The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	0	4497	4104163		Xanthomonas_phage(50.0%)	3	NA	NA
WP_004249162.1|2300_2825_+	single-stranded DNA-binding protein SSB1	NA	I3PGW4	Xanthomonas_phage	67.0	7.6e-58
WP_004245904.1|3166_3697_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_004245906.1|3885_4497_-	repressor LexA	NA	U5P451	Shigella_phage	45.6	2.5e-12
>prophage 2
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	14207	17879	4104163		Dickeya_phage(100.0%)	1	NA	NA
WP_165469444.1|14207_17879_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.0	2.1e-21
>prophage 3
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	36142	40037	4104163		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_012368501.1|36142_37732_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	9.3e-67
WP_004249142.1|37744_39034_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_004246923.1|39057_39750_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004246922.1|39764_40037_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.7	8.0e-19
>prophage 4
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	50208	69466	4104163	transposase	Sodalis_phage(14.29%)	16	NA	NA
WP_017628671.1|50208_51201_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	41.6	4.6e-48
WP_064497153.1|51393_55623_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	1.1e-66
WP_004246906.1|55745_59774_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	1.4e-21
WP_004246905.1|60126_60492_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004246904.1|60555_61053_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004246903.1|61380_62082_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004246901.1|62086_62515_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004246900.1|62660_63206_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	4.5e-13
WP_004246899.1|63213_63591_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_004249692.1|63863_65048_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
WP_012368509.1|65115_67230_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	4.7e-58
WP_004246897.1|67309_67780_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004246896.1|67879_68254_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004246894.1|68381_68675_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004249124.1|68705_69074_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_017628670.1|69073_69466_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.3	1.8e-16
>prophage 5
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	76581	84365	4104163		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_175223853.1|76581_78513_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.5	2.8e-73
WP_012368514.1|78839_80531_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	1.0e-07
WP_012368515.1|80986_82714_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.0	1.7e-05
WP_017628668.1|82820_84365_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	53.3	2.2e-36
>prophage 6
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	90461	98211	4104163		Klosneuvirus(20.0%)	6	NA	NA
WP_004246871.1|90461_91679_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.4	7.2e-27
WP_004246870.1|91796_92372_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_004246869.1|92744_93317_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_004249106.1|93591_94215_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_175223854.1|94673_95162_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	5.1e-16
WP_012368519.1|95412_98211_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	9.0e-73
>prophage 7
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	114370	116348	4104163		Bacillus_virus(50.0%)	2	NA	NA
WP_004250067.1|114370_115372_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.3e-18
WP_004246844.1|115364_116348_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.5e-17
>prophage 8
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	135898	139008	4104163		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_004246821.1|135898_136522_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.2	1.0e-21
WP_004246820.1|136576_136852_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004246819.1|136881_139008_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.5	2.6e-11
>prophage 9
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	143391	144783	4104163		environmental_Halophage(100.0%)	1	NA	NA
WP_017628656.1|143391_144783_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	76.4	9.7e-52
>prophage 10
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	153376	158207	4104163		Tupanvirus(50.0%)	3	NA	NA
WP_004246802.1|153376_155212_-	ribosome-dependent GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.7	1.6e-22
WP_004246801.1|155571_156981_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004249083.1|157160_158207_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.9	1.7e-08
>prophage 11
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	167209	175053	4104163		Bacillus_phage(60.0%)	8	NA	NA
WP_004246792.1|167209_167932_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	8.3e-31
WP_004246791.1|167931_169272_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.2	2.0e-09
WP_017628647.1|169474_170515_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	36.0	1.2e-49
WP_004246789.1|170590_171550_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004249075.1|171551_172454_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004246787.1|172484_173261_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	6.9e-15
WP_017628646.1|173275_174010_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_017628645.1|174213_175053_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	65.7	8.3e-06
>prophage 12
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	192513	193872	4104163		Moraxella_phage(100.0%)	1	NA	NA
WP_004249062.1|192513_193872_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.4	3.5e-62
>prophage 13
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	221726	223325	4104163		Bacillus_phage(50.0%)	2	NA	NA
WP_004246732.1|221726_222479_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.6e-08
WP_004246731.1|222515_223325_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	2.4e-10
>prophage 14
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	228900	229467	4104163		Escherichia_phage(100.0%)	1	NA	NA
WP_004246725.1|228900_229467_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	29.5	6.1e-13
>prophage 15
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	236350	239064	4104163		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_004246712.1|236350_237313_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.3	2.5e-51
WP_004246711.1|237299_238307_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_004246710.1|238308_239064_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.6e-16
>prophage 16
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	242439	245495	4104163		Escherichia_phage(100.0%)	2	NA	NA
WP_017628626.1|242439_244857_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.0	2.4e-138
WP_004246705.1|244853_245495_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	3.3e-63
>prophage 17
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	251129	251843	4104163		Bacillus_virus(100.0%)	1	NA	NA
WP_004246695.1|251129_251843_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-17
>prophage 18
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	257532	259023	4104163		Aeromonas_phage(100.0%)	1	NA	NA
WP_004246686.1|257532_259023_-	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	26.6	2.9e-22
>prophage 19
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	264979	267920	4104163		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_004246680.1|264979_266350_-	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	23.7	2.1e-06
WP_004246679.1|266363_267920_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	33.3	2.8e-07
>prophage 20
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	271703	273351	4104163	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_063693206.1|271703_272912_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
WP_063073907.1|272934_273351_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	4.9e-44
>prophage 21
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	291465	292500	4104163		Wolbachia_phage(100.0%)	1	NA	NA
WP_017628609.1|291465_292500_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
>prophage 22
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	304051	305671	4104163		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004246655.1|304051_305671_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.7e-140
>prophage 23
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	316115	317231	4104163		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004246639.1|316115_317231_+	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
>prophage 24
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	320660	442673	4104163	tRNA,integrase,protease,transposase	Salmonella_phage(18.52%)	108	372202:372261	452498:452514
WP_004249858.1|320660_321476_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_004246629.1|321520_322195_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004249859.1|322191_322902_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246627.1|322903_323932_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_064497091.1|323972_324647_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|324764_325388_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_109023954.1|325755_327714_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	2.8e-89
WP_004246621.1|327878_328190_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_064497089.1|328186_329842_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_064497088.1|330164_331796_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_165469476.1|333074_333491_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	5.5e-43
WP_004249865.1|333577_334270_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064497334.1|334273_335692_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_064497335.1|335682_336420_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|342597_343284_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368605.1|343364_344762_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_004246607.1|344843_345770_-	ribokinase	NA	NA	NA	NA	NA
WP_175223855.1|346050_347550_+	ATPase RavA	NA	A0A0N7A9S6	Sulfolobus_monocaudavirus	29.2	8.6e-22
WP_064497150.1|347557_349015_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|349015_350008_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|350168_350630_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_064497149.1|350730_351171_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004246600.1|351550_353449_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004246599.1|353445_354072_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|354686_355064_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|355095_355920_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|355965_356205_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|356266_356737_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|356749_357283_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|357297_358839_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|358896_359760_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|359794_361177_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|361198_361615_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_064497148.1|361765_363139_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.7	3.3e-28
WP_049210449.1|363296_365123_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	2.1e-131
WP_001029679.1|365282_366104_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|366090_368199_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|368195_369863_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|370665_372240_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
372202:372261	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|372264_372969_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
372202:372261	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_011264039.1|373041_373281_+	macrolide transporter	NA	NA	NA	NA	NA
WP_000612791.1|373426_374290_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001354008.1|374327_374573_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|375041_375833_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_109023896.1|375835_376111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|377012_377345_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_001206316.1|377514_378306_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|378398_379658_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|379919_380711_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|380768_381377_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|381472_382315_-	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_000845048.1|382481_383495_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|383697_384048_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|384173_384734_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_175223856.1|384736_387688_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_046788546.1|387696_388098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|388182_388887_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_000214122.1|390910_392125_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|392152_392458_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_175223901.1|392925_394059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001445143.1|394089_394341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|394623_395439_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|395528_396618_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|396815_397301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|399111_399864_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|400285_401311_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|401539_402316_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|402429_403134_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
402367:402429	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCAC	NA	NA	NA	NA
WP_000376616.1|403251_403455_-	hypothetical protein	NA	NA	NA	NA	NA
402367:402429	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCAC	NA	NA	NA	NA
WP_000259031.1|403582_404422_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|404415_404763_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|404985_405438_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|405522_406155_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|406292_407123_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|407253_407808_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000251879.1|411189_412806_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|413036_413414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|413823_414195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|414255_414753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|414828_415617_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|415674_416199_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|416293_416767_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|417098_417635_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|417749_418076_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|418263_418503_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_046335306.1|419412_420489_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	5.4e-26
WP_004249813.1|420501_422193_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_064497250.1|422241_423249_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049210447.1|423313_424441_+	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064497247.1|424515_424920_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_017826966.1|425137_425542_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_041701435.1|425597_425885_-	YjeO family protein	NA	NA	NA	NA	NA
WP_064497246.1|425973_426786_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_064497245.1|427660_428794_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_004246570.1|428803_430210_+	YfcC family protein	NA	NA	NA	NA	NA
WP_004246569.1|430302_430941_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_064497244.1|431062_432166_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_064497243.1|432158_433679_+	MFS transporter	NA	NA	NA	NA	NA
WP_004249975.1|433773_434223_-	metal-binding protein	NA	NA	NA	NA	NA
WP_004246565.1|434398_435073_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_109024035.1|435094_437008_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246563.1|437181_437496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249798.1|437520_438159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497241.1|438442_439105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497240.1|439518_440175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368617.1|440573_441239_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_004249797.1|441535_441940_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.3	1.4e-22
WP_017628739.1|442088_442673_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
452498:452514	attR	ATCGTCAGGCATTGGCG	NA	NA	NA	NA
>prophage 25
