	NA	NA
WP_004248419.1|31561_33589_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.9	2.4e-144
WP_004243794.1|33763_34819_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004243796.1|35041_35812_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004248422.1|35960_36914_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	1.4e-73
WP_004243798.1|37244_37502_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_063073766.1|37645_39373_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.4	1.9e-17
WP_004243800.1|39422_39932_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004243801.1|40022_40904_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.5	2.6e-58
WP_017627973.1|41109_42198_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	36.8	4.8e-30
WP_004243804.1|42217_43060_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004243805.1|43059_43893_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_004243806.1|43892_44924_-	thiosulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_004243807.1|45175_46072_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	32.9	5.5e-24
>prophage 5
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	52652	53936	4203751	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004243819.1|52652_53936_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	24.9	3.2e-25
>prophage 6
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	58105	58531	4203751		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_004243827.1|58105_58531_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	36.8	2.1e-18
>prophage 7
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	66941	73537	4203751		Mycoplasma_phage(20.0%)	8	NA	NA
WP_004243837.1|66941_68237_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.6	2.5e-38
WP_004243841.1|68517_68712_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004243842.1|68727_69063_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_017627967.1|69065_70916_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.4	2.1e-102
WP_004243844.1|70927_71449_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004243846.1|71497_71821_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	6.3e-23
WP_004243847.1|71911_72298_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	5.4e-53
WP_004243849.1|72322_73537_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	9.4e-35
>prophage 8
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	79367	80621	4203751		Aeromonas_phage(100.0%)	1	NA	NA
WP_004243862.1|79367_80621_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	9.2e-102
>prophage 9
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	83651	93728	4203751		Bacillus_phage(50.0%)	5	NA	NA
WP_004248444.1|83651_85268_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.6	2.3e-97
WP_004243867.1|85342_86680_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	2.6e-09
WP_096043115.1|86691_87618_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004248446.1|87701_89150_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	5.4e-13
WP_017627961.1|89837_93728_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	7.7e-131
>prophage 10
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	101973	109604	4203751	tRNA	Pandoravirus(25.0%)	9	NA	NA
WP_004248453.1|101973_102504_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
WP_004243886.1|102816_103077_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004243887.1|103106_103487_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243888.1|103486_104218_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_017627957.1|104287_105028_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243892.1|105040_105949_-	GTPase Era	NA	NA	NA	NA	NA
WP_004248457.1|105945_106626_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_017627956.1|106821_107793_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004243894.1|107807_109604_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
>prophage 11
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	113989	116895	4203751		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	3	NA	NA
WP_004243902.1|113989_115345_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	2.3e-42
WP_004248459.1|115496_115880_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_026090412.1|116214_116895_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.6	1.9e-56
>prophage 12
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	121831	125517	4203751		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004243915.1|121831_122314_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
WP_017627954.1|122918_123278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627953.1|123361_123775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627952.1|124080_125517_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	32.7	6.1e-49
>prophage 13
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	143044	143623	4203751		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004243957.1|143044_143623_-	hypothetical protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	5.1e-31
>prophage 14
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	156529	160441	4203751		Acinetobacter_phage(50.0%)	2	NA	NA
WP_004243977.1|156529_158569_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.4	4.8e-15
WP_004243978.1|158806_160441_-	sodium/sugar symporter	NA	A0A240F3J2	Aeromonas_phage	39.0	7.5e-88
>prophage 15
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	165455	167863	4203751		Tupanvirus(50.0%)	2	NA	NA
WP_004248507.1|165455_166472_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	5.7e-86
WP_017627943.1|166903_167863_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	26.3	8.2e-18
>prophage 16
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	171351	171597	4203751		Salmonella_phage(100.0%)	1	NA	NA
WP_012368173.1|171351_171597_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
>prophage 17
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	179872	188462	4203751	tRNA	Lactobacillus_phage(20.0%)	8	NA	NA
WP_004244004.1|179872_180421_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|180920_181130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|181437_181647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244024.1|182243_183758_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_096043105.1|183766_184865_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004244029.1|185036_186770_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_004244030.1|186779_187487_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244032.1|187520_188462_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
>prophage 18
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	192152	195029	4203751		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004248527.1|192152_195029_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	9.3e-267
>prophage 19
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	206603	210054	4203751		Bacillus_phage(50.0%)	2	NA	NA
WP_012368222.1|206603_208727_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	3.1e-41
WP_004248535.1|208803_210054_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.3e-103
>prophage 20
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	234251	235679	4203751		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244077.1|234251_235679_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	3.2e-42
>prophage 21
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	247248	247644	4203751		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017627934.1|247248_247644_-	8-oxo-dGTP diphosphatase MutT	NA	H6X3M3	Enterobacteria_phage	32.0	3.3e-05
>prophage 22
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	255062	257552	4203751		uncultured_virus(100.0%)	1	NA	NA
WP_017627931.1|255062_257552_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	8.5e-99
>prophage 23
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	281327	287053	4203751		Catovirus(50.0%)	3	NA	NA
WP_017627927.1|281327_283136_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.5	1.9e-47
WP_004244135.1|283666_284611_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_004244137.1|285493_287053_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.3	3.3e-08
>prophage 24
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	293494	294170	4203751		Brucella_phage(50.0%)	2	NA	NA
WP_004244143.1|293494_293839_-	DNA-binding protein	NA	A0A141GEX5	Brucella_phage	38.8	3.7e-05
WP_017627925.1|293828_294170_-	addiction module killer protein	NA	A4JWV2	Burkholderia_virus	37.8	3.2e-09
>prophage 25
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	299077	300232	4203751		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004244148.1|299077_300232_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.5	2.6e-127
>prophage 26
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	330789	331545	4203751		Edwardsiella_phage(100.0%)	1	NA	NA
WP_036907548.1|330789_331545_+	trimeric autotransporter adhesin AipA	NA	A0A0B6VSQ9	Edwardsiella_phage	32.2	2.6e-06
>prophage 27
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	346068	346824	4203751		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_017627908.1|346068_346824_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	2.3e-15
>prophage 28
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	366232	438773	4203751	integrase,tRNA,capsid,lysis,protease,terminase,holin	Salmonella_phage(24.56%)	95	371433:371488	417992:418047
WP_026090403.1|366232_367522_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	4.6e-173
WP_004244232.1|367597_367933_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	1.4e-20
WP_017627901.1|368369_368996_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	2.2e-11
WP_004244239.1|369186_369858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627900.1|370260_370956_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
371433:371488	attL	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_121909631.1|371662_371881_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	91.2	3.2e-26
WP_143475794.1|372027_373116_+	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.5	4.5e-20
WP_143475795.1|373151_375734_-	SGNH/GDSL hydrolase family protein	NA	A0A2P1MXB7	Escherichia_phage	46.4	7.6e-42
WP_121909349.1|375791_378260_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	52.5	9.2e-255
WP_049257622.1|378246_378639_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	57.9	1.6e-44
WP_004247776.1|378635_379106_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	2.6e-41
WP_004247775.1|379105_379582_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	72.3	3.3e-60
WP_175246631.1|379585_382927_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	47.2	1.2e-209
WP_175246632.1|382994_383408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064971344.1|383471_383744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909508.1|383782_384475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909506.1|384503_384749_-	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	52.0	1.2e-13
WP_121909504.1|384845_384998_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_161706779.1|385933_386758_-	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	43.8	3.8e-56
WP_121909261.1|387111_387804_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.2	4.9e-89
WP_121909259.1|387853_388609_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	79.7	2.0e-107
WP_036905489.1|388673_389042_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	28.7	2.0e-09
WP_121909257.1|389038_389410_-	HK97 gp10 family phage protein	NA	G0ZNE3	Cronobacter_phage	64.2	1.5e-39
WP_004247766.1|389411_389753_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	9.4e-25
WP_121909255.1|389752_390151_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.0	3.5e-55
WP_060556622.1|390207_390381_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	50.0	1.2e-07
WP_060556621.1|390390_391485_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.5e-145
WP_121909253.1|391497_391947_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.1	3.7e-45
WP_121909251.1|391946_393221_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.7	2.2e-151
WP_121909249.1|393224_394154_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.0	7.1e-91
WP_121909247.1|394104_395460_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.2	5.9e-163
WP_121909245.1|395459_396704_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	73.8	2.7e-186
WP_004247756.1|396684_397125_-	hypothetical protein	NA	Q716H4	Shigella_phage	66.4	7.5e-43
WP_004247755.1|397272_397455_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.1	6.3e-20
WP_175246633.1|397447_397606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175246705.1|397636_398164_-	HNH endonuclease	NA	A0A1B2IEH2	Erwinia_phage	46.2	6.5e-41
WP_121909241.1|398871_399321_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	80.3	3.4e-51
WP_036976899.1|399322_399655_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|399641_399935_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014656499.1|399931_400321_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_121909383.1|400739_401579_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	45.3	9.0e-61
WP_049199110.1|401575_401767_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	2.3e-28
WP_121909381.1|401756_402122_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.8e-37
WP_121909379.1|402118_402409_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	80.0	3.3e-39
WP_175246634.1|402412_402571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142836740.1|402663_402933_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	76.1	4.2e-28
WP_121909391.1|403243_403468_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	73.9	6.8e-24
WP_121909375.1|403473_403917_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	61.5	2.9e-42
WP_063073731.1|404326_404620_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_036935835.1|404606_404828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964332.1|404843_405011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909389.1|405029_406397_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	63.8	2.5e-161
WP_121909373.1|406400_407246_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	54.6	6.2e-70
WP_049199128.1|407238_407418_-	hypothetical protein	NA	G9L679	Escherichia_phage	59.6	2.9e-09
WP_164484703.1|407410_407587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909293.1|407682_408036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367616.1|408170_408356_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088206660.1|408463_409165_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	45.8	4.4e-45
WP_088206661.1|409195_409501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909295.1|409907_410180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909297.1|410194_410515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064505999.1|410576_410852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909299.1|410886_411120_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	42.9	1.5e-10
WP_121909301.1|411203_411437_+	DUF551 domain-containing protein	NA	A0A1B1W256	Salmonella_phage	45.6	2.1e-12
WP_166465079.1|411490_411646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073719.1|411653_411908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099432895.1|411904_412126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909303.1|412122_412947_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0M5M5Y6	Salmonella_phage	68.2	1.3e-107
WP_036976946.1|412946_413501_+	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	64.9	2.0e-61
WP_060558090.1|414087_414375_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_175246626.1|414374_414566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073714.1|414736_415105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909305.1|415261_415450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043071.1|415442_415799_+	DUF2591 family protein	NA	K7PH48	Enterobacterial_phage	33.9	2.3e-10
WP_121909307.1|415785_416388_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	51.0	5.8e-54
WP_063108480.1|416823_417981_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.4	4.7e-177
WP_017627899.1|418269_419142_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
417992:418047	attR	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004244244.1|419145_419358_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|419994_420936_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|421001_422393_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
WP_004244249.1|422784_423279_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004244250.1|423291_424014_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017627898.1|424146_424668_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_017627897.1|424664_425732_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004244255.1|425855_427124_+	MFS transporter	NA	NA	NA	NA	NA
WP_004244256.1|427201_428227_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_063073710.1|428326_430768_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004250296.1|430764_431451_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	4.6e-31
WP_012368271.1|431421_432051_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004244260.1|432101_432887_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.9	1.3e-05
WP_017627896.1|432972_433830_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004244263.1|433869_434793_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_026090402.1|434795_435317_+	NfeD family protein	NA	NA	NA	NA	NA
WP_004244266.1|435282_435684_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_017627895.1|435818_438773_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.5	2.6e-115
>prophage 29
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	451336	453220	4203751		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004244279.1|451336_453220_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	2.4e-109
>prophage 30
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	479104	479398	4203751		Morganella_phage(100.0%)	1	NA	NA
WP_012368285.1|479104_479398_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.0	3.7e-06
>prophage 31
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	503837	519052	4203751	tRNA	uncultured_Mediterranean_phage(25.0%)	14	NA	NA
WP_017627877.1|503837_506402_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	2.8e-28
WP_004244343.1|506467_507457_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_004244344.1|508131_509256_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244345.1|509409_510036_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_004244347.1|510029_510794_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	2.1e-64
WP_004248688.1|510771_511824_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_004248690.1|511823_512306_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_017627876.1|512307_513054_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_026090399.1|513093_513384_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017627875.1|513675_514290_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	40.0	8.1e-27
WP_175246636.1|514289_515747_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.2e-36
WP_004244356.1|515758_516667_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_017627873.1|516678_518100_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012368298.1|518320_519052_-	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	27.8	1.5e-08
>prophage 32
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	523314	523986	4203751		Vibrio_phage(100.0%)	1	NA	NA
WP_004250261.1|523314_523986_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A088FAQ4	Vibrio_phage	27.5	2.3e-14
>prophage 33
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	536351	537383	4203751		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245446.1|536351_537383_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.5	3.2e-36
>prophage 34
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	544931	551039	4203751		Mollivirus(33.33%)	4	NA	NA