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	455428	456391	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_004249967.1|455428_456391_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	1.5e-59
>prophage 26
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	459398	461261	4104163		Tupanvirus(100.0%)	1	NA	NA
WP_064497235.1|459398_461261_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	8.2e-14
>prophage 27
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	489702	497213	4104163		Staphylococcus_phage(33.33%)	7	NA	NA
WP_012368639.1|489702_489963_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	3.5e-16
WP_004246510.1|489926_490286_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004246509.1|490303_490447_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004246507.1|491169_492570_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004246506.1|492574_493678_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.1	3.8e-51
WP_036919434.1|493689_494778_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004246504.1|494798_497213_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	55.4	4.5e-12
>prophage 28
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	505767	506151	4104163		Escherichia_phage(100.0%)	1	NA	NA
WP_049194960.1|505767_506151_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	54.6	1.1e-26
>prophage 29
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	510124	512733	4104163		Xanthomonas_phage(33.33%)	3	NA	NA
WP_004246490.1|510124_510583_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	6.0e-51
WP_109023956.1|510566_511775_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	1.4e-46
WP_107033662.1|512061_512733_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	27.8	8.0e-20
>prophage 30
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	519479	520786	4104163		Bacillus_phage(50.0%)	2	NA	NA
WP_060557234.1|519479_520304_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.4	9.5e-23
WP_004246474.1|520300_520786_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	6.6e-24
>prophage 31
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	532594	538835	4104163		Synechococcus_phage(25.0%)	5	NA	NA
WP_012368661.1|532594_533533_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	35.3	6.3e-31
WP_060557223.1|533800_535000_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.8e-36
WP_109023925.1|535009_536035_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	8.0e-19
WP_060557221.1|536574_537540_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_109023926.1|537542_538835_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	36.6	7.7e-11
>prophage 32
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	544239	547017	4104163	tRNA	Catovirus(50.0%)	3	NA	NA
WP_175223859.1|544239_545217_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.4	9.3e-17
WP_004246449.1|545334_545838_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_109024048.1|545850_547017_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	3.8e-118
>prophage 33
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	555500	557603	4104163		Bacillus_phage(50.0%)	2	NA	NA
WP_004249722.1|555500_556892_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_004246432.1|556904_557603_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
>prophage 34
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	567308	570996	4104163		Salmonella_phage(50.0%)	3	NA	NA
WP_060557199.1|567308_568496_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.9	2.6e-13
WP_004246422.1|568605_570138_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|570180_570996_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
>prophage 35
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	574177	575518	4104163		Erwinia_phage(100.0%)	1	NA	NA
WP_004246417.1|574177_575518_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
>prophage 36
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	591988	594932	4104163		Hokovirus(50.0%)	2	NA	NA
WP_064497120.1|591988_593419_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.0	6.9e-61
WP_004246398.1|593429_594932_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
>prophage 37
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	599803	601528	4104163		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004246391.1|599803_601528_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
>prophage 38
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	612860	614714	4104163		Acinetobacter_phage(100.0%)	1	NA	NA
WP_064497127.1|612860_614714_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	25.5	2.3e-08
>prophage 39
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	623701	626807	4104163		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004246971.1|623701_624649_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.5	4.2e-30
WP_012368688.1|625622_626807_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
>prophage 40
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	646112	650032	4104163	tRNA	Prochlorococcus_phage(25.0%)	5	NA	NA
WP_004246934.1|646112_647063_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	2.8e-10
WP_004246933.1|647089_647605_-	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	39.6	1.4e-16
WP_004246932.1|647736_648894_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	30.0	4.2e-32
WP_004246931.1|648912_649470_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_004249883.1|649462_650032_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.6	2.4e-09
>prophage 41
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	661663	663313	4104163		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_017627862.1|661663_663313_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.3	6.5e-63
>prophage 42
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	670774	678596	4104163	transposase	Helicobacter_phage(20.0%)	8	NA	NA
WP_053828310.1|670774_671197_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.8	4.0e-41
WP_053828405.1|671212_672421_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.1e-187
WP_004246360.1|672552_672822_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_004253075.1|672822_673071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249673.1|673243_675265_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	6.2e-116
WP_004246357.1|675339_676848_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004249672.1|676851_678150_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	28.7	1.7e-34
WP_004246355.1|678269_678596_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.4	6.6e-20
>prophage 43
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	683114	689291	4104163		Catovirus(20.0%)	6	NA	NA
WP_017628777.1|683114_684245_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.2	8.5e-30
WP_004246348.1|684241_685504_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.1	1.3e-23
WP_012368702.1|685494_686568_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.3	7.1e-103
WP_004249667.1|686586_687468_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	8.4e-110
WP_004246344.1|687445_688159_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004246343.1|688160_689291_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	37.8	1.2e-20
>prophage 44
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	705726	709668	4104163		Brevibacillus_phage(50.0%)	3	NA	NA
WP_004246325.1|705726_706650_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	25.8	9.7e-24
WP_004246324.1|706649_707366_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_004246323.1|707511_709668_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	1.3e-116
>prophage 45
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	712955	714785	4104163		Catovirus(100.0%)	1	NA	NA
WP_004246318.1|712955_714785_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.1	7.9e-86
>prophage 46
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	729413	729959	4104163		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004253041.1|729413_729959_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.5	1.3e-28
>prophage 47
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	733964	737312	4104163		Vibrio_phage(50.0%)	2	NA	NA
WP_004253037.1|733964_735281_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	33.3	6.2e-16
WP_004253034.1|735302_737312_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	3.3e-61
>prophage 48
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	742824	747505	4104163		Cedratvirus(50.0%)	3	NA	NA
WP_004249629.1|742824_744123_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.4e-65
WP_004249627.1|744548_744977_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004246285.1|745015_747505_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
>prophage 49
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	752687	753896	4104163	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_175223869.1|752687_753896_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.5e-186
>prophage 50
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	769761	771496	4104163		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004246260.1|769761_770289_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	4.2e-56
WP_004249610.1|770488_771496_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.4	4.4e-70
>prophage 51
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	775069	777382	4104163		Vibrio_phage(25.0%)	4	NA	NA
WP_004246255.1|775069_775336_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.2	8.6e-18
WP_109023842.1|775521_775869_+	putative DNA-binding transcriptional regulator	NA	A0A1C6ZDN4	Pseudomonas_phage	50.0	1.2e-06
WP_004246253.1|775947_776364_+	putative DNA-binding transcriptional regulator	NA	C9DGL1	Escherichia_phage	53.8	3.9e-09
WP_004246252.1|776410_777382_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	1.4e-09
>prophage 52
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	783221	786086	4104163	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_004246243.1|783221_785162_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.8	8.3e-118
WP_004246242.1|785243_786086_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.8e-16
>prophage 53
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	790425	793176	4104163		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004246237.1|790425_793176_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.1e-26
>prophage 54
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	798805	800641	4104163		Catovirus(100.0%)	1	NA	NA
WP_004246232.1|798805_800641_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	7.2e-55
>prophage 55
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	807284	808988	4104163		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004246222.1|807284_808988_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	69.7	5.4e-214
>prophage 56
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	822377	829626	4104163		Trichoplusia_ni_ascovirus(25.0%)	10	NA	NA
WP_017628760.1|822377_822659_-	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.2	6.1e-14
WP_004246207.1|822945_823197_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_017628759.1|823312_823753_+	YhbP family protein	NA	NA	NA	NA	NA
WP_004246205.1|823761_824139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246204.1|824305_824515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246203.1|824541_825006_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	5.0e-53
WP_004246202.1|825010_827149_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_004246200.1|827494_827881_-	RidA family protein	NA	NA	NA	NA	NA
WP_004246198.1|828218_828677_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004246197.1|828690_829626_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.9e-52
>prophage 57
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	834613	839554	4104163	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_004249581.1|834613_837502_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	7.4e-147
WP_004246185.1|837515_837965_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004246183.1|838045_839554_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	8.3e-49
>prophage 58
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	845423	851033	4104163	transposase	Helicobacter_phage(33.33%)	5	NA	NA
WP_053828314.1|845423_845840_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.5	1.3e-44
WP_096043054.1|845862_847071_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	3.6e-188
WP_012368780.1|848553_848811_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004249548.1|849285_849897_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_026090512.1|849896_851033_-	RNA ligase RtcB family protein	NA	R4TNH6	Mycobacterium_phage	27.1	3.9e-27
>prophage 59
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	858544	865672	4104163		Micromonas_pusilla_virus(33.33%)	6	NA	NA
WP_004249538.1|858544_860239_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	31.8	1.5e-59
WP_004246140.1|860242_860527_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004249537.1|860577_861474_-	cation transporter	NA	NA	NA	NA	NA
WP_004246138.1|861550_862129_-	helix-turn-helix transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	41.7	8.2e-05
WP_017628749.1|862367_863555_+	MFS transporter	NA	NA	NA	NA	NA
WP_004246136.1|864325_865672_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.7	4.4e-158
>prophage 60
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	879484	882837	4104163		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_004246119.1|879484_881122_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	28.4	7.7e-40
WP_004246118.1|881247_881514_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004249526.1|881517_882048_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004246116.1|882051_882837_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.8	3.6e-27
>prophage 61
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	891816	892437	4104163		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628747.1|891816_892437_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.8	9.7e-20
>prophage 62
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	909516	910179	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_004245430.1|909516_910179_-	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	28.3	5.9e-07
>prophage 63
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	917503	919057	4104163		Escherichia_phage(100.0%)	1	NA	NA
WP_004245426.1|917503_919057_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	33.3	2.4e-19
>prophage 64
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	935755	938074	4104163		Tupanvirus(50.0%)	2	NA	NA
WP_004245408.1|935755_936733_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	20.8	2.1e-05
WP_004248870.1|936994_938074_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	4.6e-09
>prophage 65
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	945665	946805	4104163		Vibrio_phage(50.0%)	2	NA	NA
WP_004245400.1|945665_946340_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.9	3.6e-60
WP_004245397.1|946550_946805_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	4.1e-09
>prophage 66
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	951901	955089	4104163		Streptococcus_phage(50.0%)	2	NA	NA
WP_017628206.1|951901_954292_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	2.8e-131
WP_004248875.1|954462_955089_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	44.2	5.0e-16
>prophage 67
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	958670	962745	4104163		Staphylococcus_phage(33.33%)	4	NA	NA
WP_004245385.1|958670_959336_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	9.4e-13
WP_004248880.1|959328_960306_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004245383.1|960647_961502_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	2.5e-42
WP_004245382.1|961596_962745_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	1.4e-43
>prophage 68
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	966208	967303	4104163		Planktothrix_phage(100.0%)	1	NA	NA
WP_004248885.1|966208_967303_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.6e-20
>prophage 69
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	984013	985057	4104163		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245330.1|984013_985057_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
>prophage 70
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	998951	1007816	4104163		Thermobifida_phage(20.0%)	11	NA	NA
WP_004245308.1|998951_999806_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_004245307.1|999890_1000358_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004248916.1|1000513_1000801_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004248917.1|1000824_1002300_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004245304.1|1002359_1003085_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_064497339.1|1003091_1003625_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004245302.1|1003605_1004184_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004245301.1|1004201_1004759_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
WP_017628220.1|1004786_1005761_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
WP_026090454.1|1005779_1006760_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004245298.1|1007003_1007816_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
>prophage 71
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1015555	1018209	4104163		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_017628225.1|1015555_1016626_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
WP_017628226.1|1016817_1018209_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
>prophage 72
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1022737	1023247	4104163	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245280.1|1022737_1023247_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
>prophage 73
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1034111	1036448	4104163		Hokovirus(100.0%)	1	NA	NA
WP_004245272.1|1034111_1036448_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.0	4.0e-42
>prophage 74
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1045136	1048938	4104163		Caulobacter_phage(50.0%)	4	NA	NA
WP_004245257.1|1045136_1045727_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	5.6e-09
WP_004245256.1|1045749_1046127_-	YraN family protein	NA	NA	NA	NA	NA
WP_017628232.1|1046231_1047998_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004245252.1|1048059_1048938_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.9	1.8e-51
>prophage 75
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1061478	1063188	4104163		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004252657.1|1061478_1063188_-	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.0	1.1e-07
>prophage 76
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1068687	1077086	4104163	transposase	Salmonella_phage(20.0%)	8	NA	NA
WP_063693510.1|1068687_1069896_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.1e-187
WP_012368857.1|1069918_1070335_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
WP_004248950.1|1070470_1072138_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.6	1.9e-41
WP_012368858.1|1072479_1074399_+	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.3	1.8e-08
WP_004248952.1|1074500_1074812_+	trp operon repressor	NA	NA	NA	NA	NA
WP_004248953.1|1074901_1075441_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_004245229.1|1075492_1076140_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_017628237.1|1076183_1077086_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.2	1.5e-08
>prophage 77
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1093851	1107787	4104163	tRNA	Cyanophage(20.0%)	10	NA	NA
WP_004248961.1|1093851_1094805_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	8.8e-12
WP_017628242.1|1094989_1095973_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012367436.1|1096134_1096722_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_017628243.1|1097246_1099172_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.4	4.2e-146
WP_004245212.1|1099278_1100415_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.7	2.8e-17
WP_004245211.1|1100955_1102134_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.9	1.9e-85
WP_004245210.1|1102322_1103240_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004248964.1|1103314_1103575_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017628244.1|1104005_1104947_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004248968.1|1104976_1107787_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.5	1.3e-87
>prophage 78
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1111279	1112443	4104163		Halovirus(100.0%)	1	NA	NA
WP_017628247.1|1111279_1112443_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	2.6e-50
>prophage 79
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1123759	1128012	4104163		Staphylococcus_phage(50.0%)	4	NA	NA
WP_012367446.1|1123759_1124590_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.9	1.3e-64
WP_004248982.1|1124617_1125775_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004248983.1|1126022_1126694_-	DedA family protein	NA	NA	NA	NA	NA
WP_017628249.1|1126818_1128012_-	cystathionine beta-lyase	NA	A0A2I2L687	Orpheovirus	22.1	4.6e-10
>prophage 80
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1142962	1143871	4104163		Salmonella_phage(100.0%)	1	NA	NA
WP_004245172.1|1142962_1143871_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	56.2	2.4e-91
>prophage 81
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1151977	1159159	4104163		Bacillus_phage(66.67%)	4	NA	NA
WP_017628255.1|1151977_1155703_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	24.2	5.5e-09
WP_004252605.1|1155699_1156932_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_004249004.1|1157153_1157843_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	40.7	6.1e-39
WP_004245160.1|1157866_1159159_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.5	3.4e-27
>prophage 82
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1179821	1186702	4104163	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
WP_004245143.1|1179821_1180964_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	4.2e-93
WP_004245142.1|1181050_1181386_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.9e-10
WP_012367466.1|1181418_1183266_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004247209.1|1183276_1184245_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	2.0e-48
WP_004245139.1|1184363_1184813_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012367467.1|1184861_1186019_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.8e-51
WP_004245137.1|1186231_1186702_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.6e-30
>prophage 83
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1193743	1195252	4104163		Staphylococcus_phage(100.0%)	1	NA	NA
WP_017628266.1|1193743_1195252_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	7.9e-15
>prophage 84
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1212245	1213619	4104163		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004247225.1|1212245_1213619_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.4	8.6e-61
>prophage 85
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1218403	1223552	4104163	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_004245088.1|1218403_1219027_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
WP_004245087.1|1219171_1220443_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	7.3e-131
WP_017628270.1|1220700_1223055_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	8.8e-223
WP_004247229.1|1223276_1223552_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	6.0e-22
>prophage 86
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1227539	1232432	4104163		Bacillus_phage(66.67%)	4	NA	NA
WP_004245081.1|1227539_1228238_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.2	5.3e-83
WP_004245080.1|1228395_1228857_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247232.1|1228912_1230658_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.4e-54
WP_017628273.1|1230644_1232432_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.4e-42
>prophage 87
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1247205	1249961	4104163		Klosneuvirus(50.0%)	2	NA	NA
WP_012367485.1|1247205_1247757_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	9.5e-27
WP_017628277.1|1247984_1249961_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.8	2.3e-46
>prophage 88
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1271115	1280345	4104163	transposase	Mamastrovirus(20.0%)	9	NA	NA
WP_004245040.1|1271115_1272696_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	53.2	3.6e-18
WP_004245039.1|1272854_1273397_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.3	1.7e-15
WP_004245038.1|1273456_1274110_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004245037.1|1274958_1275900_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	2.7e-21
WP_004245036.1|1275896_1276667_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017628285.1|1276856_1278086_+	MFS transporter	NA	NA	NA	NA	NA
WP_004245034.1|1278174_1278357_+	DUF2526 family protein	NA	NA	NA	NA	NA
WP_053828325.1|1278697_1279114_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.2e-42
WP_063693470.1|1279136_1280345_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	4.3e-189
>prophage 89
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1287578	1287875	4104163		Morganella_phage(100.0%)	1	NA	NA
WP_004245017.1|1287578_1287875_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.4	1.4e-05
>prophage 90
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1294438	1295479	4104163		Bacillus_virus(100.0%)	1	NA	NA
WP_004245012.1|1294438_1295479_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-31
>prophage 91
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1305426	1311366	4104163		unidentified_phage(50.0%)	5	NA	NA
WP_071524519.1|1305426_1307010_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.3	7.4e-24
WP_064497130.1|1307097_1307427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244998.1|1307488_1307944_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004244997.1|1308140_1308851_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_017628292.1|1308936_1311366_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.7	5.8e-44
>prophage 92
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1315473	1315818	4104163		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004244992.1|1315473_1315818_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	2.0e-27
>prophage 93
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1319637	1320963	4104163		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244987.1|1319637_1320963_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	7.8e-35
>prophage 94
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1324678	1327682	4104163		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_004244983.1|1324678_1326316_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	9.7e-152
WP_004244982.1|1326380_1327682_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.2	6.8e-132
>prophage 95
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1331295	1338089	4104163		Lactobacillus_virus(25.0%)	7	NA	NA
WP_004244978.1|1331295_1332630_-	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	37.4	1.8e-07
WP_017628296.1|1332703_1333459_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004247298.1|1333496_1334210_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004244975.1|1334234_1334714_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	1.2e-49
WP_017628297.1|1334779_1335538_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	1.2e-40
WP_036894287.1|1336212_1337295_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004247305.1|1337294_1338089_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.2	1.5e-12
>prophage 96
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1344641	1345658	4104163		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628302.1|1344641_1345658_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	34.1	2.1e-35
>prophage 97
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1355722	1355935	4104163		Enterococcus_phage(100.0%)	1	NA	NA
WP_004244951.1|1355722_1355935_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	62.2	1.0e-05
>prophage 98
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1359902	1361906	4104163	holin	Vibrio_phage(100.0%)	1	NA	NA
WP_004244946.1|1359902_1361906_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.0	8.0e-23
>prophage 99
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1372842	1374297	4104163		Morganella_phage(50.0%)	2	NA	NA
WP_170827682.1|1372842_1373166_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNW5	Morganella_phage	41.8	1.1e-06
WP_004247323.1|1373730_1374297_-	phase variation DNA invertase MrpI	NA	A0A2L1IV36	Escherichia_phage	52.4	2.0e-51
>prophage 100
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1382087	1382411	4104163		Morganella_phage(100.0%)	1	NA	NA
WP_004244917.1|1382087_1382411_+	transcriptional regulator MrpJ	NA	A0A1W6JNW5	Morganella_phage	55.3	1.6e-05
>prophage 101
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1390684	1392424	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_004252439.1|1390684_1392424_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	1.4e-28
>prophage 102
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1405490	1406135	4104163		Synechococcus_phage(100.0%)	1	NA	NA
WP_064497201.1|1405490_1406135_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	24.1	1.3e-06
>prophage 103
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1423594	1425757	4104163		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_017628323.1|1423594_1425757_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
>prophage 104
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1442109	1444099	4104163	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_004247373.1|1442109_1442358_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
WP_004244838.1|1443028_1444099_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
>prophage 105
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1450901	1451495	4104163		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_004244829.1|1450901_1451495_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.0	6.2e-16
>prophage 106
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1466063	1466642	4104163		Caulobacter_phage(100.0%)	1	NA	NA
WP_004244807.1|1466063_1466642_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.5e-14
>prophage 107
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1485244	1487613	4104163		Streptococcus_phage(100.0%)	2	NA	NA
WP_004247396.1|1485244_1486348_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	9.7e-63
WP_004244786.1|1486359_1487613_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.9	1.6e-98
>prophage 108
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1491767	1497384	4104163	tRNA	Pseudomonas_phage(25.0%)	4	NA	NA
WP_017628346.1|1491767_1492274_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	44.0	1.0e-27
WP_004247401.1|1492381_1493449_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	1.8e-114
WP_004247402.1|1494350_1496978_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.1	5.8e-82
WP_004244778.1|1497195_1497384_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	63.2	1.3e-12
>prophage 109
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1507268	1508357	4104163		Klebsiella_phage(100.0%)	1	NA	NA
WP_170832182.1|1507268_1508357_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	51.7	7.7e-89
>prophage 110
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1516594	1519171	4104163		Cronobacter_phage(100.0%)	1	NA	NA
WP_004244758.1|1516594_1519171_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.0	5.8e-127
>prophage 111
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1546681	1559734	4104163		Mycobacterium_phage(22.22%)	14	NA	NA
WP_004246075.1|1546681_1547881_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|1548489_1549458_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|1549483_1551610_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1551638_1552043_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1552054_1552279_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1552560_1553034_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1553231_1553441_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|1553625_1553766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1554509_1554884_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1554899_1555865_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1555966_1556611_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1556968_1557232_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1557430_1558642_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_058336147.1|1558768_1559734_-	endolytic peptidoglycan transglycosylase RlpA	NA	H2BCY4	Synechococcus_phage	45.5	1.9e-06
>prophage 112
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1567009	1570677	4104163	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_004247439.1|1567009_1569592_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.8e-189
WP_004246043.1|1569951_1570677_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.6e-29
>prophage 113
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1576696	1577200	4104163		Streptomyces_phage(100.0%)	1	NA	NA
WP_004252236.1|1576696_1577200_+	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	36.8	9.3e-05
>prophage 114
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1580911	1581973	4104163		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004246031.1|1580911_1581973_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	2.5e-47
>prophage 115
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1585764	1586877	4104163		Synechococcus_phage(100.0%)	1	NA	NA
WP_004246024.1|1585764_1586877_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	7.3e-34
>prophage 116
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1594529	1636259	4104163	lysis,integrase,tail	Proteus_phage(21.43%)	69	1580938:1580953	1628194:1628209
1580938:1580953	attL	TCTCTTTTTCTGCTTT	NA	NA	NA	NA
WP_049213530.1|1594529_1595531_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.1	6.9e-68
WP_012367595.1|1595487_1595733_-	excisionase	NA	NA	NA	NA	NA
WP_004247455.1|1595729_1596068_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_012367596.1|1596060_1596237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023864.1|1596394_1596637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023863.1|1596636_1597344_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.5	3.5e-66
WP_041707084.1|1597377_1597572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023862.1|1597611_1597890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023861.1|1597905_1598403_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	70.7	3.2e-50
WP_109023860.1|1598392_1599214_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	89.7	6.0e-134