WP_004250252.1|544931_545675_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.8	4.7e-13
WP_004245456.1|545971_546931_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_004248711.1|546943_550426_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.1	3.4e-202
WP_004245458.1|550448_551039_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	44.2	1.4e-31
>prophage 35
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	559022	560646	4203751		Tupanvirus(50.0%)	2	NA	NA
WP_004245467.1|559022_559886_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	32.4	2.2e-06
WP_004248717.1|559887_560646_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.0	2.7e-24
>prophage 36
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	577397	580458	4203751		Vibrio_phage(50.0%)	3	NA	NA
WP_004245492.1|577397_578243_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.8e-43
WP_004249505.1|578334_579702_+	LOG family protein	NA	NA	NA	NA	NA
WP_017628582.1|579708_580458_+	flap endonuclease Xni	NA	B6V2K6	Bacillus_phage	29.5	7.9e-16
>prophage 37
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	583647	599937	4203751	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_017628581.1|583647_584862_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	32.1	3.8e-60
WP_004245500.1|584864_585308_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004245501.1|585749_586598_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.1	4.9e-14
WP_017628579.1|586706_587801_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_004245505.1|588564_589827_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	1.6e-13
WP_004249500.1|590071_591406_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_017628578.1|591504_593421_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.6	2.9e-22
WP_049195255.1|593413_597052_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	23.2	3.1e-09
WP_017628576.1|597048_599937_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.3	1.2e-72
>prophage 38
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	606314	610415	4203751		Vibrio_phage(50.0%)	3	NA	NA
WP_004245521.1|606314_607166_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.5	2.4e-125
WP_004245522.1|607197_608082_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004249490.1|608168_610415_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.6	3.9e-10
>prophage 39
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	613808	621224	4203751		Acidithiobacillus_phage(40.0%)	5	NA	NA
WP_004245527.1|613808_614510_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.6	4.3e-24
WP_004245528.1|614637_615090_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	5.2e-31
WP_004249488.1|615089_615659_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	53.3	7.2e-54
WP_017628571.1|615774_618129_+	DNA polymerase II	NA	B3GAM5	uncultured_virus	24.8	2.8e-27
WP_004249485.1|618320_621224_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.3	2.8e-21
>prophage 40
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	629369	631053	4203751		Aeromonas_phage(50.0%)	2	NA	NA
WP_004245544.1|629369_630191_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A2R4ALY4	Aeromonas_phage	45.6	9.5e-07
WP_004245545.1|630567_631053_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	1.5e-31
>prophage 41
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	639331	652208	4203751		Bacillus_virus(33.33%)	10	NA	NA
WP_049212329.1|639331_642289_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	28.6	3.8e-82
WP_063073859.1|642322_644218_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.8	8.7e-96
WP_004245556.1|644325_644916_-	esterase YqiA	NA	NA	NA	NA	NA
WP_004250217.1|644919_645759_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_004245558.1|645990_646620_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.6	4.3e-23
WP_004245559.1|646833_648231_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004249472.1|648559_649288_+	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	36.1	2.0e-24
WP_004245561.1|649295_650459_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.1	3.7e-89
WP_004249471.1|650593_651379_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004245565.1|651554_652208_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	2.3e-43
>prophage 42
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	655539	656964	4203751		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004249466.1|655539_656964_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	8.7e-40
>prophage 43
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	661714	662938	4203751		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_017628565.1|661714_662938_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.4	2.9e-92
>prophage 44
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	667685	673175	4203751	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_004245584.1|667685_668708_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.9	3.5e-107
WP_001144069.1|669050_669266_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017628562.1|669379_671128_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	7.8e-75
WP_004245586.1|671318_673175_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	1.6e-33
>prophage 45
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	676719	677358	4203751		Burkholderia_phage(100.0%)	1	NA	NA
WP_017628558.1|676719_677358_+	7-cyano-7-deazaguanine synthase	NA	A5A3S4	Burkholderia_phage	28.2	2.2e-11
>prophage 46
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	688703	701065	4203751	protease	Caulobacter_phage(37.5%)	12	NA	NA
WP_017628548.1|688703_690224_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	4.7e-07
WP_004245601.1|690379_691948_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|692348_693029_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|693125_693701_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|693777_694356_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|694423_695449_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|695483_695939_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017628547.1|695963_697100_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|697100_697685_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|698077_699223_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
WP_004245612.1|699215_699986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245613.1|699988_701065_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.1	8.9e-37
>prophage 47
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	706930	709451	4203751	holin	Bodo_saltans_virus(33.33%)	3	NA	NA
WP_175246639.1|706930_708127_+	tetracycline efflux MFS transporter Tet(J)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	6.7e-09
WP_004249433.1|708393_708684_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	44.7	7.5e-15
WP_004245624.1|709190_709451_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	63.1	2.4e-25
>prophage 48
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	714253	716629	4203751		Hokovirus(100.0%)	1	NA	NA
WP_017628540.1|714253_716629_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.5	2.3e-13
>prophage 49
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	721357	721624	4203751		Pectobacterium_bacteriophage(100.0%)	1	NA	NA
WP_004249427.1|721357_721624_+	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	53.9	6.2e-16
>prophage 50
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	727893	729216	4203751		Geobacillus_virus(100.0%)	1	NA	NA
WP_004245639.1|727893_729216_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.3	2.0e-78
>prophage 51
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	734870	736460	4203751		Streptococcus_phage(100.0%)	1	NA	NA
WP_004245645.1|734870_736460_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	5.7e-32
>prophage 52
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	745335	746983	4203751	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_063693491.1|745335_746544_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	8.1e-188
WP_017628529.1|746566_746983_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	4.5e-45
>prophage 53
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	750307	751552	4203751		Enterococcus_phage(100.0%)	1	NA	NA
WP_004245666.1|750307_751552_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	2.8e-87
>prophage 54
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	761603	762407	4203751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245678.1|761603_762407_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	8.4e-08
>prophage 55
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	792694	794687	4203751		Vibrio_phage(50.0%)	2	NA	NA
WP_004245716.1|792694_794341_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	2.4e-190
WP_004249265.1|794393_794687_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	3.3e-10
>prophage 56
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	822692	824330	4203751		Hepacivirus(100.0%)	1	NA	NA
WP_004249237.1|822692_824330_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.6	1.7e-39
>prophage 57
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	830155	839973	4203751		Vibrio_phage(25.0%)	9	NA	NA
WP_004245792.1|830155_831670_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	7.6e-10
WP_004245793.1|831712_832855_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004245794.1|832924_834145_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_017628516.1|834222_835779_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.8	3.2e-35
WP_017628515.1|835844_836630_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004245797.1|836669_837263_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_036907348.1|837326_837719_-	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_004250150.1|838437_839100_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	31.8	1.8e-27
WP_012368460.1|839361_839973_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	33.8	3.0e-21
>prophage 58
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	845646	847065	4203751		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245806.1|845646_847065_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.5	2.8e-46
>prophage 59
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	856044	856839	4203751		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245819.1|856044_856839_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	2.2e-16
>prophage 60
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	884659	887737	4203751		Leptospira_phage(100.0%)	1	NA	NA
WP_017628500.1|884659_887737_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	4.0e-58
>prophage 61
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	903481	904756	4203751		Pandoravirus(100.0%)	1	NA	NA
WP_004249177.1|903481_904756_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.6e-19
>prophage 62
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	912272	918400	4203751		Morganella_phage(25.0%)	6	NA	NA
WP_004245886.1|912272_912590_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004245887.1|912723_913767_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245888.1|913883_914663_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004250112.1|914659_915520_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245891.1|915503_916619_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_004245892.1|917062_918400_-	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
>prophage 63
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	922351	924893	4203751		Salmonella_phage(50.0%)	2	NA	NA
WP_004245896.1|922351_923761_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	3.3e-193
WP_004245898.1|923801_924893_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	4.5e-28
>prophage 64
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	929658	934942	4203751		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_004249165.1|929658_932493_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
WP_004249162.1|932745_933270_+	single-stranded DNA-binding protein SSB1	NA	I3PGW4	Xanthomonas_phage	67.0	7.6e-58
WP_004245904.1|933611_934142_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_004245906.1|934330_934942_-	repressor LexA	NA	U5P451	Shigella_phage	45.6	2.5e-12
>prophage 65
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	944652	948324	4203751		Dickeya_phage(100.0%)	1	NA	NA
WP_017628489.1|944652_948324_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.0	2.1e-21
>prophage 66
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	966756	970651	4203751		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_012368501.1|966756_968346_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	9.3e-67
WP_004249142.1|968358_969648_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_004246923.1|969671_970364_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004246922.1|970378_970651_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.7	8.0e-19
>prophage 67
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	980822	1000055	4203751	transposase	Sodalis_phage(16.67%)	15	NA	NA
WP_004249129.1|980822_981791_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	41.6	4.5e-48
WP_004246908.1|981983_986213_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.1e-66
WP_004246906.1|986335_990364_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	1.4e-21
WP_004246905.1|990716_991082_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004246904.1|991145_991643_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004246903.1|991970_992672_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004246901.1|992676_993105_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004246900.1|993250_993796_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	4.5e-13
WP_004246899.1|993803_994181_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_012368509.1|995704_997819_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	4.7e-58
WP_004246897.1|997898_998369_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004246896.1|998468_998843_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004246894.1|998970_999264_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004249124.1|999294_999663_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_017628670.1|999662_1000055_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.3	1.8e-16
>prophage 68
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1007170	1014954	4203751		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_012368513.1|1007170_1009102_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.7	2.1e-73
WP_012368514.1|1009428_1011120_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	1.0e-07
WP_012368515.1|1011575_1013303_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.0	1.7e-05
WP_017628668.1|1013409_1014954_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	53.3	2.2e-36
>prophage 69
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1021050	1028801	4203751		Klosneuvirus(20.0%)	6	NA	NA
WP_004246871.1|1021050_1022268_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.4	7.2e-27
WP_004246870.1|1022385_1022961_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_004246869.1|1023333_1023906_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_004249106.1|1024180_1024804_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_004246867.1|1025262_1025781_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	7.1e-16
WP_012368519.1|1026002_1028801_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	9.0e-73
>prophage 70
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1044960	1046938	4203751		Bacillus_virus(50.0%)	2	NA	NA
WP_004250067.1|1044960_1045962_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.3e-18
WP_004246844.1|1045954_1046938_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.5e-17
>prophage 71
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1066488	1069598	4203751		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_004246821.1|1066488_1067112_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.2	1.0e-21
WP_004246820.1|1067166_1067442_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004246819.1|1067471_1069598_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.5	2.6e-11
>prophage 72
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1073984	1075376	4203751		environmental_Halophage(100.0%)	1	NA	NA
WP_017628656.1|1073984_1075376_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	76.4	9.7e-52
>prophage 73
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1083967	1088798	4203751		Tupanvirus(50.0%)	3	NA	NA
WP_004246802.1|1083967_1085803_-	ribosome-dependent GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.7	1.6e-22
WP_004246801.1|1086162_1087572_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004249083.1|1087751_1088798_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.9	1.7e-08
>prophage 74
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1097800	1105644	4203751		Bacillus_phage(60.0%)	8	NA	NA
WP_004246792.1|1097800_1098523_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	8.3e-31
WP_004246791.1|1098522_1099863_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.2	2.0e-09
WP_017628647.1|1100065_1101106_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	36.0	1.2e-49
WP_004246789.1|1101181_1102141_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004249075.1|1102142_1103045_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004246787.1|1103075_1103852_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	6.9e-15
WP_017628646.1|1103866_1104601_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_017628645.1|1104804_1105644_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	65.7	8.3e-06
>prophage 75
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1123105	1124464	4203751		Moraxella_phage(100.0%)	1	NA	NA
WP_004249062.1|1123105_1124464_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.4	3.5e-62
>prophage 76
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1152318	1153917	4203751		Bacillus_phage(50.0%)	2	NA	NA
WP_004246732.1|1152318_1153071_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.6e-08
WP_004246731.1|1153107_1153917_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	2.4e-10
>prophage 77
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1159514	1160051	4203751		Escherichia_phage(100.0%)	1	NA	NA
WP_063073864.1|1159514_1160051_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	30.6	9.9e-13
>prophage 78
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1166934	1169648	4203751		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_004246712.1|1166934_1167897_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.3	2.5e-51
WP_004246711.1|1167883_1168891_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_004246710.1|1168892_1169648_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.6e-16
>prophage 79
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1173023	1176079	4203751		Escherichia_phage(100.0%)	2	NA	NA
WP_017628626.1|1173023_1175441_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.0	2.4e-138
WP_004246705.1|1175437_1176079_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	3.3e-63
>prophage 80
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1181713	1184497	4203751		Bacillus_virus(50.0%)	2	NA	NA
WP_004246695.1|1181713_1182427_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-17
WP_063073865.1|1182517_1184497_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.8	6.0e-47
>prophage 81
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1188115	1189606	4203751		Aeromonas_phage(100.0%)	1	NA	NA
WP_004246686.1|1188115_1189606_-	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	26.6	2.9e-22
>prophage 82
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1195562	1198503	4203751		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_004246680.1|1195562_1196933_-	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	23.7	2.1e-06
WP_004246679.1|1196946_1198503_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	33.3	2.8e-07
>prophage 83
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1202286	1354065	4203751	integrase,tRNA,transposase	Escherichia_phage(17.14%)	126	1280134:1280151	1352781:1352798