WP_109023859.1|1599206_1600025_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	98.5	4.8e-160
WP_109023858.1|1600021_1600276_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	100.0	2.6e-40
WP_109023857.1|1600403_1600586_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	83.3	2.2e-20
WP_109023866.1|1600664_1600937_-	hypothetical protein	NA	A0A1P8DTE8	Proteus_phage	64.6	1.1e-25
WP_109023856.1|1601296_1601512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023855.1|1601508_1601724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|1601732_1602050_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_036908285.1|1602483_1602849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|1602845_1603625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023854.1|1603659_1604343_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.7	3.0e-131
WP_004245989.1|1604425_1604635_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_004247478.1|1604780_1605128_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004251793.1|1605223_1605397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049213519.1|1605393_1606161_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_109023853.1|1606160_1607546_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_012367619.1|1607571_1608021_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	3.7e-13
WP_004245984.1|1608099_1608390_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1608386_1608743_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004247487.1|1608742_1609375_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004247148.1|1609685_1610207_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_036976679.1|1610365_1610788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1610841_1611111_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017628809.1|1611110_1611581_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|1611562_1611721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628808.1|1611723_1612185_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.1	1.8e-23
WP_017628807.1|1612473_1612899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628806.1|1613021_1613261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628805.1|1613578_1614130_-	YfbU family protein	NA	NA	NA	NA	NA
WP_017628804.1|1614194_1614797_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
WP_004245976.1|1614799_1616287_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.6	1.3e-264
WP_004245975.1|1616286_1617657_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	2.4e-119
WP_004245973.1|1617653_1618775_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	1.0e-104
WP_004245971.1|1618886_1619648_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.0e-67
WP_004245970.1|1619661_1620615_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|1620617_1620902_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004245968.1|1620941_1621421_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_004245967.1|1621423_1621774_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
WP_004245966.1|1621775_1622357_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_004245963.1|1622353_1622755_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1622800_1623457_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_004245960.1|1623508_1623814_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_049213761.1|1623828_1624116_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	9.0e-13
WP_004247508.1|1624144_1624351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145959338.1|1625060_1625597_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_049213757.1|1625575_1626232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213755.1|1626872_1627043_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	49.1	1.1e-05
WP_080974785.1|1627116_1627689_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	58.4	4.6e-32
WP_065424105.1|1627764_1628544_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	46.8	6.2e-48
1628194:1628209	attR	AAAGCAGAAAAAGAGA	NA	NA	NA	NA
WP_049201309.1|1628755_1629235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049201311.1|1629256_1629574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|1629717_1629951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023897.1|1630018_1632958_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	34.7	5.6e-142
WP_004247512.1|1632980_1633193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247513.1|1633232_1633523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245944.1|1633542_1633743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367642.1|1633886_1634228_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	48.2	7.7e-27
WP_004245940.1|1634224_1634968_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.4e-86
WP_004245939.1|1634964_1635675_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	64.6	4.4e-85
WP_004245938.1|1635671_1636259_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.9	1.4e-57
>prophage 117
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1641791	1642052	4104163		Proteus_phage(100.0%)	1	NA	NA
WP_004247524.1|1641791_1642052_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
>prophage 118
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1648634	1650687	4104163	tRNA	Proteus_phage(50.0%)	2	NA	NA
WP_012367652.1|1648634_1648775_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.5	7.2e-16
WP_012367653.1|1649019_1650687_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
>prophage 119
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1655038	1659197	4104163		Mycobacterium_phage(50.0%)	4	NA	NA
WP_017628481.1|1655038_1655824_-	esterase	NA	A0A1L5C1K3	Mycobacterium_phage	36.1	1.3e-05
WP_004244392.1|1656288_1656840_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_004252216.1|1656914_1658558_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_012367657.1|1658714_1659197_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.4	9.4e-39
>prophage 120
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1664611	1665766	4104163		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017628479.1|1664611_1665766_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	41.6	1.2e-60
>prophage 121
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1678383	1680150	4104163		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004244416.1|1678383_1680150_+	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.5	5.8e-17
>prophage 122
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1702215	1713995	4104163		Vibrio_phage(25.0%)	6	NA	NA
WP_036900878.1|1702215_1702935_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	34.0	8.3e-23
WP_004244442.1|1703178_1704237_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
WP_004244443.1|1704309_1705062_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004247554.1|1705412_1706879_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.6	7.9e-12
WP_017628474.1|1707054_1708614_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_017628473.1|1708628_1713995_+	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.9	6.2e-06
>prophage 123
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1719211	1723634	4104163		Planktothrix_phage(50.0%)	4	NA	NA
WP_004244454.1|1719211_1720276_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.7	6.3e-19
WP_012367674.1|1720340_1721162_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_012367675.1|1721310_1722300_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_017628469.1|1722356_1723634_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	3.8e-18
>prophage 124
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1731106	1732042	4104163		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628464.1|1731106_1732042_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	6.8e-25
>prophage 125
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1737994	1743191	4104163		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_017628462.1|1737994_1739764_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	4.1e-23
WP_004247573.1|1739784_1740771_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_004247574.1|1740788_1741487_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_017628461.1|1741796_1743191_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	2.9e-56
>prophage 126
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1753096	1757867	4104163		Bacillus_phage(33.33%)	4	NA	NA
WP_017628458.1|1753096_1755205_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	7.5e-48
WP_004244496.1|1755265_1755772_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	26.3	2.6e-07
WP_004244497.1|1756049_1756940_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004244498.1|1757288_1757867_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	37.1	4.5e-19
>prophage 127
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1763906	1764569	4104163		Vibrio_phage(100.0%)	1	NA	NA
WP_004244504.1|1763906_1764569_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.4	7.6e-55
>prophage 128
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1770897	1775754	4104163	tRNA	Catovirus(66.67%)	4	NA	NA
WP_017628455.1|1770897_1772925_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	6.0e-26
WP_004247590.1|1773129_1774242_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004247591.1|1774454_1775096_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_004244515.1|1775172_1775754_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
>prophage 129
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1779681	1787503	4104163	tRNA,transposase	Moraxella_phage(20.0%)	7	NA	NA
WP_004247594.1|1779681_1781262_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	3.8e-36
WP_053828334.1|1781433_1781850_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.6e-45
WP_053867585.1|1781872_1783081_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_004247595.1|1783254_1784661_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.7	8.6e-32
WP_004244520.1|1784780_1785278_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_017628450.1|1785591_1786743_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_012367689.1|1786885_1787503_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.6e-14
>prophage 130
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1793115	1797319	4104163		Cellulophaga_phage(50.0%)	4	NA	NA
WP_004244529.1|1793115_1794015_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	2.5e-08
WP_017628448.1|1794520_1795342_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244532.1|1795338_1795959_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004247605.1|1796116_1797319_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	50.1	4.0e-102
>prophage 131
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1804703	1810299	4104163		Vibrio_phage(33.33%)	8	NA	NA
WP_004244541.1|1804703_1804967_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
WP_064497114.1|1805137_1805440_+	YbjC family protein	NA	NA	NA	NA	NA
WP_012367695.1|1805610_1806114_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_012367696.1|1806142_1807276_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.5	3.5e-23
WP_004244548.1|1807418_1808087_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_004244549.1|1808086_1808791_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244550.1|1808821_1809556_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012367698.1|1809570_1810299_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
>prophage 132
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1816092	1897404	4104163	protease,tRNA,plate	Bacillus_phage(21.05%)	60	NA	NA
WP_017628445.1|1816092_1818036_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	6.5e-38
WP_004244557.1|1818198_1818408_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.4e-15
WP_004244558.1|1818697_1819012_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1819042_1821337_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1821456_1821675_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|1821994_1822687_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_064497115.1|1822688_1824440_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	6.8e-18
WP_017628444.1|1824442_1826212_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1826350_1827310_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1827852_1828347_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_058336139.1|1828474_1832350_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1832462_1833068_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1833078_1834428_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1834561_1835851_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1836030_1836363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|1836763_1837813_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1837885_1838791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1839148_1839889_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1839996_1842279_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1842333_1843188_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017628443.1|1843858_1845616_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1845843_1846881_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|1846955_1848224_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|1848360_1849791_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|1849927_1851016_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|1851212_1852499_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1852787_1853465_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_064497199.1|1853646_1855320_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1855384_1855672_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_155290605.1|1855728_1856001_+	ATP synthase subunit A	NA	NA	NA	NA	NA
WP_017628440.1|1856205_1858575_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1858611_1860357_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|1860353_1861355_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1861850_1862066_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1862480_1862660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1862664_1863426_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017628439.1|1863549_1864380_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1864759_1865533_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1865542_1866865_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1866845_1867577_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|1867573_1872031_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1872313_1872967_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1873372_1874086_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_049194798.1|1874435_1876151_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1876482_1877031_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1877080_1877731_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1877823_1878297_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1878387_1880124_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_064497434.1|1880110_1881472_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628436.1|1881509_1885058_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|1885060_1886524_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1886529_1887180_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1887181_1887970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|1887973_1890685_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1890693_1891449_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1891441_1892800_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1892801_1893353_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1893354_1894623_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|1894627_1895665_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|1895628_1897404_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 133
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1905035	1909736	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_063693455.1|1905035_1909736_+	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.9	3.0e-28
>prophage 134
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1916409	1916919	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_081000326.1|1916409_1916919_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.0	1.7e-14
>prophage 135
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1921082	1921634	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_071587364.1|1921082_1921634_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	63.3	3.2e-14
>prophage 136
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1926083	1933392	4104163	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_121909311.1|1926083_1927196_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	1.3e-96
WP_004244664.1|1927540_1928941_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	1.5e-81
WP_017827340.1|1929014_1929206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244666.1|1929220_1930435_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_017628415.1|1930776_1933392_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	5.7e-21
>prophage 137
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1940357	1942289	4104163		Tupanvirus(100.0%)	1	NA	NA
WP_175223878.1|1940357_1942289_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
>prophage 138
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1955946	1957998	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_017628409.1|1955946_1957998_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	2.3e-17
>prophage 139
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1962476	1965626	4104163		Indivirus(100.0%)	4	NA	NA
WP_004247010.1|1962476_1963421_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
WP_017628405.1|1963420_1963726_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004247012.1|1963870_1964767_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628404.1|1964822_1965626_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	39.1	1.8e-42
>prophage 140
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1970908	1972490	4104163		Morganella_phage(100.0%)	2	NA	NA
WP_004247021.1|1970908_1971121_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
WP_004247022.1|1971563_1972490_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	65.5	2.7e-98
>prophage 141
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1978885	1979531	4104163		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004247034.1|1978885_1979299_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
WP_004247035.1|1979345_1979531_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	52.5	1.4e-11
>prophage 142
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	1984049	2021419	4104163	tRNA,integrase,terminase,plate,holin,lysis,head	Burkholderia_phage(21.62%)	53	1978663:1978676	1988282:1988295
1978663:1978676	attL	CCATCAAAGAAAGT	NA	NA	NA	NA
WP_060557151.1|1984049_1985225_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	32.2	5.5e-32
WP_020945460.1|1985226_1985439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945461.1|1985853_1986024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895412.1|1986052_1986232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023899.1|1986279_1986780_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.2	1.7e-38
WP_109023900.1|1986779_1988744_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.2	2.0e-119
1988282:1988295	attR	CCATCAAAGAAAGT	NA	NA	NA	NA
WP_094941250.1|1988756_1989089_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.2e-05
WP_087726629.1|1989143_1989362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250527.1|1989691_1990450_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_087726628.1|1990554_1990812_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087726627.1|1990852_1991308_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	1.3e-29
WP_004250533.1|1991325_1991550_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_109023901.1|1991551_1992403_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	58.3	4.0e-32
WP_109023902.1|1992395_1992989_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	6.4e-45
WP_101495146.1|1992978_1994355_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_004250541.1|1994374_1994551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895390.1|1994553_1994787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219165.1|1994783_1995587_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	46.1	9.2e-63
WP_046335186.1|1995597_1995936_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.9	8.7e-31
WP_046335185.1|1996013_1996607_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	55.3	1.9e-57
WP_046335184.1|1996618_1996930_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	67.7	1.3e-33
WP_046335183.1|1996917_1997451_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	52.6	6.1e-39
WP_046335182.1|1997613_1997811_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	63.5	9.2e-09
WP_174821363.1|1997953_1999003_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	72.0	8.1e-144
WP_049221519.1|1999270_1999618_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_088207137.1|1999610_2000015_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	8.5e-25
WP_088207138.1|2000011_2000449_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.7	6.6e-23
WP_088207139.1|2000445_2000922_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088207140.1|2000911_2001409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207141.1|2001451_2001835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023903.1|2002224_2003244_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.6	1.1e-36
WP_109023904.1|2003442_2004840_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	1.6e-83
WP_088206688.1|2004843_2006346_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.0	6.0e-100
WP_049197370.1|2006383_2007097_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.6	7.9e-34
WP_109023905.1|2007093_2008353_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_049209851.1|2008352_2008850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|2008849_2009917_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_109023906.1|2009986_2010328_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	2.7e-08
WP_082151820.1|2010330_2010762_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	1.5e-11
WP_049256452.1|2010761_2011220_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.6	1.1e-12
WP_020945484.1|2011219_2011591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937870.1|2011577_2012093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895348.1|2012101_2013589_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	2.5e-82
WP_109023907.1|2013599_2014052_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	1.7e-21
WP_004250588.1|2014091_2014550_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_109023908.1|2014633_2016928_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.5	8.8e-18
WP_109023909.1|2016924_2017452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197348.1|2017451_2017769_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	2.5e-08
WP_109023910.1|2017734_2018550_+	hypothetical protein	NA	I7B2Q1	Escherichia_phage	27.1	2.9e-16
WP_109023911.1|2018552_2019245_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|2019241_2019586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023912.1|2019578_2020766_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.0	4.4e-69
WP_004250603.1|2020762_2021419_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
>prophage 143
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2026467	2033526	4104163		Vibrio_phage(50.0%)	7	NA	NA
WP_017628393.1|2026467_2027472_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	9.7e-86
WP_004247799.1|2027555_2027840_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004251887.1|2027980_2029744_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.2	3.1e-95
WP_004247801.1|2029938_2030643_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004247802.1|2030678_2031863_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.9	3.6e-23
WP_004247049.1|2032378_2032726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247050.1|2032911_2033526_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.9	2.0e-09
>prophage 144
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2038726	2039572	4104163		Catovirus(100.0%)	1	NA	NA
WP_004251877.1|2038726_2039572_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	9.4e-26
>prophage 145
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2044269	2046276	4104163		Acinetobacter_phage(100.0%)	1	NA	NA
WP_017628391.1|2044269_2046276_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	27.6	3.1e-11
>prophage 146
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2051920	2053570	4104163		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_017628389.1|2051920_2053570_-	alpha-keto acid decarboxylase family protein	NA	E4WLQ6	Ostreococcus_tauri_virus	22.1	2.0e-16
>prophage 147
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2070551	2071680	4104163		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004247085.1|2070551_2071286_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.2e-14
WP_004247087.1|2071443_2071680_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	1.5e-10
>prophage 148
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2075010	2075655	4104163		Erwinia_phage(100.0%)	1	NA	NA
WP_004247091.1|2075010_2075655_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.9	7.0e-21
>prophage 149
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2089473	2092373	4104163		Planktothrix_phage(50.0%)	3	NA	NA
WP_004247832.1|2089473_2090178_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.8	2.5e-32
WP_004247833.1|2090177_2091425_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004247834.1|2091515_2092373_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.9	1.9e-21
>prophage 150
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2097896	2136579	4104163	tRNA,protease,integrase,portal,terminase,tail,capsid,lysis,head	Morganella_phage(25.81%)	51	2098313:2098326	2105587:2105600
WP_004247115.1|2097896_2099267_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.2e-112
2098313:2098326	attL	CATTAGCTAAACCT	NA	NA	NA	NA
WP_017628382.1|2099299_2099929_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004247117.1|2099931_2101035_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|2101140_2101593_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|2101585_2102215_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|2102353_2103607_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_109023972.1|2103716_2104850_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.0	1.9e-154
WP_017628380.1|2104824_2105076_-	excisionase	NA	NA	NA	NA	NA
WP_109023973.1|2105161_2105686_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.6	1.3e-54
2105587:2105600	attR	CATTAGCTAAACCT	NA	NA	NA	NA
WP_017628378.1|2105964_2106597_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|2106697_2106904_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_036908083.1|2106941_2107418_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_109023975.1|2107679_2107859_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	1.5e-10
WP_006537200.1|2108416_2108932_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_109023976.1|2108953_2109760_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	61.7	4.4e-89
WP_109023977.1|2109756_2110782_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.5	1.9e-84
WP_004244725.1|2110809_2111208_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	2.7e-31
WP_004244726.1|2111547_2111760_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_023582443.1|2112091_2112550_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_109023979.1|2112897_2113539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023978.1|2113744_2114236_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109023980.1|2114491_2114908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023981.1|2115859_2117602_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109023982.1|2117667_2118528_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_109023983.1|2118742_2119165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|2119218_2119488_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017628809.1|2119487_2119958_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|2119939_2120098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023937.1|2120100_2120562_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.3	1.4e-23
WP_109023935.1|2121092_2121605_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	59.4	2.0e-55
WP_109023936.1|2121685_2122093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001967215.1|2122089_2122428_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_060556835.1|2122430_2122643_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	46.3	6.4e-08
WP_036905779.1|2122767_2123235_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_060555885.1|2123188_2124922_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.4	6.9e-148
WP_017628362.1|2124921_2126190_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|2126207_2126876_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|2126879_2128046_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|2128084_2128384_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|2128383_2128713_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|2128702_2129176_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|2129181_2129523_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|2129532_2130198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|2130262_2130679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|2130675_2130954_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|2130978_2131170_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|2131296_2134572_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|2134572_2135169_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|2135168_2135750_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|2135766_2136102_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|2136180_2136579_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
>prophage 151
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2141769	2144840	4104163		Escherichia_phage(50.0%)	2	NA	NA
WP_081041966.1|2141769_2144079_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
WP_049219712.1|2144639_2144840_+	hypothetical protein	NA	Q77Z09	Phage_21	92.6	3.3e-22
>prophage 152
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2149986	2153583	4104163		Phage_21(66.67%)	7	NA	NA
WP_004247902.1|2149986_2150151_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_017628191.1|2150545_2150683_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	90.7	4.9e-17
WP_017628190.1|2150835_2151168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628189.1|2151407_2151848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628188.1|2152028_2152364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628187.1|2152762_2153011_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_017827607.1|2153430_2153583_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	6.8e-20
>prophage 153
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2158276	2158489	4104163		Morganella_phage(100.0%)	1	NA	NA
WP_004247907.1|2158276_2158489_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
>prophage 154
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2164470	2166351	4104163		uncultured_marine_virus(50.0%)	2	NA	NA
WP_004247912.1|2164470_2165112_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_004251487.1|2165124_2166351_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
>prophage 155
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2170359	2180319	4104163		Morganella_phage(60.0%)	15	NA	NA
WP_004247917.1|2170359_2170536_+	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
WP_004242534.1|2171027_2171249_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|2171675_2171957_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_017628181.1|2172325_2172739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|2172766_2173009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247920.1|2173071_2173632_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|2174007_2174205_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|2174222_2174999_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|2175233_2175617_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004247922.1|2175759_2176623_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_017628180.1|2176749_2177181_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	37.4	5.1e-20
WP_017628179.1|2177354_2178092_+	phosphatase	NA	NA	NA	NA	NA
WP_004251474.1|2178178_2178727_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_004242555.1|2179178_2179574_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_004242557.1|2179884_2180319_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.5	7.7e-24
>prophage 156
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2183331	2183673	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004242565.1|2183331_2183673_+	YebY family protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	32.7	1.5e-06
>prophage 157
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2189527	2191588	4104163		Moraxella_phage(100.0%)	1	NA	NA
WP_004247931.1|2189527_2191588_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	9.2e-83
>prophage 158
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2198037	2198604	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_004242580.1|2198037_2198604_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.8	2.3e-07
>prophage 159
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2203154	2204042	4104163		Klosneuvirus(100.0%)	1	NA	NA
WP_004251467.1|2203154_2204042_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.2	1.4e-08
>prophage 160
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2210238	2223723	4104163	tRNA	Tupanvirus(62.5%)	13	NA	NA
WP_004242605.1|2210238_2212167_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	8.0e-129
WP_012367833.1|2212170_2212710_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	2.8e-15
WP_004242608.1|2212804_2213002_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004242609.1|2213045_2213402_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|2213502_2213550_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004242610.1|2213726_2214710_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	3.8e-34
WP_004247944.1|2214724_2217112_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004242612.1|2217116_2217413_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_004242613.1|2217695_2218730_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004242614.1|2218731_2219481_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.0	3.0e-07
WP_004247945.1|2219615_2220761_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	1.9e-37