WP_063693206.1|1202286_1203495_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
WP_053828396.1|1203517_1203934_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_004249011.1|1204754_1205273_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_017628614.1|1205345_1207517_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017628613.1|1208786_1211831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628612.1|1211830_1212769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|1212761_1213031_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628611.1|1213222_1214146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|1214235_1214913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249837.1|1215005_1216613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043063.1|1218709_1219726_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_000412211.1|1220845_1221505_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|1221705_1222083_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|1224870_1225575_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|1226172_1227033_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|1227617_1228322_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|1228511_1229327_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|1229477_1230182_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|1230937_1231789_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|1232096_1232912_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1232972_1233776_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1233775_1234612_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_028697649.1|1234718_1235195_+	TnpR	NA	NA	NA	NA	NA
WP_114267976.1|1235256_1236465_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	5.7e-234
WP_000557454.1|1236607_1237468_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|1237480_1238023_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|1238504_1238696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|1238719_1238947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|1238997_1240134_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|1243993_1244698_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|1245128_1245479_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|1245681_1246695_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|1246852_1247326_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000503573.1|1247456_1248245_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|1248450_1248798_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1248791_1249631_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1249758_1250259_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|1250227_1251220_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|1251222_1252902_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|1252976_1253645_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|1253680_1253917_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|1253913_1254276_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|1254293_1255988_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|1256039_1256462_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|1256497_1256773_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|1256786_1257137_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|1257208_1257643_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_169774393.1|1259611_1260415_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	4.4e-33
WP_119563495.1|1260644_1261598_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001218908.1|1262442_1263627_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_004249995.1|1264260_1266303_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_012368588.1|1266306_1267053_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_004246663.1|1267123_1267873_-	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_017628608.1|1268001_1269342_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_004246661.1|1269595_1270030_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_004246660.1|1270443_1270776_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_004246659.1|1270847_1272347_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_012368590.1|1272655_1273861_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004249849.1|1275012_1275714_+	pirin family protein	NA	NA	NA	NA	NA
WP_004246655.1|1275829_1277449_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.7e-140
WP_004246652.1|1277653_1278538_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004246651.1|1278565_1278979_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_004249850.1|1279052_1281161_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
1280134:1280151	attL	ATATTTTTAATGTAACGC	NA	NA	NA	NA
WP_004246647.1|1281516_1282074_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004249852.1|1282163_1282967_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017628606.1|1283300_1285835_-	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_017628605.1|1285951_1286776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628604.1|1286763_1287363_+	fimbrial assembly protein	NA	NA	NA	NA	NA
WP_017628603.1|1287346_1287880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246639.1|1287886_1289002_+	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
WP_012368596.1|1289582_1290104_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_004249857.1|1290156_1291251_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_017628602.1|1291405_1292350_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_004249858.1|1292431_1293247_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_004246629.1|1293291_1293966_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004249859.1|1293962_1294673_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246627.1|1294674_1295703_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155290689.1|1295763_1296960_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.0	5.4e-184
WP_036895833.1|1296982_1297399_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	7.6e-45
WP_012368600.1|1297486_1298161_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|1298278_1298902_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_004249862.1|1299269_1301228_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004246621.1|1301392_1301704_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004246620.1|1301700_1303356_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_017628600.1|1303678_1305310_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_063693479.1|1305349_1306558_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_017628598.1|1306629_1306998_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	4.2e-39
WP_012368603.1|1307084_1307777_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_017628597.1|1307780_1309199_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_017628596.1|1309189_1309927_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|1315951_1316638_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368605.1|1316718_1318116_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_004246607.1|1318197_1319124_-	ribokinase	NA	NA	NA	NA	NA
WP_017628746.1|1319404_1320904_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	38.0	3.0e-22
WP_004246605.1|1320911_1322369_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|1322369_1323362_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|1323522_1323984_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004249871.1|1324083_1324524_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_017628745.1|1324903_1326802_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004246599.1|1326798_1327425_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|1328040_1328418_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|1328449_1329274_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|1329319_1329559_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|1329620_1330091_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|1330103_1330637_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|1330651_1332193_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|1332250_1333114_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|1333148_1334531_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|1334552_1334969_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|1335119_1336493_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246586.1|1336650_1338477_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_001029679.1|1338636_1339458_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|1339444_1341553_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|1341549_1343217_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|1343219_1344746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|1344746_1346363_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|1346593_1346971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|1347380_1347752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|1347812_1348310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|1348385_1349174_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|1349231_1349756_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|1349850_1350324_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|1350655_1351192_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|1351306_1351633_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|1351820_1352060_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_004249814.1|1352988_1354065_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.1e-26
1352781:1352798	attR	ATATTTTTAATGTAACGC	NA	NA	NA	NA
>prophage 84
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1374469	1374874	4203751		Stx_converting_phage(100.0%)	1	NA	NA
WP_004249797.1|1374469_1374874_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.3	1.4e-22
>prophage 85
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1388365	1389328	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_020946490.1|1388365_1389328_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	8.7e-60
>prophage 86
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1392335	1394198	4203751		Tupanvirus(100.0%)	1	NA	NA
WP_036919411.1|1392335_1394198_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
>prophage 87
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1410227	1411436	4203751	transposase	Bluetongue_virus(100.0%)	1	NA	NA
WP_001339197.1|1410227_1411436_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 88
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1423991	1431502	4203751		Staphylococcus_phage(33.33%)	7	NA	NA
WP_012368639.1|1423991_1424252_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	3.5e-16
WP_004246510.1|1424215_1424575_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004246509.1|1424592_1424736_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_063073819.1|1425458_1426859_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004246506.1|1426863_1427967_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.1	3.8e-51
WP_063073820.1|1427978_1429067_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_063073821.1|1429087_1431502_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	55.4	4.5e-12
>prophage 89
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1437255	1437639	4203751		Escherichia_phage(100.0%)	1	NA	NA
WP_063073825.1|1437255_1437639_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	56.3	3.5e-28
>prophage 90
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1445862	1450656	4203751		Vibrio_phage(25.0%)	4	NA	NA
WP_115425848.1|1445862_1446105_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	45.3	1.5e-08
WP_095500550.1|1446091_1447834_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.0	4.2e-60
WP_175246646.1|1448106_1448322_+	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	41.5	2.7e-06
WP_175246647.1|1448343_1450656_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	27.6	5.8e-25
>prophage 91
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1461396	1466519	4203751	integrase	Gordonia_phage(50.0%)	6	1454823:1454836	1467168:1467181
1454823:1454836	attL	TAACCAGCAAATTA	NA	NA	NA	NA
WP_095500539.1|1461396_1462449_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	28.5	2.1e-30
WP_095500538.1|1462449_1462929_+	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_115425836.1|1463190_1463502_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_115425835.1|1463494_1464724_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_031215120.1|1464922_1465261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115425834.1|1465262_1466519_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	38.8	3.1e-73
1467168:1467181	attR	TAATTTGCTGGTTA	NA	NA	NA	NA
>prophage 92
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1470346	1472976	4203751		Xanthomonas_phage(33.33%)	3	NA	NA
WP_063073830.1|1470346_1470805_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	4.6e-51
WP_020946516.1|1470788_1471997_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	1.6e-47
WP_004249942.1|1472304_1472976_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	27.8	1.8e-19
>prophage 93
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1479723	1481030	4203751		Bacillus_phage(50.0%)	2	NA	NA
WP_063073834.1|1479723_1480548_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.9	5.6e-23
WP_004246474.1|1480544_1481030_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	6.6e-24
>prophage 94
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1492838	1498630	4203751		Synechococcus_phage(25.0%)	5	NA	NA
WP_004246462.1|1492838_1493777_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.4	8.3e-31
WP_121909233.1|1494044_1495244_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.8e-36
WP_004246460.1|1495253_1496279_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	6.1e-19
WP_121909234.1|1496366_1497335_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_121909235.1|1497337_1498630_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	36.6	7.7e-11
>prophage 95
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1504034	1508216	4203751	tRNA	Catovirus(33.33%)	4	NA	NA
WP_143475723.1|1504034_1505012_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.4	9.3e-17
WP_004246449.1|1505127_1505631_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_121909579.1|1505642_1506812_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.1	3.5e-119
WP_121909550.1|1507349_1508216_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	5.4e-109
>prophage 96
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1514049	1520391	4203751		Enterobacteria_phage(25.0%)	5	NA	NA
WP_143475717.1|1514049_1514592_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.0	1.5e-48
WP_049203100.1|1516290_1517049_-	DUF707 domain-containing protein	NA	NA	NA	NA	NA
WP_143475716.1|1517063_1518209_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	42.2	9.3e-77
WP_004246433.1|1518291_1519680_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
WP_004246432.1|1519692_1520391_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
>prophage 97
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1531341	1535029	4203751		Salmonella_phage(50.0%)	3	NA	NA
WP_060557199.1|1531341_1532529_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.9	2.6e-13
WP_004246422.1|1532638_1534171_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|1534213_1535029_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
>prophage 98
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1538196	1539537	4203751		Erwinia_phage(100.0%)	1	NA	NA
WP_004246417.1|1538196_1539537_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
>prophage 99
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1556005	1558949	4203751		Hokovirus(50.0%)	2	NA	NA
WP_121909210.1|1556005_1557436_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.7	4.0e-61
WP_004246398.1|1557446_1558949_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
>prophage 100
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1563820	1565545	4203751		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004246391.1|1563820_1565545_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
>prophage 101
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1576877	1578731	4203751		Acinetobacter_phage(100.0%)	1	NA	NA
WP_017628673.1|1576877_1578731_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	25.5	2.3e-08
>prophage 102
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1587713	1590819	4203751		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004246971.1|1587713_1588661_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.5	4.2e-30
WP_004249692.1|1589634_1590819_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
>prophage 103
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1610124	1614044	4203751	tRNA	Prochlorococcus_phage(25.0%)	5	NA	NA
WP_004246934.1|1610124_1611075_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	2.8e-10
WP_004246933.1|1611101_1611617_-	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	39.6	1.4e-16
WP_004246932.1|1611748_1612906_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	30.0	4.2e-32
WP_004246931.1|1612924_1613482_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_004249883.1|1613474_1614044_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.6	2.4e-09
>prophage 104
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1625678	1627328	4203751		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_017627862.1|1625678_1627328_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.3	6.5e-63
>prophage 105
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1634789	1642612	4203751	transposase	Helicobacter_phage(20.0%)	8	NA	NA
WP_012368697.1|1634789_1635206_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	6.0e-42
WP_053828405.1|1635228_1636437_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.1e-187
WP_004246360.1|1636568_1636838_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_004253075.1|1636838_1637087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249673.1|1637259_1639281_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	6.2e-116
WP_049194777.1|1639355_1640864_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004249672.1|1640867_1642166_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	28.7	1.7e-34
WP_004246355.1|1642285_1642612_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.4	6.6e-20
>prophage 106
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1647130	1653307	4203751		Catovirus(20.0%)	6	NA	NA
WP_017628777.1|1647130_1648261_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.2	8.5e-30
WP_004246348.1|1648257_1649520_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.1	1.3e-23
WP_017628776.1|1649510_1650584_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.3	5.4e-103
WP_004249667.1|1650602_1651484_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	8.4e-110
WP_004249666.1|1651461_1652175_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004246343.1|1652176_1653307_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	37.8	1.2e-20
>prophage 107
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1669740	1673682	4203751		Brevibacillus_phage(50.0%)	3	NA	NA
WP_004246325.1|1669740_1670664_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	25.8	9.7e-24
WP_004249656.1|1670663_1671380_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_017628770.1|1671525_1673682_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	3.0e-116
>prophage 108
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1676969	1678799	4203751		Catovirus(100.0%)	1	NA	NA
WP_004246318.1|1676969_1678799_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.1	7.9e-86
>prophage 109
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1693427	1693973	4203751		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004253041.1|1693427_1693973_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.5	1.3e-28
>prophage 110
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1697978	1701326	4203751		Vibrio_phage(50.0%)	2	NA	NA
WP_004253037.1|1697978_1699295_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	33.3	6.2e-16