WP_004242618.1|2220760_2221741_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.1	5.6e-38
WP_004242621.1|2221740_2223723_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	1.3e-20
>prophage 161
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2227171	2229245	4104163		Bacillus_phage(50.0%)	3	NA	NA
WP_017628170.1|2227171_2227663_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	40.5	9.1e-13
WP_017628169.1|2227740_2228760_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_004242629.1|2228876_2229245_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	37.4	4.6e-09
>prophage 162
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2246740	2247667	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080975004.1|2246740_2247667_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	65.7	7.5e-08
>prophage 163
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2255232	2256180	4104163		Tupanvirus(100.0%)	1	NA	NA
WP_004242665.1|2255232_2256180_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	1.7e-44
>prophage 164
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2259309	2266540	4104163		Pseudomonas_phage(33.33%)	8	NA	NA
WP_004242680.1|2259309_2260392_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	5.1e-08
WP_004247962.1|2260391_2261240_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004242688.1|2261217_2262033_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004242689.1|2262090_2262945_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	7.5e-47
WP_017628160.1|2262952_2263882_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_004247964.1|2263959_2264238_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004247966.1|2264234_2264759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628159.1|2264839_2266540_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.2	2.1e-32
>prophage 165
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2279110	2280841	4104163	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004242704.1|2279110_2280841_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	8.0e-88
>prophage 166
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2284486	2294364	4104163	tRNA	Tupanvirus(40.0%)	10	NA	NA
WP_017628156.1|2284486_2286049_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.5	4.2e-19
WP_017628155.1|2286385_2287360_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004242718.1|2287362_2288112_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	29.5	4.3e-14
WP_004242719.1|2288296_2288695_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_017628154.1|2288962_2290747_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	38.4	7.1e-07
WP_004247981.1|2290750_2291185_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004242729.1|2291213_2291969_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004242730.1|2292093_2292615_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.0	5.3e-11
WP_004242731.1|2292717_2293341_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004242732.1|2293353_2294364_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	6.9e-07
>prophage 167
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2298943	2303902	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_109023846.1|2298943_2303902_+	DUF4150 domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	50.0	4.0e-23
>prophage 168
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2307205	2313115	4104163	transposase	Macacine_betaherpesvirus(33.33%)	7	NA	NA
WP_080600918.1|2307205_2307394_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.0	2.5e-11
WP_017628149.1|2307474_2307792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242751.1|2308226_2308412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247983.1|2309251_2310037_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004242756.1|2310029_2310755_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	9.9e-16
WP_004242757.1|2310829_2311774_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_004242759.1|2311786_2313115_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	2.8e-16
>prophage 169
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2317163	2327016	4104163	tRNA	Cyanophage(33.33%)	8	NA	NA
WP_004242768.1|2317163_2318639_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.7	5.6e-82
WP_012367881.1|2319221_2319662_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004247986.1|2319663_2319996_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_004242773.1|2321178_2321523_-	RidA family protein	NA	NA	NA	NA	NA
WP_012367884.1|2321608_2323546_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	1.1e-85
WP_026090434.1|2323645_2324341_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004242776.1|2324431_2325025_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_064497435.1|2325327_2327016_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	5.5e-33
>prophage 170
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2333957	2334608	4104163		Bacillus_virus(100.0%)	1	NA	NA
WP_004242790.1|2333957_2334608_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.4	2.7e-20
>prophage 171
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2338253	2340933	4104163		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017628144.1|2338253_2339807_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.4e-06
WP_017628143.1|2339934_2340933_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	1.9e-62
>prophage 172
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2351331	2355228	4104163		Catovirus(100.0%)	1	NA	NA
WP_017628136.1|2351331_2355228_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.0	1.5e-57
>prophage 173
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2362337	2365360	4104163		Escherichia_phage(100.0%)	2	NA	NA
WP_064497436.1|2362337_2364734_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.1	4.0e-146
WP_004242832.1|2364730_2365360_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.1	3.2e-63
>prophage 174
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2373895	2379282	4104163	transposase	Bacillus_virus(25.0%)	4	NA	NA
WP_017628129.1|2373895_2375461_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.7	8.7e-41
WP_096043110.1|2375755_2376863_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	4.0e-40
WP_017628126.1|2376863_2377064_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	68.5	6.7e-15
WP_017628125.1|2377308_2379282_+	ATP-binding protein	NA	X5JAK5	Clostridium_phage	36.3	4.5e-79
>prophage 175
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2386336	2387329	4104163	integrase	Thermus_phage(100.0%)	1	2382991:2383005	2400240:2400254
2382991:2383005	attL	AAAGTAAAATGATTA	NA	NA	NA	NA
WP_004251263.1|2386336_2387329_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
WP_004251263.1|2386336_2387329_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
2400240:2400254	attR	AAAGTAAAATGATTA	NA	NA	NA	NA
>prophage 176
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2390469	2393226	4104163		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_026090432.1|2390469_2393226_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	6.4e-23
>prophage 177
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2398372	2408364	4104163		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|2398372_2400430_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_064497103.1|2400441_2402142_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|2402477_2403164_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|2403163_2403625_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|2403677_2404289_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|2404428_2405289_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|2405290_2405908_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|2405919_2408364_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 178
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2421544	2422408	4104163		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_004242916.1|2421544_2422408_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.4	2.7e-20
>prophage 179
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2435431	2440854	4104163		Mycobacterium_phage(50.0%)	4	NA	NA
WP_012367924.1|2435431_2436934_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.6	1.4e-32
WP_012367925.1|2437088_2437685_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012367926.1|2438118_2439123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628114.1|2439255_2440854_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	1.8e-57
>prophage 180
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2444057	2445242	4104163		Salmonella_phage(100.0%)	1	NA	NA
WP_017628113.1|2444057_2445242_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	1.2e-13
>prophage 181
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2493021	2494965	4104163		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_017628098.1|2493021_2494965_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	29.5	9.5e-05
>prophage 182
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2498949	2499549	4104163		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004243033.1|2498949_2499549_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	6.7e-42
>prophage 183
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2511837	2517066	4104163	protease	Salmonella_phage(33.33%)	4	NA	NA
WP_017628093.1|2511837_2512362_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	47.9	4.3e-37
WP_004243046.1|2512535_2515133_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.3	5.4e-88
WP_063073810.1|2515438_2515687_+	YciN family protein	NA	NA	NA	NA	NA
WP_004243049.1|2516019_2517066_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.9	1.7e-24
>prophage 184
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2524546	2527519	4104163		Acinetobacter_phage(100.0%)	3	NA	NA
WP_004248130.1|2524546_2525140_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	37.9	6.8e-31
WP_004243063.1|2525141_2526140_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	9.7e-54
WP_017628090.1|2526145_2527519_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.6	1.4e-39
>prophage 185
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2532749	2534534	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004248134.1|2532749_2534534_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.6	2.9e-16
>prophage 186
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2539469	2543527	4104163	tRNA	Salmonella_phage(50.0%)	5	NA	NA
WP_004243080.1|2539469_2540006_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.4	2.2e-20
WP_017628086.1|2540358_2540748_+	VOC family protein	NA	NA	NA	NA	NA
WP_004251042.1|2540836_2541139_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004243084.1|2541579_2542248_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004243086.1|2542606_2543527_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
>prophage 187
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2560851	2566821	4104163	tRNA	Planktothrix_phage(66.67%)	6	NA	NA
WP_004248150.1|2560851_2561853_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.1	5.8e-06
WP_004243110.1|2561842_2562652_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_004243111.1|2562860_2563649_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004243113.1|2563866_2564478_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_004243115.1|2564556_2565426_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004248155.1|2565546_2566821_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
>prophage 188
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2575862	2581340	4104163		Enterobacteria_phage(25.0%)	5	NA	NA
WP_004243141.1|2575862_2576888_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.1	1.7e-32
WP_004243142.1|2576897_2577800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004248166.1|2577919_2579137_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.0	1.5e-11
WP_004243144.1|2579439_2580594_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.6	2.5e-85
WP_004243145.1|2580683_2581340_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.2	3.2e-21
>prophage 189
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2591958	2597162	4104163		environmental_halophage(33.33%)	5	NA	NA
WP_017628080.1|2591958_2593200_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.6	1.3e-84
WP_004243162.1|2593206_2594514_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004243163.1|2594488_2595235_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.9	9.3e-09
WP_004243165.1|2595279_2596776_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004248176.1|2596793_2597162_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.7	1.5e-12
>prophage 190
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2603581	2608212	4104163		Hokovirus(50.0%)	3	NA	NA
WP_064497027.1|2603581_2605957_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.1	2.8e-176
WP_004243173.1|2606175_2607042_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004248179.1|2607162_2608212_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.3	4.7e-83
>prophage 191
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2615998	2616793	4104163		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004243181.1|2615998_2616793_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	6.8e-10
>prophage 192
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2624583	2625369	4104163		Cronobacter_phage(100.0%)	1	NA	NA
WP_012367995.1|2624583_2625369_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	65.2	2.2e-85
>prophage 193
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2630646	2632032	4104163		Morganella_phage(100.0%)	3	NA	NA
WP_004243203.1|2630646_2631084_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	2.7e-24
WP_004243204.1|2631150_2631489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243205.1|2631603_2632032_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.4e-22
>prophage 194
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2635571	2646510	4104163	holin	Rock_bream_iridovirus(25.0%)	8	NA	NA
WP_017628067.1|2635571_2636036_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	35.8	4.2e-20
WP_012368001.1|2636121_2637399_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_004250947.1|2637388_2638639_-	cytosine permease	NA	NA	NA	NA	NA
WP_064497026.1|2639025_2640693_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.5	1.6e-53
WP_004243216.1|2640738_2642214_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004248206.1|2642238_2642841_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004248207.1|2643050_2645093_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.6	1.2e-21
WP_012368002.1|2645352_2646510_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	29.7	2.4e-16
>prophage 195
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2652932	2656059	4104163		Morganella_phage(33.33%)	3	NA	NA
WP_012368005.1|2652932_2653268_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	46.7	3.5e-08
WP_004243227.1|2654065_2655073_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.5	1.1e-15
WP_004243228.1|2655069_2656059_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.8e-15
>prophage 196
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2670309	2671849	4104163		Planktothrix_phage(100.0%)	2	NA	NA
WP_049195210.1|2670309_2671146_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	3.7e-14
WP_004243243.1|2671135_2671849_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-23
>prophage 197
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2676940	2688107	4104163		Klebsiella_phage(20.0%)	10	NA	NA
WP_004243248.1|2676940_2677537_-	thymidine kinase	NA	A0A2K9V5L3	Klebsiella_phage	59.0	3.6e-56
WP_004243249.1|2678046_2678451_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004248222.1|2678680_2679688_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.7	1.9e-33
WP_004243251.1|2679943_2680849_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	1.9e-64
WP_012368013.1|2681030_2682050_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_004243253.1|2682172_2682664_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004243254.1|2682702_2683551_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	1.1e-13
WP_017628061.1|2683936_2684800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004248228.1|2685243_2686050_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004250914.1|2686139_2688107_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.8	8.3e-41
>prophage 198
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2693386	2694028	4104163		Tupanvirus(100.0%)	1	NA	NA
WP_017628058.1|2693386_2694028_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.0	7.4e-23
>prophage 199
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2709887	2710274	4104163		uncultured_virus(100.0%)	1	NA	NA
WP_004248250.1|2709887_2710274_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	72.4	2.2e-14
>prophage 200
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2713689	2715522	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_004243286.1|2713689_2715522_-	excinuclease ABC subunit UvrC	NA	U5J9C9	Bacillus_phage	34.8	2.4e-05
>prophage 201
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2725266	2730681	4104163		Xanthomonas_phage(25.0%)	7	NA	NA
WP_064497024.1|2725266_2725968_-	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	33.5	3.8e-20
WP_012368022.1|2726364_2727153_+	glucose 1-dehydrogenase	NA	H2EEJ0	Moumouvirus	25.9	5.7e-09
WP_017628047.1|2727251_2727806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243305.1|2727802_2728210_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_004243308.1|2728980_2729238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243309.1|2729345_2730038_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	46.6	1.1e-56
WP_004248260.1|2730057_2730681_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.8	9.1e-18
>prophage 202
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2734967	2741730	4104163		Caulobacter_phage(25.0%)	5	NA	NA
WP_004243319.1|2734967_2736020_-	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
WP_017628042.1|2736003_2736783_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.4e-31
WP_004250844.1|2737043_2738621_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243391.1|2738705_2740172_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_004243392.1|2740341_2741730_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
>prophage 203
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2759367	2760081	4104163		Synechococcus_phage(100.0%)	1	NA	NA
WP_004243413.1|2759367_2760081_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.6e-37
>prophage 204
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2766356	2766713	4104163		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004243423.1|2766356_2766713_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.3	1.7e-13
>prophage 205
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2771290	2775242	4104163		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_004243429.1|2771290_2772592_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	1.3e-61
WP_004248287.1|2772700_2773327_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004248288.1|2773558_2774599_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	3.0e-74
WP_004243435.1|2774612_2775242_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.1	2.8e-30
>prophage 206
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2784807	2786274	4104163		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004243443.1|2784807_2786274_-	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	30.0	3.7e-54
>prophage 207
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2794284	2797933	4104163	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_004243448.1|2794284_2795661_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	31.6	2.4e-34
WP_004243449.1|2795726_2796434_+	two-component system response regulator BaeR	NA	NA	NA	NA	NA
WP_004243450.1|2796553_2797933_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	82.1	2.7e-179
>prophage 208
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2808626	2814997	4104163		Rhizobium_phage(33.33%)	6	NA	NA
WP_017628032.1|2808626_2809511_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.8	4.3e-13
WP_004243466.1|2809641_2811111_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004243467.1|2812473_2812698_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	70.5	8.9e-16
WP_004248304.1|2812814_2813210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243469.1|2813307_2813490_-	YoaH family protein	NA	NA	NA	NA	NA
WP_017628031.1|2813602_2814997_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	39.6	3.6e-38
>prophage 209
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2819972	2821907	4104163		Morganella_phage(100.0%)	3	NA	NA
WP_004243477.1|2819972_2820416_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	2.5e-09
WP_012368048.1|2820524_2821343_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012368049.1|2821472_2821907_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.8	1.3e-26
>prophage 210
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2855972	2856959	4104163		Clostridium_phage(100.0%)	1	NA	NA
WP_004243530.1|2855972_2856959_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	39.1	3.6e-16
>prophage 211
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2871563	2877367	4104163		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_004243551.1|2871563_2871953_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	3.5e-07
WP_004243552.1|2872012_2873065_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	1.2e-06
WP_170827685.1|2873057_2873924_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_004243556.1|2873954_2875601_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	6.6e-07
WP_012368063.1|2875660_2877367_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	6.8e-15
>prophage 212
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2886827	2888406	4104163		Bacillus_virus(50.0%)	3	NA	NA
WP_004248352.1|2886827_2887526_-	MgtC family protein	NA	G3MA03	Bacillus_virus	47.0	3.3e-16
WP_004243572.1|2887890_2888085_-	protein DsrB	NA	NA	NA	NA	NA
WP_004243573.1|2888193_2888406_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
>prophage 213
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2893617	2896698	4104163		Escherichia_phage(100.0%)	1	NA	NA
WP_012368067.1|2893617_2896698_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.6	1.1e-07
>prophage 214
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2901070	2909825	4104163		Morganella_phage(20.0%)	7	NA	NA
WP_004243585.1|2901070_2902012_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	45.2	9.4e-67
WP_017628016.1|2902295_2903504_+	multidrug efflux MFS transporter MdtG	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	5.9e-05
WP_004250754.1|2903924_2905460_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.5	8.5e-158
WP_012368073.1|2906266_2907046_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_004243592.1|2907146_2907569_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.7	7.3e-11
WP_165469427.1|2907798_2908116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628015.1|2908247_2909825_-	YadA-like family protein	NA	A0A0B6VPC9	Edwardsiella_phage	46.4	3.9e-09
>prophage 215
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2922263	2942049	4104163	lysis,holin,plate	Escherichia_phage(20.0%)	22	NA	NA
WP_012368081.1|2922263_2924702_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2924713_2925331_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2925334_2926111_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2926226_2926769_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2927337_2927517_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_017628011.1|2928831_2929488_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|2929484_2930672_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2930664_2931009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2931005_2931698_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2931700_2932513_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2932481_2932802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2932814_2933303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628009.1|2933305_2935609_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|2935691_2936150_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2936209_2936662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2936672_2938160_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|2938168_2938681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|2938717_2939167_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2939163_2939568_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2939570_2939870_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2940250_2941066_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
WP_004243642.1|2941311_2942049_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	44.8	2.6e-56
>prophage 216
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2947892	2962702	4104163		Pseudomonas_phage(33.33%)	10	NA	NA
WP_017628005.1|2947892_2950721_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	24.3	1.7e-34
WP_036971114.1|2950921_2953555_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	1.4e-104
WP_004243650.1|2953739_2954477_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004250699.1|2954838_2957130_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.1	2.4e-305
WP_004248376.1|2957141_2958272_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	3.4e-172
WP_170827686.1|2958311_2958575_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	60.6	8.5e-18
WP_004243656.1|2958682_2958916_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_004248379.1|2959106_2960318_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004248380.1|2960422_2960965_-	membrane protein	NA	NA	NA	NA	NA
WP_004248382.1|2961247_2962702_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.5	6.5e-99
>prophage 217
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	2992461	2994291	4104163		Oenococcus_phage(100.0%)	1	NA	NA
WP_017627997.1|2992461_2994291_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	32.6	1.9e-15
>prophage 218
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3021954	3023472	4104163		Mollivirus(100.0%)	1	NA	NA
WP_004243730.1|3021954_3023472_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	2.0e-90
>prophage 219
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3030019	3031147	4104163		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_017627981.1|3030019_3031147_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.9	2.0e-23
>prophage 220
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3041041	3042127	4104163		Pandoravirus(100.0%)	1	NA	NA
WP_004243753.1|3041041_3042127_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.5	8.2e-91
>prophage 221
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3060727	3061030	4104163		Morganella_phage(100.0%)	1	NA	NA
WP_004243781.1|3060727_3061030_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	37.9	6.0e-07
>prophage 222
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3069093	3083604	4104163		Streptococcus_phage(33.33%)	13	NA	NA
WP_004248419.1|3069093_3071121_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.9	2.4e-144
WP_165469425.1|3071295_3072351_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004243796.1|3072573_3073344_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004248422.1|3073492_3074446_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	1.4e-73
WP_004243798.1|3074776_3075034_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004243799.1|3075177_3076905_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.4	1.9e-17
WP_004243800.1|3076954_3077464_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004243801.1|3077554_3078436_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.5	2.6e-58
WP_017627973.1|3078641_3079730_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	36.8	4.8e-30
WP_004243804.1|3079749_3080592_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004243805.1|3080591_3081425_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_004243806.1|3081424_3082456_-	thiosulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_004243807.1|3082707_3083604_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	32.9	5.5e-24
>prophage 223
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3090184	3091468	4104163	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004243819.1|3090184_3091468_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	24.9	3.2e-25
>prophage 224
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3095637	3096063	4104163		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_004243827.1|3095637_3096063_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	36.8	2.1e-18
>prophage 225
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3104473	3111069	4104163		Mycoplasma_phage(20.0%)	8	NA	NA
WP_004243837.1|3104473_3105769_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.6	2.5e-38
WP_004243841.1|3106049_3106244_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004243842.1|3106259_3106595_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_017627967.1|3106597_3108448_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.4	2.1e-102
WP_004243844.1|3108459_3108981_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004243846.1|3109029_3109353_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	6.3e-23
WP_004243847.1|3109443_3109830_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	5.4e-53
WP_004243849.1|3109854_3111069_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	9.4e-35
>prophage 226
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3116899	3118153	4104163		Aeromonas_phage(100.0%)	1	NA	NA
WP_004243862.1|3116899_3118153_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	9.2e-102
>prophage 227
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3121183	3131260	4104163		Bacillus_phage(50.0%)	5	NA	NA
WP_004248444.1|3121183_3122800_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.6	2.3e-97
WP_004243867.1|3122874_3124212_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	2.6e-09
WP_096043115.1|3124223_3125150_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004248446.1|3125233_3126682_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	5.4e-13
WP_017627961.1|3127369_3131260_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	7.7e-131
>prophage 228
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3139505	3147136	4104163	tRNA	Pandoravirus(25.0%)	9	NA	NA
WP_004248453.1|3139505_3140036_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
WP_004243886.1|3140348_3140609_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004243887.1|3140638_3141019_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243888.1|3141018_3141750_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_017627957.1|3141819_3142560_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243892.1|3142572_3143481_-	GTPase Era	NA	NA	NA	NA	NA
WP_004248457.1|3143477_3144158_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_017627956.1|3144353_3145325_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004243894.1|3145339_3147136_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
>prophage 229
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3151521	3154427	4104163		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	3	NA	NA
WP_004243902.1|3151521_3152877_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	2.3e-42
WP_004248459.1|3153028_3153412_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_026090412.1|3153746_3154427_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.6	1.9e-56
>prophage 230
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3159363	3163049	4104163		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004243915.1|3159363_3159846_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
WP_017627954.1|3160450_3160810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627953.1|3160893_3161307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627952.1|3161612_3163049_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	32.7	6.1e-49
>prophage 231
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3182992	3183571	4104163		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004243957.1|3182992_3183571_-	hypothetical protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	5.1e-31
>prophage 232
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3196477	3200389	4104163		Acinetobacter_phage(50.0%)	2	NA	NA
WP_004243977.1|3196477_3198517_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.4	4.8e-15
WP_004243978.1|3198754_3200389_-	sodium/sugar symporter	NA	A0A240F3J2	Aeromonas_phage	39.0	7.5e-88
>prophage 233
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3205403	3207811	4104163		Tupanvirus(50.0%)	2	NA	NA
WP_004248507.1|3205403_3206420_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	5.7e-86
WP_017627943.1|3206851_3207811_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	26.3	8.2e-18
>prophage 234
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3211299	3211545	4104163		Salmonella_phage(100.0%)	1	NA	NA
WP_012368173.1|3211299_3211545_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
>prophage 235
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3219820	3228410	4104163	tRNA	Lactobacillus_phage(20.0%)	8	NA	NA
WP_004244004.1|3219820_3220369_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|3220868_3221078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|3221385_3221595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244024.1|3222191_3223706_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_096043105.1|3223714_3224813_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004244029.1|3224984_3226718_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_004244030.1|3226727_3227435_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244032.1|3227468_3228410_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
>prophage 236
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3232100	3234977	4104163		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004248527.1|3232100_3234977_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	9.3e-267
>prophage 237
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3243097	3250001	4104163		Bacillus_phage(66.67%)	4	NA	NA
WP_012368220.1|3243097_3245170_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.8	6.5e-44
WP_012368221.1|3245172_3246537_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012368222.1|3246550_3248674_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	3.1e-41
WP_004248535.1|3248750_3250001_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.3e-103
>prophage 238
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3274198	3275626	4104163		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244077.1|3274198_3275626_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	3.2e-42
>prophage 239