WP_004246294.1|1699316_1701326_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.3	1.8e-59
>prophage 111
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1706838	1711519	4203751		Cedratvirus(50.0%)	3	NA	NA
WP_004249629.1|1706838_1708137_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.4e-65
WP_004249627.1|1708562_1708991_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_017628767.1|1709029_1711519_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
>prophage 112
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1732047	1733782	4203751		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004246260.1|1732047_1732575_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	4.2e-56
WP_004249610.1|1732774_1733782_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.4	4.4e-70
>prophage 113
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1737355	1739668	4203751		Vibrio_phage(25.0%)	4	NA	NA
WP_004246255.1|1737355_1737622_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.2	8.6e-18
WP_004246254.1|1737807_1738155_+	putative DNA-binding transcriptional regulator	NA	A0A1C6ZDN4	Pseudomonas_phage	50.0	1.2e-06
WP_175246655.1|1738233_1738650_+	putative DNA-binding transcriptional regulator	NA	C9DGL1	Escherichia_phage	53.8	5.2e-09
WP_004246252.1|1738696_1739668_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	1.4e-09
>prophage 114
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1745507	1748372	4203751	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_004246243.1|1745507_1747448_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.8	8.3e-118
WP_004246242.1|1747529_1748372_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.8e-16
>prophage 115
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1752711	1755462	4203751		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004246237.1|1752711_1755462_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.1e-26
>prophage 116
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1761091	1762927	4203751		Catovirus(100.0%)	1	NA	NA
WP_026090516.1|1761091_1762927_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	7.2e-55
>prophage 117
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1769570	1771274	4203751		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004246222.1|1769570_1771274_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	69.7	5.4e-214
>prophage 118
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1784663	1791912	4203751		Trichoplusia_ni_ascovirus(25.0%)	10	NA	NA
WP_017628760.1|1784663_1784945_-	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.2	6.1e-14
WP_004246207.1|1785231_1785483_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_017628759.1|1785598_1786039_+	YhbP family protein	NA	NA	NA	NA	NA
WP_004246205.1|1786047_1786425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246204.1|1786591_1786801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246203.1|1786827_1787292_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	5.0e-53
WP_004246202.1|1787296_1789435_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_004246200.1|1789780_1790167_-	RidA family protein	NA	NA	NA	NA	NA
WP_004246198.1|1790504_1790963_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004246197.1|1790976_1791912_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.9e-52
>prophage 119
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1796899	1801840	4203751	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_004249581.1|1796899_1799788_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	7.4e-147
WP_004246185.1|1799801_1800251_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004246183.1|1800331_1801840_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	8.3e-49
>prophage 120
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1807709	1813319	4203751	transposase	Helicobacter_phage(33.33%)	5	NA	NA
WP_053828314.1|1807709_1808126_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.5	1.3e-44
WP_096043054.1|1808148_1809357_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	3.6e-188
WP_012368780.1|1810839_1811097_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004249548.1|1811571_1812183_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_063073908.1|1812182_1813319_-	RNA ligase RtcB family protein	NA	R4TNH6	Mycobacterium_phage	27.1	8.8e-27
>prophage 121
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1820830	1827958	4203751		Micromonas_pusilla_virus(33.33%)	6	NA	NA
WP_004249538.1|1820830_1822525_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	31.8	1.5e-59
WP_004246140.1|1822528_1822813_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004249537.1|1822863_1823760_-	cation transporter	NA	NA	NA	NA	NA
WP_004246138.1|1823836_1824415_-	helix-turn-helix transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	41.7	8.2e-05
WP_017628749.1|1824653_1825841_+	MFS transporter	NA	NA	NA	NA	NA
WP_004246136.1|1826611_1827958_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.7	4.4e-158
>prophage 122
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1841770	1845123	4203751		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_004246119.1|1841770_1843408_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	28.4	7.7e-40
WP_004246118.1|1843533_1843800_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004249526.1|1843803_1844334_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004246116.1|1844337_1845123_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.8	3.6e-27
>prophage 123
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1854102	1854723	4203751		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628747.1|1854102_1854723_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.8	9.7e-20
>prophage 124
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1871812	1872475	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_004245430.1|1871812_1872475_-	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	28.3	5.9e-07
>prophage 125
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1879799	1881353	4203751		Escherichia_phage(100.0%)	1	NA	NA
WP_004245426.1|1879799_1881353_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	33.3	2.4e-19
>prophage 126
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1898051	1900370	4203751		Tupanvirus(50.0%)	2	NA	NA
WP_004245408.1|1898051_1899029_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	20.8	2.1e-05
WP_004248870.1|1899290_1900370_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	4.6e-09
>prophage 127
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1907961	1909101	4203751		Vibrio_phage(50.0%)	2	NA	NA
WP_004245400.1|1907961_1908636_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.9	3.6e-60
WP_004245397.1|1908846_1909101_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	4.1e-09
>prophage 128
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1914197	1917385	4203751		Streptococcus_phage(50.0%)	2	NA	NA
WP_017628206.1|1914197_1916588_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	2.8e-131
WP_004248875.1|1916758_1917385_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	44.2	5.0e-16
>prophage 129
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1920966	1925041	4203751		Staphylococcus_phage(33.33%)	4	NA	NA
WP_004245385.1|1920966_1921632_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	9.4e-13
WP_004248880.1|1921624_1922602_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004245383.1|1922943_1923798_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	2.5e-42
WP_004245382.1|1923892_1925041_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	1.4e-43
>prophage 130
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1928504	1929599	4203751		Planktothrix_phage(100.0%)	1	NA	NA
WP_004248885.1|1928504_1929599_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.6e-20
>prophage 131
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1946309	1947353	4203751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245330.1|1946309_1947353_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
>prophage 132
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1961247	1970112	4203751		Thermobifida_phage(20.0%)	11	NA	NA
WP_004245308.1|1961247_1962102_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_004245307.1|1962186_1962654_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004248916.1|1962809_1963097_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004248917.1|1963120_1964596_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004245304.1|1964655_1965381_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_004245303.1|1965387_1965921_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004245302.1|1965901_1966480_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004245301.1|1966497_1967055_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
WP_017628220.1|1967082_1968057_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
WP_026090454.1|1968075_1969056_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004245298.1|1969299_1970112_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
>prophage 133
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1977851	1980505	4203751		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_017628225.1|1977851_1978922_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
WP_017628226.1|1979113_1980505_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
>prophage 134
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1985033	1985543	4203751	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245280.1|1985033_1985543_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
>prophage 135
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	1996407	1998744	4203751		Hokovirus(100.0%)	1	NA	NA
WP_004245272.1|1996407_1998744_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.0	4.0e-42
>prophage 136
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2007433	2011235	4203751		Caulobacter_phage(50.0%)	4	NA	NA
WP_004245257.1|2007433_2008024_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	5.6e-09
WP_004245256.1|2008046_2008424_-	YraN family protein	NA	NA	NA	NA	NA
WP_017628232.1|2008528_2010295_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004245252.1|2010356_2011235_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.9	1.8e-51
>prophage 137
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2023774	2025484	4203751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004252657.1|2023774_2025484_-	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.0	1.1e-07
>prophage 138
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2030983	2039375	4203751	transposase	Salmonella_phage(20.0%)	8	NA	NA
WP_063693510.1|2030983_2032192_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.1e-187
WP_012368857.1|2032214_2032631_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
WP_004248950.1|2032759_2034427_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.6	1.9e-41
WP_012368858.1|2034768_2036688_+	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.3	1.8e-08
WP_004248952.1|2036789_2037101_+	trp operon repressor	NA	NA	NA	NA	NA
WP_004248953.1|2037190_2037730_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_004245229.1|2037781_2038429_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_017628237.1|2038472_2039375_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.2	1.5e-08
>prophage 139
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2056140	2070076	4203751	tRNA	Cyanophage(20.0%)	10	NA	NA
WP_004248961.1|2056140_2057094_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	8.8e-12
WP_017628242.1|2057278_2058262_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012367436.1|2058423_2059011_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_017628243.1|2059535_2061461_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.4	4.2e-146
WP_063073860.1|2061567_2062704_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.9	2.8e-17
WP_004245211.1|2063244_2064423_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.9	1.9e-85
WP_004245210.1|2064611_2065529_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004248964.1|2065603_2065864_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017628244.1|2066294_2067236_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004248968.1|2067265_2070076_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.5	1.3e-87
>prophage 140
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2073568	2074732	4203751		Halovirus(100.0%)	1	NA	NA
WP_017628247.1|2073568_2074732_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	2.6e-50
>prophage 141
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2086048	2090301	4203751		Staphylococcus_phage(50.0%)	4	NA	NA
WP_012367446.1|2086048_2086879_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.9	1.3e-64
WP_004248982.1|2086906_2088064_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004248983.1|2088311_2088983_-	DedA family protein	NA	NA	NA	NA	NA
WP_017628249.1|2089107_2090301_-	cystathionine beta-lyase	NA	A0A2I2L687	Orpheovirus	22.1	4.6e-10
>prophage 142
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2105251	2106160	4203751		Salmonella_phage(100.0%)	1	NA	NA
WP_004245172.1|2105251_2106160_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	56.2	2.4e-91
>prophage 143
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2114266	2121448	4203751		Bacillus_phage(66.67%)	4	NA	NA
WP_017628255.1|2114266_2117992_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	24.2	5.5e-09
WP_004252605.1|2117988_2119221_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_004249004.1|2119442_2120132_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	40.7	6.1e-39
WP_004245160.1|2120155_2121448_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.5	3.4e-27
>prophage 144
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2141162	2148043	4203751	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
WP_004245143.1|2141162_2142305_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	4.2e-93
WP_004245142.1|2142391_2142727_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.9e-10
WP_012367466.1|2142759_2144607_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004247209.1|2144617_2145586_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	2.0e-48
WP_004245139.1|2145704_2146154_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012367467.1|2146202_2147360_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.8e-51
WP_004245137.1|2147572_2148043_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.6e-30
>prophage 145
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2155084	2156593	4203751		Staphylococcus_phage(100.0%)	1	NA	NA
WP_017628266.1|2155084_2156593_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	7.9e-15
>prophage 146
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2173586	2174960	4203751		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004247225.1|2173586_2174960_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.4	8.6e-61
>prophage 147
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2179744	2184893	4203751	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_004245088.1|2179744_2180368_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
WP_004245087.1|2180512_2181784_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	7.3e-131
WP_017628270.1|2182041_2184396_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	8.8e-223
WP_004247229.1|2184617_2184893_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	6.0e-22
>prophage 148
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2188880	2193773	4203751		Bacillus_phage(66.67%)	4	NA	NA
WP_004245081.1|2188880_2189579_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.2	5.3e-83
WP_004245080.1|2189736_2190198_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247232.1|2190253_2191999_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.4e-54
WP_017628273.1|2191985_2193773_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.4e-42
>prophage 149
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2208546	2211302	4203751		Klosneuvirus(50.0%)	2	NA	NA
WP_012367485.1|2208546_2209098_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	9.5e-27
WP_017628277.1|2209325_2211302_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.8	2.3e-46
>prophage 150
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2234195	2241686	4203751	transposase	uncultured_virus(25.0%)	8	NA	NA
WP_004245039.1|2234195_2234738_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.3	1.7e-15
WP_004245038.1|2234797_2235451_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004245037.1|2236299_2237241_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	2.7e-21
WP_004245036.1|2237237_2238008_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017628285.1|2238197_2239427_+	MFS transporter	NA	NA	NA	NA	NA
WP_004245034.1|2239515_2239698_+	DUF2526 family protein	NA	NA	NA	NA	NA
WP_053828325.1|2240038_2240455_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.2e-42
WP_063693470.1|2240477_2241686_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	4.3e-189
>prophage 151
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2249004	2249301	4203751		Morganella_phage(100.0%)	1	NA	NA
WP_004245017.1|2249004_2249301_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.4	1.4e-05
>prophage 152
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2255864	2256905	4203751		Bacillus_virus(100.0%)	1	NA	NA
WP_004245012.1|2255864_2256905_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-31
>prophage 153
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2266852	2272792	4203751		unidentified_phage(50.0%)	5	NA	NA
WP_071524519.1|2266852_2268436_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.3	7.4e-24
WP_004244999.1|2268523_2268853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244998.1|2268914_2269370_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004244997.1|2269566_2270277_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_017628292.1|2270362_2272792_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.7	5.8e-44
>prophage 154
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2276899	2277244	4203751		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004244992.1|2276899_2277244_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	2.0e-27
>prophage 155
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2281063	2282389	4203751		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244987.1|2281063_2282389_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	7.8e-35
>prophage 156
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2286104	2289108	4203751		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_004244983.1|2286104_2287742_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	9.7e-152
WP_004244982.1|2287806_2289108_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.2	6.8e-132
>prophage 157
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2292721	2299595	4203751		Lactobacillus_virus(25.0%)	7	NA	NA
WP_004244978.1|2292721_2294056_-	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	37.4	1.8e-07
WP_017628296.1|2294129_2294885_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004247298.1|2294922_2295636_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004244975.1|2295660_2296140_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	1.2e-49
WP_017628297.1|2296205_2296964_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	1.2e-40
WP_036894287.1|2297718_2298801_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004247305.1|2298800_2299595_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.2	1.5e-12
>prophage 158
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2306147	2307164	4203751		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628302.1|2306147_2307164_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	34.1	2.1e-35
>prophage 159
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2317228	2317441	4203751		Enterococcus_phage(100.0%)	1	NA	NA
WP_004244951.1|2317228_2317441_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	62.2	1.0e-05
>prophage 160
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2321408	2323412	4203751	holin	Vibrio_phage(100.0%)	1	NA	NA
WP_004244946.1|2321408_2323412_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.0	8.0e-23
>prophage 161
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2334348	2335803	4203751		Morganella_phage(50.0%)	2	NA	NA
WP_170827682.1|2334348_2334672_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNW5	Morganella_phage	41.8	1.1e-06
WP_004247323.1|2335236_2335803_-	phase variation DNA invertase MrpI	NA	A0A2L1IV36	Escherichia_phage	52.4	2.0e-51
>prophage 162
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2343593	2343917	4203751		Morganella_phage(100.0%)	1	NA	NA
WP_004244917.1|2343593_2343917_+	transcriptional regulator MrpJ	NA	A0A1W6JNW5	Morganella_phage	55.3	1.6e-05
>prophage 163
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2352190	2353930	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_004252439.1|2352190_2353930_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	1.4e-28
>prophage 164
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2385080	2387243	4203751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_017628323.1|2385080_2387243_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
>prophage 165
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2403618	2407274	4203751	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_004247373.1|2403618_2403867_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
WP_000196965.1|2404328_2405201_+	ParA family protein	NA	NA	NA	NA	NA
WP_001095747.1|2405278_2405710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000549132.1|2405921_2407274_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	53.5	6.6e-122
>prophage 166
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2414133	2418483	4203751	transposase	Streptococcus_phage(50.0%)	3	NA	NA
WP_004239734.1|2414133_2416188_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	7.4e-40
WP_000202155.1|2417071_2417539_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_017827827.1|2417559_2418483_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.0	7.3e-56
>prophage 167
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2434908	2455607	4203751		Bacillus_phage(50.0%)	6	NA	NA
WP_000588838.1|2434908_2436636_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	7.8e-35
WP_036972215.1|2436628_2438395_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	3.0e-34
WP_004239723.1|2438413_2439187_-	thioesterase	NA	NA	NA	NA	NA
WP_000801189.1|2439186_2440275_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_017827831.1|2440274_2449490_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	39.7	1.0e-48
WP_004239721.1|2449502_2455607_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	29.0	1.3e-36
>prophage 168
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2476363	2478589	4203751		Yersinia_phage(100.0%)	1	NA	NA
WP_017827858.1|2476363_2478589_+	trimeric autotransporter adhesin TaaP	NA	A0A1V0DXR3	Yersinia_phage	40.2	4.4e-06
>prophage 169
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2490861	2491836	4203751		Caulobacter_phage(100.0%)	1	NA	NA
WP_012368428.1|2490861_2491836_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	2.1e-45
>prophage 170
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2497124	2498195	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_004244838.1|2497124_2498195_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
>prophage 171
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2504997	2505591	4203751		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_004244829.1|2504997_2505591_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.0	6.2e-16
>prophage 172
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2520159	2520738	4203751		Caulobacter_phage(100.0%)	1	NA	NA
WP_004244807.1|2520159_2520738_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.5e-14
>prophage 173
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2539340	2541709	4203751		Streptococcus_phage(100.0%)	2	NA	NA
WP_004247396.1|2539340_2540444_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	9.7e-63
WP_004244786.1|2540455_2541709_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.9	1.6e-98
>prophage 174
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2545863	2551480	4203751	tRNA	Pseudomonas_phage(25.0%)	4	NA	NA
WP_017628346.1|2545863_2546370_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	44.0	1.0e-27
WP_004247401.1|2546477_2547545_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	1.8e-114
WP_004247402.1|2548446_2551074_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.1	5.8e-82
WP_004244778.1|2551291_2551480_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	63.2	1.3e-12
>prophage 175
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2561364	2562453	4203751		Klebsiella_phage(100.0%)	1	NA	NA
WP_170832182.1|2561364_2562453_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	51.7	7.7e-89
>prophage 176
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2570690	2573267	4203751		Cronobacter_phage(100.0%)	1	NA	NA
WP_004244758.1|2570690_2573267_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.0	5.8e-127
>prophage 177
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2600779	2613826	4203751		Mycobacterium_phage(22.22%)	14	NA	NA
WP_004246075.1|2600779_2601979_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|2602587_2603556_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|2603581_2605708_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|2605736_2606141_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|2606152_2606377_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|2606658_2607132_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|2607329_2607539_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|2607723_2607864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|2608607_2608982_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|2608997_2609963_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|2610064_2610709_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|2611066_2611330_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|2611528_2612740_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_049198160.1|2612866_2613826_-	endolytic peptidoglycan transglycosylase RlpA	NA	H2BCY4	Synechococcus_phage	45.5	1.9e-06
>prophage 178
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2621101	2624769	4203751	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_004247439.1|2621101_2623684_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.8e-189
WP_004246043.1|2624043_2624769_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.6e-29
>prophage 179
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2630788	2631292	4203751		Streptomyces_phage(100.0%)	1	NA	NA
WP_004252236.1|2630788_2631292_+	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	36.8	9.3e-05
>prophage 180
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2635003	2636065	4203751		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004246031.1|2635003_2636065_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	2.5e-47
>prophage 181
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2639856	2640969	4203751		Synechococcus_phage(100.0%)	1	NA	NA
WP_004246024.1|2639856_2640969_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	7.3e-34
>prophage 182
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2648621	2696936	4203751	integrase,terminase,tail,lysis	Cronobacter_phage(19.51%)	74	2648535:2648553	2703855:2703873
2648535:2648553	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_026164649.1|2648621_2649623_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
WP_004247454.1|2649579_2649825_-	excisionase	NA	NA	NA	NA	NA
WP_049216772.1|2649821_2650160_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	7.4e-14
WP_012367596.1|2650152_2650329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367598.1|2650535_2651261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726682.1|2651335_2652019_-	hypothetical protein	NA	A0A2I7QT96	Vibrio_phage	48.1	1.2e-23
WP_110144533.1|2652955_2653495_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.7	1.7e-57
WP_087726680.1|2653484_2654369_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.2	1.2e-60
WP_017628824.1|2654370_2654691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|2654687_2654840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919938.1|2654836_2655100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175246659.1|2655107_2655263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367608.1|2655351_2655579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909704.1|2655701_2655977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|2656141_2656327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|2656323_2656476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049237116.1|2656661_2656877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907950.1|2656873_2657089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827445.1|2657097_2657415_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	9.3e-19
WP_036908285.1|2657779_2658145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|2658141_2658921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023854.1|2658955_2659639_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.7	3.0e-131
WP_004245989.1|2659721_2659931_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_004247478.1|2660076_2660424_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004251793.1|2660519_2660693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909410.1|2660689_2661457_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_121909412.1|2661456_2662842_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
WP_049195179.1|2662867_2663317_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|2663395_2663686_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|2663682_2664039_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|2664038_2664671_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|2664982_2665504_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|2665662_2666085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|2666138_2666408_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_017628809.1|2666407_2666878_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|2666859_2667018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367624.1|2667020_2667482_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	6.3e-24
WP_049199100.1|2668373_2668790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246660.1|2668786_2668942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909231.1|2669001_2669271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909230.1|2669296_2669863_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	63.6	9.0e-57
WP_121909229.1|2669859_2671434_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	87.3	4.6e-284
WP_121909228.1|2671433_2672804_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.1	2.8e-120
WP_121909227.1|2672800_2673922_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.8	3.6e-105
WP_004247499.1|2673991_2674237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247500.1|2674333_2675095_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.6e-67
WP_004247501.1|2675108_2676062_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.9	1.1e-126
WP_107033975.1|2676064_2676349_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004245968.1|2676388_2676868_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_004247502.1|2676870_2677221_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_004245966.1|2677222_2677804_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_121909226.1|2677800_2678202_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_121909225.1|2678246_2678903_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	56.3	1.6e-57
WP_004245960.1|2678954_2679260_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_051008871.1|2679274_2679562_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_004247508.1|2679590_2679797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247509.1|2679949_2680321_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_004247510.1|2680334_2680517_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_109880200.1|2680851_2681853_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	31.0	1.8e-36
WP_046334559.1|2682125_2682959_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	55.6	3.7e-67
WP_004245955.1|2683028_2683190_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_046334560.1|2683303_2683561_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_049257266.1|2683557_2684451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334561.1|2684488_2685358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909283.1|2685417_2688348_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.5	1.1e-132
WP_121909285.1|2688359_2688650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|2689012_2689354_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004247517.1|2689350_2690094_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
WP_004247518.1|2690090_2690801_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
WP_004247519.1|2690797_2691403_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
WP_004247520.1|2691454_2695648_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	1.7e-301
WP_004245936.1|2695641_2696010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|2696011_2696626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|2696675_2696936_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
2703855:2703873	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 183
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2703525	2705578	4203751	tRNA	Proteus_phage(50.0%)	2	NA	NA
WP_004244376.1|2703525_2703666_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	89.1	4.7e-15
WP_012367653.1|2703910_2705578_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
>prophage 184
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2709929	2714088	4203751		Mycobacterium_phage(50.0%)	4	NA	NA
WP_017628481.1|2709929_2710715_-	esterase	NA	A0A1L5C1K3	Mycobacterium_phage	36.1	1.3e-05
WP_004244392.1|2711179_2711731_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_063073870.1|2711805_2713449_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_012367657.1|2713605_2714088_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.4	9.4e-39
>prophage 185
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2719502	2720654	4203751		Enterobacteria_phage(100.0%)	1	NA	NA
WP_063073869.1|2719502_2720654_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	41.6	1.2e-60
>prophage 186
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2733271	2735038	4203751		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004244416.1|2733271_2735038_+	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.5	5.8e-17
>prophage 187
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2757103	2768883	4203751		Vibrio_phage(25.0%)	6	NA	NA
WP_036900878.1|2757103_2757823_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	34.0	8.3e-23
WP_004244442.1|2758066_2759125_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
WP_004244443.1|2759197_2759950_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004247554.1|2760300_2761767_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.6	7.9e-12
WP_017628474.1|2761942_2763502_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_096043113.1|2763516_2768883_+	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.9	6.2e-06
>prophage 188
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2774099	2778522	4203751		Planktothrix_phage(50.0%)	4	NA	NA
WP_004244454.1|2774099_2775164_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.7	6.3e-19
WP_012367674.1|2775228_2776050_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_012367675.1|2776198_2777188_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_017628469.1|2777244_2778522_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	3.8e-18
>prophage 189
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2785994	2786930	4203751		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628464.1|2785994_2786930_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	6.8e-25
>prophage 190
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2792882	2798080	4203751		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_017628462.1|2792882_2794652_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	4.1e-23
WP_004247573.1|2794672_2795659_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_004247574.1|2795676_2796375_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_017628461.1|2796685_2798080_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	2.9e-56
>prophage 191
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2807985	2812756	4203751		Bacillus_phage(33.33%)	4	NA	NA
WP_017628458.1|2807985_2810094_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	7.5e-48
WP_004244496.1|2810154_2810661_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	26.3	2.6e-07
WP_004244497.1|2810938_2811829_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_049195239.1|2812177_2812756_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.5	2.2e-18
>prophage 192
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2818795	2819458	4203751		Vibrio_phage(100.0%)	1	NA	NA
WP_004244504.1|2818795_2819458_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.4	7.6e-55
>prophage 193
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2825786	2830643	4203751	tRNA	Catovirus(66.67%)	4	NA	NA
WP_017628455.1|2825786_2827814_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	6.0e-26
WP_004247590.1|2828018_2829131_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004247591.1|2829343_2829985_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_004244515.1|2830061_2830643_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
>prophage 194
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2834570	2842392	4203751	tRNA,transposase	Moraxella_phage(20.0%)	7	NA	NA
WP_004247594.1|2834570_2836151_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	3.8e-36
WP_053828334.1|2836322_2836739_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.6e-45
WP_053867585.1|2836761_2837970_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_004247595.1|2838143_2839550_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.7	8.6e-32
WP_004244520.1|2839669_2840167_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_017628450.1|2840480_2841632_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_012367689.1|2841774_2842392_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.6e-14
>prophage 195
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2848004	2852208	4203751		Cellulophaga_phage(50.0%)	4	NA	NA
WP_004244529.1|2848004_2848904_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	2.5e-08
WP_017628448.1|2849409_2850231_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244532.1|2850227_2850848_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_175246662.1|2851005_2852208_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	50.1	5.2e-102
>prophage 196
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2859592	2865188	4203751		Vibrio_phage(33.33%)	8	NA	NA
WP_004244541.1|2859592_2859856_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
WP_004247610.1|2860026_2860329_+	YbjC family protein	NA	NA	NA	NA	NA
WP_012367695.1|2860499_2861003_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_012367696.1|2861031_2862165_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.5	3.5e-23
WP_004244548.1|2862307_2862976_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_004244549.1|2862975_2863680_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244550.1|2863710_2864445_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012367698.1|2864459_2865188_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
>prophage 197
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2870981	2952225	4203751	plate,tRNA,protease	Bacillus_phage(15.79%)	59	NA	NA
WP_017628445.1|2870981_2872925_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	6.5e-38
WP_004244557.1|2873087_2873297_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.4e-15
WP_004244558.1|2873586_2873901_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|2873931_2876226_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|2876345_2876564_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|2876883_2877576_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_063073899.1|2877577_2879329_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|2879331_2881101_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|2881239_2882199_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|2882741_2883236_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_053828337.1|2883363_2887227_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|2887339_2887945_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|2887955_2889305_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_049195444.1|2889438_2890728_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.4e-97
WP_004244572.1|2890907_2891240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|2891640_2892690_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|2892762_2893668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|2894025_2894766_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|2894873_2897156_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|2897210_2898065_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017628443.1|2898735_2900493_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|2900720_2901758_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|2901832_2903101_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|2903237_2904668_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|2904804_2905893_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|2906089_2907376_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|2907664_2908342_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|2908523_2910197_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|2910261_2910549_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_017628440.1|2911026_2913396_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|2913432_2915178_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|2915174_2916176_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|2916671_2916887_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|2917301_2917481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|2917485_2918247_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017628439.1|2918370_2919201_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|2919580_2920354_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|2920363_2921686_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|2921666_2922398_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|2922394_2926852_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|2927134_2927788_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|2928193_2928907_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_049194798.1|2929256_2930972_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|2931303_2931852_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|2931901_2932552_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|2932644_2933118_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_175246663.1|2933208_2934945_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017628437.1|2934937_2936293_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_175246664.1|2936330_2939879_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|2939881_2941345_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|2941350_2942001_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|2942002_2942791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|2942794_2945506_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|2945514_2946270_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|2946262_2947621_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_063073901.1|2947622_2948174_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|2948175_2949444_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|2949448_2950486_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|2950449_2952225_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 198
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2959857	2964558	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_063693455.1|2959857_2964558_+	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.9	3.0e-28
>prophage 199
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2971231	2971741	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_081000326.1|2971231_2971741_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.0	1.7e-14
>prophage 200
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2975904	2976456	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_071587364.1|2975904_2976456_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	63.3	3.2e-14
>prophage 201
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2980905	2988214	4203751	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_121909311.1|2980905_2982018_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	1.3e-96
WP_004244664.1|2982362_2983763_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	1.5e-81
WP_017827340.1|2983836_2984028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244666.1|2984042_2985257_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_017628415.1|2985598_2988214_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	5.7e-21
>prophage 202
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	2995179	2997111	4203751		Tupanvirus(100.0%)	1	NA	NA
WP_004244674.1|2995179_2997111_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
>prophage 203
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3010768	3012820	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_017628409.1|3010768_3012820_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	2.3e-17
>prophage 204
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3017298	3020448	4203751		Indivirus(100.0%)	4	NA	NA
WP_004247010.1|3017298_3018243_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
WP_017628405.1|3018242_3018548_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004247012.1|3018692_3019589_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628404.1|3019644_3020448_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	39.1	1.8e-42
>prophage 205
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3025730	3027312	4203751		Morganella_phage(100.0%)	2	NA	NA
WP_004247021.1|3025730_3025943_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
WP_004247022.1|3026385_3027312_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	65.5	2.7e-98
>prophage 206
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3033707	3034353	4203751		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004247034.1|3033707_3034121_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
WP_004247035.1|3034167_3034353_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	52.5	1.4e-11
>prophage 207
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3039276	3046335	4203751		Vibrio_phage(50.0%)	7	NA	NA
WP_017628393.1|3039276_3040281_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	9.7e-86
WP_004247799.1|3040364_3040649_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004251887.1|3040789_3042553_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.2	3.1e-95
WP_004247801.1|3042747_3043452_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004247802.1|3043487_3044672_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.9	3.6e-23
WP_004247049.1|3045187_3045535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247050.1|3045720_3046335_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.9	2.0e-09
>prophage 208
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3051535	3052381	4203751		Catovirus(100.0%)	1	NA	NA
WP_004251877.1|3051535_3052381_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	9.4e-26
>prophage 209
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3057078	3059085	4203751		Acinetobacter_phage(100.0%)	1	NA	NA
WP_017628391.1|3057078_3059085_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	27.6	3.1e-11
>prophage 210
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3064729	3066379	4203751		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_017628389.1|3064729_3066379_-	alpha-keto acid decarboxylase family protein	NA	E4WLQ6	Ostreococcus_tauri_virus	22.1	2.0e-16
>prophage 211
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3083360	3084489	4203751		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004247085.1|3083360_3084095_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.2e-14
WP_004247087.1|3084252_3084489_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	1.5e-10
>prophage 212
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3087819	3088464	4203751		Erwinia_phage(100.0%)	1	NA	NA
WP_004247091.1|3087819_3088464_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.9	7.0e-21
>prophage 213
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3103059	3105959	4203751		Planktothrix_phage(50.0%)	3	NA	NA
WP_004247832.1|3103059_3103764_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.8	2.5e-32
WP_004247833.1|3103763_3105011_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004247834.1|3105101_3105959_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.9	1.9e-21
>prophage 214
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3111482	3195315	4203751	integrase,tRNA,head,protease,lysis,capsid,tail,terminase,portal	Enterobacteria_phage(20.0%)	99	3135431:3135447	3183075:3183091
WP_004247115.1|3111482_3112853_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.2e-112
WP_017628382.1|3112885_3113515_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004247117.1|3113517_3114621_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|3114726_3115179_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|3115171_3115801_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|3115939_3117193_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_175246666.1|3117313_3118441_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.6	2.8e-126
WP_004251672.1|3118421_3118664_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|3118725_3119256_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|3119312_3120140_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|3120205_3120580_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247128.1|3121228_3121711_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|3121814_3122054_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|3122138_3122597_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247131.1|3122686_3122896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247132.1|3122885_3123065_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_004247133.1|3123077_3124169_+	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247134.1|3124340_3125048_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247135.1|3125047_3126073_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|3126100_3126499_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|3126841_3127054_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|3127455_3127977_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|3128300_3128636_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_063073914.1|3128739_3129666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036908073.1|3130082_3130511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|3130663_3130915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|3131358_3131628_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|3131627_3132098_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_162837602.1|3132079_3132238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905787.1|3132240_3132702_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_001967215.1|3133599_3133938_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_006537823.1|3133940_3134153_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
WP_006537822.1|3134275_3134743_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_017628363.1|3134696_3136430_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
3135431:3135447	attL	GATCACCAACAGTGGCC	NA	NA	NA	NA
WP_017628362.1|3136429_3137698_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|3137715_3138384_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|3138387_3139554_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|3139592_3139892_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|3139891_3140221_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_063073913.1|3140210_3140684_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.6	2.8e-11
WP_017628357.1|3140689_3141031_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|3141040_3141706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|3141770_3142187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|3142183_3142462_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|3142486_3142678_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|3142804_3146080_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|3146080_3146677_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|3146676_3147258_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|3147274_3147610_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|3147688_3148087_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
WP_063073912.1|3152493_3152703_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_049219717.1|3152973_3153222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081232609.1|3153275_3155459_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.1e-16
WP_049219712.1|3156020_3156221_+	hypothetical protein	NA	Q77Z09	Phage_21	92.6	3.3e-22
WP_049206743.1|3158474_3159179_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_049206744.1|3159171_3161289_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063073916.1|3162187_3163315_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	59.0	4.1e-117
WP_012367804.1|3163295_3163538_-	excisionase	NA	NA	NA	NA	NA
WP_063073917.1|3163794_3164454_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.4	1.7e-46
WP_063073918.1|3164772_3165846_+	conserved phage C-terminal domain-containing protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	6.4e-27
WP_063073919.1|3165858_3166257_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	54.5	2.3e-30
WP_012367807.1|3166478_3166739_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247849.1|3166893_3167151_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247850.1|3167156_3167429_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_049202017.1|3167734_3167941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073920.1|3168242_3169265_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	68.3	1.2e-128
WP_063073921.1|3169538_3170426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073923.1|3170670_3171060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073924.1|3171210_3171480_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	46.7	7.4e-17
WP_063073925.1|3171479_3171950_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	4.0e-50
WP_166465087.1|3171931_3172090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073926.1|3172092_3172554_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.7	5.5e-12
WP_063073927.1|3172793_3173369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073928.1|3173435_3173714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247866.1|3174184_3174697_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	1.1e-58
WP_049209882.1|3174709_3175204_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.6	2.3e-48
WP_063073929.1|3175200_3177303_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.9	7.7e-295
WP_004247869.1|3177299_3177515_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_063073930.1|3177511_3179002_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	1.6e-190
WP_096058092.1|3178967_3180956_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	63.9	1.0e-248
WP_049209887.1|3181044_3181386_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
WP_063073894.1|3181397_3181670_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
WP_063073895.1|3181679_3182243_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_036973524.1|3182242_3182638_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_074153257.1|3182649_3183171_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.2e-65
3183075:3183091	attR	GATCACCAACAGTGGCC	NA	NA	NA	NA
WP_049202041.1|3183182_3183572_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	39.4	3.1e-16
WP_080591809.1|3183592_3183913_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	42.0	9.7e-16
WP_063073893.1|3183881_3186875_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	33.8	1.3e-109
WP_063073892.1|3186875_3187205_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	54.6	6.7e-28
WP_004247884.1|3187299_3187875_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	34.1	4.9e-18
WP_063073891.1|3187927_3188632_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.1	1.7e-65
WP_063073890.1|3188653_3189382_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	1.4e-89
WP_064971711.1|3189285_3189936_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	45.9	4.8e-46
WP_063073889.1|3189950_3193154_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	55.5	2.9e-277
WP_049219065.1|3193143_3193476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073888.1|3193475_3194162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827679.1|3194158_3194425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073887.1|3194441_3194681_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	68.4	2.0e-21
WP_139208638.1|3194721_3195315_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	80.4	1.7e-77
>prophage 215
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3199576	3203173	4203751		Phage_21(66.67%)	7	NA	NA
WP_004247902.1|3199576_3199741_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_017628191.1|3200135_3200273_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	90.7	4.9e-17
WP_017628190.1|3200425_3200758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628189.1|3200997_3201438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628188.1|3201618_3201954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628187.1|3202352_3202601_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_017827607.1|3203020_3203173_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	6.8e-20
>prophage 216
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3207866	3208079	4203751		Morganella_phage(100.0%)	1	NA	NA
WP_004247907.1|3207866_3208079_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
>prophage 217
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3214060	3215941	4203751		uncultured_marine_virus(50.0%)	2	NA	NA
WP_004247912.1|3214060_3214702_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_004251487.1|3214714_3215941_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
>prophage 218
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3219949	3229909	4203751		Morganella_phage(60.0%)	15	NA	NA
WP_004247917.1|3219949_3220126_+	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
WP_004242534.1|3220617_3220839_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|3221265_3221547_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_017628181.1|3221915_3222329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|3222356_3222599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247920.1|3222661_3223222_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|3223597_3223795_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|3223812_3224589_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|3224823_3225207_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004247922.1|3225349_3226213_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_017628180.1|3226339_3226771_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	37.4	5.1e-20
WP_017628179.1|3226944_3227682_+	phosphatase	NA	NA	NA	NA	NA
WP_004251474.1|3227768_3228317_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_004242555.1|3228768_3229164_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_004242557.1|3229474_3229909_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.5	7.7e-24
>prophage 219
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3232921	3233263	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004242565.1|3232921_3233263_+	YebY family protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	32.7	1.5e-06
>prophage 220
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3239117	3241178	4203751		Moraxella_phage(100.0%)	1	NA	NA
WP_004247931.1|3239117_3241178_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	9.2e-83
>prophage 221
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3247627	3248194	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_004242580.1|3247627_3248194_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.8	2.3e-07
>prophage 222
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3252744	3253632	4203751		Klosneuvirus(100.0%)	1	NA	NA
WP_004251467.1|3252744_3253632_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.2	1.4e-08
>prophage 223
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3259828	3273313	4203751	tRNA	Tupanvirus(62.5%)	13	NA	NA
WP_004242605.1|3259828_3261757_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	8.0e-129
WP_012367833.1|3261760_3262300_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	2.8e-15
WP_004242608.1|3262394_3262592_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004242609.1|3262635_3262992_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|3263092_3263140_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004242610.1|3263316_3264300_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	3.8e-34
WP_004247944.1|3264314_3266702_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004242612.1|3266706_3267003_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_004242613.1|3267285_3268320_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004242614.1|3268321_3269071_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.0	3.0e-07
WP_004247945.1|3269205_3270351_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	1.9e-37
WP_004242618.1|3270350_3271331_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.1	5.6e-38
WP_004242621.1|3271330_3273313_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	1.3e-20
>prophage 224
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3276761	3278835	4203751		Bacillus_phage(50.0%)	3	NA	NA
WP_017628170.1|3276761_3277253_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	40.5	9.1e-13
WP_017628169.1|3277330_3278350_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_004242629.1|3278466_3278835_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	37.4	4.6e-09
>prophage 225
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3296329	3297256	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080975004.1|3296329_3297256_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	65.7	7.5e-08
>prophage 226
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3304820	3305768	4203751		Tupanvirus(100.0%)	1	NA	NA
WP_004242665.1|3304820_3305768_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	1.7e-44
>prophage 227
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3308897	3316128	4203751		Pseudomonas_phage(33.33%)	8	NA	NA
WP_004242680.1|3308897_3309980_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	5.1e-08
WP_004247962.1|3309979_3310828_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004242688.1|3310805_3311621_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004242689.1|3311678_3312533_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	7.5e-47
WP_017628160.1|3312540_3313470_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_004247964.1|3313547_3313826_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004247966.1|3313822_3314347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628159.1|3314427_3316128_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.2	2.1e-32
>prophage 228
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3328698	3330429	4203751	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004242704.1|3328698_3330429_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	8.0e-88
>prophage 229
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3334074	3343952	4203751	tRNA	Tupanvirus(40.0%)	10	NA	NA
WP_017628156.1|3334074_3335637_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.5	4.2e-19
WP_017628155.1|3335973_3336948_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004242718.1|3336950_3337700_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	29.5	4.3e-14
WP_004242719.1|3337884_3338283_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_017628154.1|3338550_3340335_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	38.4	7.1e-07
WP_004247981.1|3340338_3340773_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004242729.1|3340801_3341557_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004242730.1|3341681_3342203_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.0	5.3e-11
WP_004242731.1|3342305_3342929_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004242732.1|3342941_3343952_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	6.9e-07
>prophage 230
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3356792	3362702	4203751	transposase	Macacine_betaherpesvirus(33.33%)	7	NA	NA
WP_080600918.1|3356792_3356981_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.0	2.5e-11
WP_017628149.1|3357061_3357379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242751.1|3357813_3357999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247983.1|3358838_3359624_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004242756.1|3359616_3360342_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	9.9e-16
WP_004242757.1|3360416_3361361_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_175246667.1|3361373_3362702_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	2.8e-16
>prophage 231
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3366750	3376604	4203751	tRNA	Cyanophage(33.33%)	9	NA	NA
WP_004242768.1|3366750_3368226_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.7	5.6e-82
WP_012367881.1|3368808_3369249_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004247986.1|3369250_3369583_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_012367883.1|3369873_3370737_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004242773.1|3370766_3371111_-	RidA family protein	NA	NA	NA	NA	NA
WP_012367884.1|3371196_3373134_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	1.1e-85
WP_026090434.1|3373233_3373929_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004242776.1|3374019_3374613_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004242778.1|3374915_3376604_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	1.9e-33
>prophage 232
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3383545	3384196	4203751		Bacillus_virus(100.0%)	1	NA	NA
WP_004242790.1|3383545_3384196_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.4	2.7e-20
>prophage 233
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3387841	3390521	4203751		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017628144.1|3387841_3389395_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.4e-06
WP_017628143.1|3389522_3390521_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	1.9e-62
>prophage 234
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3400919	3404816	4203751		Catovirus(100.0%)	1	NA	NA
WP_017628136.1|3400919_3404816_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.0	1.5e-57
>prophage 235
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3418810	3421833	4203751		Escherichia_phage(100.0%)	2	NA	NA
WP_004248020.1|3418810_3421207_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.2	1.4e-146
WP_004242832.1|3421203_3421833_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.1	3.2e-63
>prophage 236
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3430368	3435755	4203751	transposase	Bacillus_virus(25.0%)	4	NA	NA
WP_017628129.1|3430368_3431934_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.7	8.7e-41
WP_096043110.1|3432228_3433336_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	4.0e-40
WP_017628126.1|3433336_3433537_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	68.5	6.7e-15
WP_017628125.1|3433781_3435755_+	ATP-binding protein	NA	X5JAK5	Clostridium_phage	36.3	4.5e-79
>prophage 237
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3442851	3443844	4203751	integrase	Thermus_phage(100.0%)	1	3439464:3439478	3456755:3456769
3439464:3439478	attL	AAAGTAAAATGATTA	NA	NA	NA	NA
WP_004251263.1|3442851_3443844_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
WP_004251263.1|3442851_3443844_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
3456755:3456769	attR	AAAGTAAAATGATTA	NA	NA	NA	NA
>prophage 238
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3446984	3449741	4203751		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_026090432.1|3446984_3449741_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	6.4e-23
>prophage 239
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3454887	3464879	4203751		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|3454887_3456945_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004242886.1|3456956_3458657_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|3458992_3459679_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|3459678_3460140_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|3460192_3460804_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|3460943_3461804_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|3461805_3462423_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|3462434_3464879_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 240
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3478062	3481137	4203751		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_004242916.1|3478062_3478926_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.4	2.7e-20
WP_004242917.1|3478970_3479300_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004248056.1|3479394_3481137_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.2	9.0e-39
>prophage 241
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3491947	3497370	4203751		Mycobacterium_phage(50.0%)	4	NA	NA
WP_012367924.1|3491947_3493450_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.6	1.4e-32
WP_012367925.1|3493604_3494201_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012367926.1|3494634_3495639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628114.1|3495771_3497370_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	1.8e-57
>prophage 242
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3500573	3501758	4203751		Salmonella_phage(100.0%)	1	NA	NA
WP_017628113.1|3500573_3501758_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	1.2e-13
>prophage 243
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3551134	3553078	4203751		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_017628098.1|3551134_3553078_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	29.5	9.5e-05
>prophage 244
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3557062	3557662	4203751		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004243033.1|3557062_3557662_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	6.7e-42
>prophage 245
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3569950	3575179	4203751	protease	Salmonella_phage(33.33%)	4	NA	NA
WP_017628093.1|3569950_3570475_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	47.9	4.3e-37
WP_004243046.1|3570648_3573246_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.3	5.4e-88
WP_063073810.1|3573551_3573800_+	YciN family protein	NA	NA	NA	NA	NA
WP_004243049.1|3574132_3575179_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.9	1.7e-24
>prophage 246
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3582659	3585632	4203751		Acinetobacter_phage(100.0%)	3	NA	NA
WP_004248130.1|3582659_3583253_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	37.9	6.8e-31
WP_004243063.1|3583254_3584253_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	9.7e-54
WP_017628090.1|3584258_3585632_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.6	1.4e-39
>prophage 247
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3590862	3592647	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004248134.1|3590862_3592647_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.6	2.9e-16
>prophage 248
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3597582	3601640	4203751	tRNA	Salmonella_phage(50.0%)	5	NA	NA
WP_004243080.1|3597582_3598119_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.4	2.2e-20
WP_017628086.1|3598471_3598861_+	VOC family protein	NA	NA	NA	NA	NA
WP_004251042.1|3598949_3599252_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004243084.1|3599692_3600361_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004243086.1|3600719_3601640_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
>prophage 249
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3618964	3624934	4203751	tRNA	Planktothrix_phage(66.67%)	6	NA	NA
WP_004248150.1|3618964_3619966_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.1	5.8e-06
WP_004243110.1|3619955_3620765_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_004243111.1|3620973_3621762_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004243113.1|3621979_3622591_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_004243115.1|3622669_3623539_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004248155.1|3623659_3624934_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
>prophage 250
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3633975	3639453	4203751		Enterobacteria_phage(25.0%)	5	NA	NA
WP_004243141.1|3633975_3635001_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.1	1.7e-32
WP_004243142.1|3635010_3635913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004248166.1|3636032_3637250_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.0	1.5e-11
WP_004243144.1|3637552_3638707_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.6	2.5e-85
WP_004243145.1|3638796_3639453_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.2	3.2e-21
>prophage 251
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3650071	3655275	4203751		environmental_halophage(33.33%)	5	NA	NA
WP_017628080.1|3650071_3651313_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.6	1.3e-84
WP_004243162.1|3651319_3652627_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004243163.1|3652601_3653348_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.9	9.3e-09
WP_004243165.1|3653392_3654889_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004248176.1|3654906_3655275_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.7	1.5e-12
>prophage 252
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3661694	3666325	4203751		Hokovirus(50.0%)	3	NA	NA
WP_004243172.1|3661694_3664070_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.2	3.3e-177
WP_004243173.1|3664288_3665155_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004248179.1|3665275_3666325_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.3	4.7e-83
>prophage 253
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3674111	3674906	4203751		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004243181.1|3674111_3674906_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	6.8e-10
>prophage 254
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3682696	3683482	4203751		Cronobacter_phage(100.0%)	1	NA	NA
WP_012367995.1|3682696_3683482_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	65.2	2.2e-85
>prophage 255
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3688759	3690145	4203751		Morganella_phage(100.0%)	3	NA	NA
WP_004243203.1|3688759_3689197_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	2.7e-24
WP_004243204.1|3689263_3689602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243205.1|3689716_3690145_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.4e-22
>prophage 256
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3693684	3704623	4203751	holin	Rock_bream_iridovirus(25.0%)	8	NA	NA
WP_017628067.1|3693684_3694149_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	35.8	4.2e-20
WP_012368001.1|3694234_3695512_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_004250947.1|3695501_3696752_-	cytosine permease	NA	NA	NA	NA	NA
WP_004250946.1|3697138_3698806_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.5	2.1e-53
WP_004243216.1|3698851_3700327_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004248206.1|3700351_3700954_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004248207.1|3701163_3703206_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.6	1.2e-21
WP_012368002.1|3703465_3704623_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	29.7	2.4e-16
>prophage 257
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3711045	3714172	4203751		Morganella_phage(33.33%)	3	NA	NA
WP_012368005.1|3711045_3711381_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	46.7	3.5e-08
WP_004243227.1|3712178_3713186_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.5	1.1e-15
WP_004243228.1|3713182_3714172_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.8e-15
>prophage 258
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3728422	3729962	4203751		Planktothrix_phage(100.0%)	2	NA	NA
WP_049195210.1|3728422_3729259_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	3.7e-14
WP_004243243.1|3729248_3729962_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-23
>prophage 259
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3735053	3746261	4203751		Klebsiella_phage(20.0%)	10	NA	NA
WP_004243248.1|3735053_3735650_-	thymidine kinase	NA	A0A2K9V5L3	Klebsiella_phage	59.0	3.6e-56
WP_004243249.1|3736159_3736564_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004248222.1|3736793_3737801_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.7	1.9e-33
WP_004243251.1|3738056_3738962_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	1.9e-64
WP_012368013.1|3739143_3740163_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_004243253.1|3740326_3740818_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004243254.1|3740856_3741705_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	1.1e-13
WP_017628061.1|3742090_3742954_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004248228.1|3743397_3744204_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004250914.1|3744293_3746261_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.8	8.3e-41
>prophage 260
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3751540	3752182	4203751		Tupanvirus(100.0%)	1	NA	NA
WP_017628058.1|3751540_3752182_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.0	7.4e-23
>prophage 261
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3768379	3768766	4203751		uncultured_virus(100.0%)	1	NA	NA
WP_004248250.1|3768379_3768766_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	72.4	2.2e-14
>prophage 262
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3772181	3774014	4203751		Bacillus_phage(100.0%)	1	NA	NA
WP_004243286.1|3772181_3774014_-	excinuclease ABC subunit UvrC	NA	U5J9C9	Bacillus_phage	34.8	2.4e-05
>prophage 263
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3783758	3789174	4203751		Xanthomonas_phage(25.0%)	7	NA	NA
WP_004243300.1|3783758_3784472_-	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	33.5	5.0e-20
WP_012368022.1|3784857_3785646_+	glucose 1-dehydrogenase	NA	H2EEJ0	Moumouvirus	25.9	5.7e-09
WP_017628047.1|3785744_3786299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243305.1|3786295_3786703_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_004243308.1|3787473_3787731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243309.1|3787838_3788531_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	46.6	1.1e-56
WP_004248260.1|3788550_3789174_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.8	9.1e-18
>prophage 264
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3793460	3838669	4203751	terminase,integrase,holin,tail	Salmonella_phage(19.44%)	54	3820924:3820939	3842883:3842898
WP_004243319.1|3793460_3794513_-	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
WP_017628042.1|3794496_3795276_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.4e-31
WP_143475692.1|3795653_3796148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036936219.1|3796147_3796492_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.3	7.0e-44
WP_004243326.1|3796494_3796767_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_124740917.1|3796763_3797135_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_143475691.1|3797332_3798247_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_175246674.1|3798286_3800569_-	hypothetical protein	NA	T1S9Y2	Salmonella_phage	56.0	1.6e-67
WP_072064144.1|3800742_3800994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069368921.1|3801352_3802057_+	Rha family transcriptional regulator	NA	S5MQL6	Escherichia_phage	63.1	6.9e-30
WP_069368920.1|3802160_3802580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246675.1|3802583_3805967_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	35.8	2.4e-181
WP_175246676.1|3805966_3809050_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.1	5.1e-162
WP_175246677.1|3809052_3809601_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	59.6	1.7e-44
WP_161748139.1|3809600_3810089_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	60.5	7.1e-50
WP_175246678.1|3810072_3812535_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.0	0.0e+00
WP_104836493.1|3812534_3813140_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	6.7e-66
WP_175246679.1|3813139_3813451_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	38.1	4.4e-13
WP_036936189.1|3813514_3813856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555916.1|3813864_3814296_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_004243350.1|3814354_3815335_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_152134580.1|3815350_3816028_-	peptidase	NA	T1SAP9	Salmonella_phage	62.9	4.4e-42
WP_109391136.1|3816045_3816360_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_109023880.1|3816356_3818021_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.2	1.2e-197
WP_004243356.1|3818030_3818243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123822191.1|3818426_3819911_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	1.2e-230
WP_065424076.1|3819910_3820480_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.0e-43
WP_004243359.1|3820578_3820938_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	56.2	3.3e-28
3820924:3820939	attL	AGGTGATTTAGCCATT	NA	NA	NA	NA
WP_161780006.1|3820930_3821278_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_063073731.1|3821274_3821568_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_141192049.1|3821554_3821845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049203709.1|3821970_3822366_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_046334325.1|3822362_3822776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|3823022_3823748_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_036976826.1|3823747_3824590_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
WP_004243371.1|3824600_3824786_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_064505757.1|3824924_3825203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|3825280_3825889_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_175246680.1|3826137_3826299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143475675.1|3826285_3828010_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	47.3	9.3e-113
WP_087802220.1|3828055_3829096_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.7	1.4e-100
WP_049203698.1|3829140_3829398_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004247460.1|3829453_3829747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161752120.1|3829771_3829951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246681.1|3829950_3830304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246682.1|3830313_3830580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246683.1|3830945_3831185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246684.1|3831177_3831543_+	DUF2591 family protein	NA	A0A2I7S6G6	Vibrio_phage	41.8	4.7e-14
WP_175246685.1|3831529_3832171_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.1	2.3e-72
WP_175246686.1|3832173_3832371_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	4.4e-19
WP_109023894.1|3832566_3833763_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.7	8.1e-140
WP_004250844.1|3833982_3835560_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243391.1|3835644_3837111_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_004243392.1|3837280_3838669_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
3842883:3842898	attR	AATGGCTAAATCACCT	NA	NA	NA	NA
>prophage 265
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3856306	3857020	4203751		Synechococcus_phage(100.0%)	1	NA	NA
WP_004243413.1|3856306_3857020_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.6e-37
>prophage 266
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3863295	3863652	4203751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004243423.1|3863295_3863652_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.3	1.7e-13
>prophage 267
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3868229	3872181	4203751		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_004243429.1|3868229_3869531_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	1.3e-61
WP_004248287.1|3869639_3870266_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004248288.1|3870497_3871538_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	3.0e-74
WP_004243435.1|3871551_3872181_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.1	2.8e-30
>prophage 268
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3881746	3883213	4203751		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004243443.1|3881746_3883213_-	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	30.0	3.7e-54
>prophage 269
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3891223	3894872	4203751	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_004243448.1|3891223_3892600_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	31.6	2.4e-34
WP_004243449.1|3892665_3893373_+	two-component system response regulator BaeR	NA	NA	NA	NA	NA
WP_004243450.1|3893492_3894872_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	82.1	2.7e-179
>prophage 270
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3905565	3911936	4203751		Rhizobium_phage(33.33%)	6	NA	NA
WP_017628032.1|3905565_3906450_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.8	4.3e-13
WP_004243466.1|3906580_3908050_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004243467.1|3909412_3909637_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	70.5	8.9e-16
WP_004248304.1|3909753_3910149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243469.1|3910246_3910429_-	YoaH family protein	NA	NA	NA	NA	NA
WP_017628031.1|3910541_3911936_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	39.6	3.6e-38
>prophage 271
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3916911	3918846	4203751		Morganella_phage(100.0%)	3	NA	NA
WP_004243477.1|3916911_3917355_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	2.5e-09
WP_012368048.1|3917463_3918282_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012368049.1|3918411_3918846_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.8	1.3e-26
>prophage 272
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3952911	3953898	4203751		Clostridium_phage(100.0%)	1	NA	NA
WP_004243530.1|3952911_3953898_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	39.1	3.6e-16
>prophage 273
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3968608	3974412	4203751		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_004243551.1|3968608_3968998_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	3.5e-07
WP_004243552.1|3969057_3970110_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	1.2e-06
WP_170827685.1|3970102_3970969_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_004243556.1|3970999_3972646_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	6.6e-07
WP_012368063.1|3972705_3974412_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	6.8e-15
>prophage 274
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3983872	3985451	4203751		Bacillus_virus(50.0%)	3	NA	NA
WP_004248352.1|3983872_3984571_-	MgtC family protein	NA	G3MA03	Bacillus_virus	47.0	3.3e-16
WP_004243572.1|3984935_3985130_-	protein DsrB	NA	NA	NA	NA	NA
WP_004243573.1|3985238_3985451_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
>prophage 275
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3990661	3993742	4203751		Escherichia_phage(100.0%)	1	NA	NA
WP_012368067.1|3990661_3993742_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.6	1.1e-07
>prophage 276
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	3998114	4006869	4203751		Morganella_phage(20.0%)	7	NA	NA
WP_004243585.1|3998114_3999056_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	45.2	9.4e-67
WP_017628016.1|3999339_4000548_+	multidrug efflux MFS transporter MdtG	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	5.9e-05
WP_004250754.1|4000968_4002504_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.5	8.5e-158
WP_012368073.1|4003310_4004090_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_004243592.1|4004190_4004613_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.7	7.3e-11
WP_004243593.1|4004842_4005160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628015.1|4005291_4006869_-	YadA-like family protein	NA	A0A0B6VPC9	Edwardsiella_phage	46.4	3.9e-09
>prophage 277
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4019307	4039093	4203751	holin,plate,lysis	Escherichia_phage(20.0%)	22	NA	NA
WP_012368081.1|4019307_4021746_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|4021757_4022375_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|4022378_4023155_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|4023270_4023813_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|4024381_4024561_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_017628011.1|4025875_4026532_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|4026528_4027716_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|4027708_4028053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|4028049_4028742_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|4028744_4029557_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|4029525_4029846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|4029858_4030347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628009.1|4030349_4032653_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|4032735_4033194_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|4033253_4033706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|4033716_4035204_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|4035212_4035725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|4035761_4036211_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|4036207_4036612_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|4036614_4036914_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|4037294_4038110_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
WP_004243642.1|4038355_4039093_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	44.8	2.6e-56
>prophage 278
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4044936	4059746	4203751		Pseudomonas_phage(33.33%)	10	NA	NA
WP_017628005.1|4044936_4047765_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	24.3	1.7e-34
WP_036971114.1|4047965_4050599_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	1.4e-104
WP_004243650.1|4050783_4051521_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004250699.1|4051882_4054174_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.1	2.4e-305
WP_004248376.1|4054185_4055316_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	3.4e-172
WP_170827686.1|4055355_4055619_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	60.6	8.5e-18
WP_004243656.1|4055726_4055960_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_004248379.1|4056150_4057362_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004248380.1|4057466_4058009_-	membrane protein	NA	NA	NA	NA	NA
WP_004248382.1|4058291_4059746_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.5	6.5e-99
>prophage 279
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4089504	4091334	4203751		Oenococcus_phage(100.0%)	1	NA	NA
WP_017627997.1|4089504_4091334_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	32.6	1.9e-15
>prophage 280
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4119311	4120829	4203751		Mollivirus(100.0%)	1	NA	NA
WP_004243730.1|4119311_4120829_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	2.0e-90
>prophage 281
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4125452	4182202	4203751	tRNA,head,lysis,protease,capsid,holin,portal,terminase,tail	Proteus_phage(43.24%)	64	NA	NA
WP_170827680.1|4125452_4126268_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004243737.1|4126321_4127332_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017627981.1|4127376_4128504_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.9	2.0e-23
WP_004248400.1|4128652_4129438_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004248401.1|4129559_4130480_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004243743.1|4131048_4132260_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004248402.1|4132464_4134504_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_004248403.1|4134577_4135126_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004243747.1|4135227_4136124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243748.1|4136445_4136718_-	YfcL family protein	NA	NA	NA	NA	NA
WP_004243749.1|4136854_4137409_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_004248404.1|4137425_4138226_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004243753.1|4138398_4139484_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.5	8.2e-91
WP_004243756.1|4139572_4140505_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004250672.1|4140899_4141454_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_004243759.1|4141606_4142149_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_004248407.1|4142191_4142677_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_017627980.1|4143110_4145279_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_004243765.1|4145278_4146583_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004243769.1|4146819_4147116_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_017627979.1|4147461_4148823_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_004248410.1|4148898_4149642_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_017627978.1|4150963_4151659_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_121909571.1|4152176_4152407_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	5.9e-31
WP_175246691.1|4152446_4153859_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	53.0	2.7e-110
WP_175246692.1|4153873_4157218_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.6	3.2e-186
WP_036901068.1|4157218_4157617_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.0	2.7e-31
WP_049219072.1|4157679_4158321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049219073.1|4158332_4158914_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.4e-50
WP_175246693.1|4159509_4162812_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	7.1e-186
WP_017827267.1|4163068_4163419_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
WP_017827268.1|4163418_4163895_-|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
WP_080748434.1|4163917_4164322_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	56.3	3.6e-31
WP_036901052.1|4164318_4164708_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.8	7.6e-31
WP_074924467.1|4164694_4165030_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	45.9	1.4e-17
WP_049217570.1|4165026_4165347_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.5	5.0e-20
WP_175246694.1|4165346_4165547_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	100.0	2.0e-19
WP_074924469.1|4165590_4166805_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.0	3.6e-220
WP_175246695.1|4166816_4167668_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	98.6	2.5e-151
WP_175246696.1|4167672_4169004_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	96.4	1.4e-249
WP_087741134.1|4169003_4170737_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.1	0.0e+00
WP_049218005.1|4170740_4171211_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.4	7.7e-70
WP_049218006.1|4171358_4171556_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
WP_049219087.1|4171552_4171903_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.9	2.4e-60
WP_049219089.1|4171968_4172376_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	85.9	1.7e-57
WP_049219090.1|4172477_4172669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167767287.1|4172792_4172933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175246697.1|4172932_4173382_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	57.0	3.1e-28
WP_064497292.1|4173378_4173771_-	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	95.7	9.7e-50
WP_026164630.1|4173763_4174072_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	62.7	3.5e-31
WP_142836738.1|4175009_4175648_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	35.9	3.9e-32
WP_175246698.1|4175644_4175860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161728930.1|4175849_4176215_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.0e-37
WP_063108505.1|4176211_4176502_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	80.0	4.3e-39
WP_142836740.1|4176594_4176864_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	76.1	4.2e-28
WP_121909391.1|4177174_4177399_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	73.9	6.8e-24
WP_121909375.1|4177404_4177848_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	61.5	2.9e-42
WP_063073731.1|4178257_4178551_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_175246699.1|4178537_4178759_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152964332.1|4178774_4178942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909389.1|4178960_4180328_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	63.8	2.5e-161
WP_110229454.1|4180331_4181168_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	57.0	2.6e-68
WP_175246700.1|4181164_4181848_-	phage antirepressor KilAC domain-containing protein	NA	A0A1P8DTE1	Proteus_phage	93.0	1.8e-112
WP_063073726.1|4181869_4182202_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
>prophage 282
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4187045	4195213	4203751		Proteus_phage(37.5%)	14	NA	NA
WP_063693267.1|4187045_4187300_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	5.0e-39
WP_175246624.1|4187296_4188121_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0M5M5Y6	Salmonella_phage	68.2	4.3e-108
WP_142836750.1|4188672_4189212_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	58.7	2.5e-56
WP_153274246.1|4189227_4189389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142836744.1|4189430_4189649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|4189684_4189972_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_063073715.1|4189971_4190325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073714.1|4190334_4190703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175246627.1|4190859_4191048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043071.1|4191040_4191397_+	DUF2591 family protein	NA	K7PH48	Enterobacterial_phage	33.9	2.3e-10
WP_175246702.1|4191383_4191986_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	50.5	2.2e-53
WP_036905342.1|4192198_4192390_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_121909571.1|4193926_4194157_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	5.9e-31
WP_175246703.1|4194196_4195213_-	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	58.8	7.8e-75
>prophage 283
NZ_CP053719	Proteus mirabilis strain MPE0346 chromosome, complete genome	4203751	4200653	4201253	4203751		Salmonella_phage(100.0%)	1	NA	NA
WP_060961288.1|4200653_4201253_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.4	4.0e-55