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3287195	3287591	4104163		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017627934.1|3287195_3287591_-	8-oxo-dGTP diphosphatase MutT	NA	H6X3M3	Enterobacteria_phage	32.0	3.3e-05
>prophage 240
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3295009	3297499	4104163		uncultured_virus(100.0%)	1	NA	NA
WP_017627931.1|3295009_3297499_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	8.5e-99
>prophage 241
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3321274	3327000	4104163		Catovirus(50.0%)	3	NA	NA
WP_017627927.1|3321274_3323083_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.5	1.9e-47
WP_004244135.1|3323613_3324558_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_004244137.1|3325440_3327000_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.3	3.3e-08
>prophage 242
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3333441	3334117	4104163		Brucella_phage(50.0%)	2	NA	NA
WP_004244143.1|3333441_3333786_-	DNA-binding protein	NA	A0A141GEX5	Brucella_phage	38.8	3.7e-05
WP_017627925.1|3333775_3334117_-	addiction module killer protein	NA	A4JWV2	Burkholderia_virus	37.8	3.2e-09
>prophage 243
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3339024	3340179	4104163		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004244148.1|3339024_3340179_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.5	2.6e-127
>prophage 244
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3370736	3371492	4104163		Edwardsiella_phage(100.0%)	1	NA	NA
WP_036907548.1|3370736_3371492_+	trimeric autotransporter adhesin AipA	NA	A0A0B6VSQ9	Edwardsiella_phage	32.2	2.6e-06
>prophage 245
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3386015	3386771	4104163		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_017627908.1|3386015_3386771_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	2.3e-15
>prophage 246
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3406179	3408943	4104163		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_064497439.1|3406179_3407469_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.3	2.3e-172
WP_004244232.1|3407544_3407880_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	1.4e-20
WP_017627901.1|3408316_3408943_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	2.2e-11
>prophage 247
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3414435	3488160	4104163	tRNA,integrase,tail,capsid,holin,lysis	Morganella_phage(30.14%)	105	3435452:3435498	3483768:3483814
WP_046334694.1|3414435_3414723_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	78.2	2.3e-32
WP_046334695.1|3415248_3415437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334696.1|3416247_3416676_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	79.6	3.1e-57
WP_046334697.1|3416788_3417448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157742853.1|3417741_3418674_-	Abi family protein	NA	NA	NA	NA	NA
WP_036900254.1|3419202_3419571_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	66.0	2.8e-27
WP_052715531.1|3419637_3422868_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
WP_036918873.1|3422884_3423226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|3423225_3423399_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|3423570_3424083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043103.1|3425067_3427788_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_046334700.1|3427784_3428129_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_052715532.1|3428143_3428740_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_036900272.1|3428739_3428934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469419.1|3428933_3429107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|3429103_3429715_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036907509.1|3429711_3429921_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|3429917_3430097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334702.1|3430093_3430351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072052191.1|3430353_3430527_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080942627.1|3430519_3431461_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.0	3.3e-64
WP_046334703.1|3431457_3432291_-	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	46.1	1.4e-21
WP_036918890.1|3432303_3432699_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|3432698_3432896_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_046334704.1|3434076_3435288_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
3435452:3435498	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_159262450.1|3435672_3435903_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	1.5e-31
WP_165469418.1|3435942_3437349_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	53.7	3.4e-113
WP_165469417.1|3437365_3441055_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	65.2	0.0e+00
WP_064497275.1|3441054_3441621_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	75.2	7.7e-48
WP_017628781.1|3441557_3442277_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_036971552.1|3442280_3442979_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	84.1	4.8e-116
WP_064497276.1|3442975_3443305_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	70.6	2.1e-42
WP_165469416.1|3443344_3446683_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	49.3	1.1e-231
WP_165469415.1|3446751_3447297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109395729.1|3447323_3447734_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	37.0	1.7e-09
WP_165469414.1|3447789_3448122_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	80.9	8.5e-15
WP_096043092.1|3448241_3448409_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	46.3	4.0e-05
WP_165469413.1|3448389_3449238_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	43.7	7.7e-36
WP_165469412.1|3449234_3450077_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	63.1	3.1e-37
WP_165469411.1|3450145_3451093_-	trypsin-like peptidase domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	36.5	9.9e-32
WP_103004647.1|3451156_3451351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469410.1|3451347_3452043_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.1	5.8e-90
WP_063073751.1|3452092_3452848_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.2e-107
WP_070487015.1|3452912_3453281_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	6.4e-11
WP_096043087.1|3453277_3453649_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	1.1e-39
WP_004247766.1|3453650_3453992_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	9.4e-25
WP_165469409.1|3453991_3454390_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.0e-55
WP_004247764.1|3454447_3454621_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_060556621.1|3454630_3455725_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.5e-145
WP_165469408.1|3455737_3456187_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	5.7e-46
WP_165469407.1|3456186_3457464_-	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	69.6	2.9e-167
WP_064497286.1|3457467_3458397_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.0	4.1e-91
WP_165469406.1|3458347_3459703_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.9	1.2e-163
WP_060556615.1|3460971_3461397_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_049199098.1|3461413_3461596_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.1	8.2e-20
WP_162837558.1|3461588_3461750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049257606.1|3461792_3462056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497289.1|3462085_3462868_-	KilA-N domain-containing protein	NA	K7PH51	Enterobacterial_phage	42.9	4.2e-52
WP_064497290.1|3463328_3463697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469405.1|3463693_3464143_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.2	1.7e-50
WP_165469404.1|3464144_3464477_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	72.3	5.1e-36
WP_004918415.1|3464463_3464757_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3464753_3465143_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_165469403.1|3465453_3466209_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	47.8	1.1e-52
WP_165469402.1|3466205_3466397_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	93.7	3.0e-28
WP_165469401.1|3466386_3466752_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.0e-37
WP_063108505.1|3466748_3467039_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	80.0	4.3e-39
WP_060556914.1|3467150_3467375_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_159298380.1|3467371_3467815_-	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	94.6	3.8e-34
WP_064497299.1|3467824_3468094_-	DUF4752 family protein	NA	NA	NA	NA	NA
WP_064497300.1|3468210_3468504_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.9e-18
WP_064497301.1|3468490_3468712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124743780.1|3468711_3468978_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	48.9	3.3e-17
WP_124743781.1|3469009_3469213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124743782.1|3469213_3469549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469435.1|3469572_3470940_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	64.0	7.3e-161
WP_124743783.1|3470943_3471780_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	52.7	6.8e-61
WP_164484703.1|3471772_3471949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469400.1|3472044_3472386_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.0	7.9e-48
WP_004245989.1|3472541_3472751_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_017827443.1|3472833_3473517_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.7	3.0e-131
WP_036976933.1|3473666_3474491_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	2.1e-38
WP_124740953.1|3474644_3474851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|3474909_3475227_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_060557708.1|3475248_3475746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497310.1|3475947_3476139_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_165469462.1|3476192_3476348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064497311.1|3476355_3476610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081261671.1|3476642_3477077_+	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	72.0	3.9e-60
WP_064497312.1|3477076_3477298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064497313.1|3477294_3478221_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	65.9	7.5e-109
WP_081261670.1|3478217_3478916_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	58.7	3.5e-74
WP_064497314.1|3478905_3479445_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	79.5	2.0e-53
WP_175223886.1|3479495_3479669_+	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	100.0	1.3e-27
WP_064497315.1|3479671_3479986_+	hypothetical protein	NA	A0A1W5PTP2	Pseudoalteromonas_phage	34.3	5.6e-08
WP_064497316.1|3479985_3480255_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	55.1	1.8e-15
WP_064497317.1|3480247_3480739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064497318.1|3480897_3481263_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_063073713.1|3481266_3481620_+	DUF2591 family protein	NA	K7PH48	Enterobacterial_phage	33.9	8.8e-10
WP_063073712.1|3481609_3482155_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	61.5	1.8e-57
WP_064497319.1|3482590_3483748_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	4.0e-176
WP_017627899.1|3484036_3484909_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
3483768:3483814	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004244244.1|3484912_3485125_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|3485761_3486703_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|3486768_3488160_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 248
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3496531	3504540	4104163	protease	Planktothrix_phage(33.33%)	8	NA	NA
WP_004250296.1|3496531_3497218_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	4.6e-31
WP_012368271.1|3497188_3497818_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004244260.1|3497868_3498654_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.9	1.3e-05
WP_017627896.1|3498739_3499597_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004244263.1|3499636_3500560_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_026090402.1|3500562_3501084_+	NfeD family protein	NA	NA	NA	NA	NA
WP_004244266.1|3501049_3501451_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_017627895.1|3501585_3504540_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.5	2.6e-115
>prophage 249
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3517085	3518969	4104163		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004244279.1|3517085_3518969_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	2.4e-109
>prophage 250
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3544853	3545147	4104163		Morganella_phage(100.0%)	1	NA	NA
WP_012368285.1|3544853_3545147_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.0	3.7e-06
>prophage 251
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3569586	3584801	4104163	tRNA	uncultured_Mediterranean_phage(25.0%)	14	NA	NA
WP_017627877.1|3569586_3572151_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	2.8e-28
WP_004244343.1|3572216_3573206_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_004244344.1|3573880_3575005_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244345.1|3575158_3575785_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_004244347.1|3575778_3576543_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	2.1e-64
WP_004248688.1|3576520_3577573_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_004248690.1|3577572_3578055_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_017627876.1|3578056_3578803_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_026090399.1|3578842_3579133_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017627875.1|3579424_3580039_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	40.0	8.1e-27
WP_036895543.1|3580038_3581496_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.9	7.1e-37
WP_004244356.1|3581507_3582416_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_017627873.1|3582427_3583849_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012368298.1|3584069_3584801_-	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	27.8	1.5e-08
>prophage 252
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3589063	3589735	4104163		Vibrio_phage(100.0%)	1	NA	NA
WP_004250261.1|3589063_3589735_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A088FAQ4	Vibrio_phage	27.5	2.3e-14
>prophage 253
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3602092	3603124	4104163		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245446.1|3602092_3603124_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.5	3.2e-36
>prophage 254
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3610672	3616780	4104163		Mollivirus(33.33%)	4	NA	NA
WP_004250252.1|3610672_3611416_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.8	4.7e-13
WP_004245456.1|3611712_3612672_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_004248711.1|3612684_3616167_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.1	3.4e-202
WP_004245458.1|3616189_3616780_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	44.2	1.4e-31
>prophage 255
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3624763	3626387	4104163		Tupanvirus(50.0%)	2	NA	NA
WP_004245467.1|3624763_3625627_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	32.4	2.2e-06
WP_004248717.1|3625628_3626387_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.0	2.7e-24
>prophage 256
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3643138	3646199	4104163		Vibrio_phage(50.0%)	3	NA	NA
WP_004245492.1|3643138_3643984_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.8e-43
WP_004249505.1|3644075_3645443_+	LOG family protein	NA	NA	NA	NA	NA
WP_017628582.1|3645449_3646199_+	flap endonuclease Xni	NA	B6V2K6	Bacillus_phage	29.5	7.9e-16
>prophage 257
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3649388	3665678	4104163	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_017628581.1|3649388_3650603_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	32.1	3.8e-60
WP_004245500.1|3650605_3651049_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004245501.1|3651490_3652339_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.1	4.9e-14
WP_109023918.1|3652447_3653542_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_004245505.1|3654305_3655568_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	1.6e-13
WP_004249500.1|3655812_3657147_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_017628578.1|3657245_3659162_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.6	2.9e-22
WP_049195255.1|3659154_3662793_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	23.2	3.1e-09
WP_017628576.1|3662789_3665678_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.3	1.2e-72
>prophage 258
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3672055	3676156	4104163		Vibrio_phage(50.0%)	3	NA	NA
WP_004245521.1|3672055_3672907_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.5	2.4e-125
WP_004245522.1|3672938_3673823_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004249490.1|3673909_3676156_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.6	3.9e-10
>prophage 259
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3679549	3686965	4104163		Acidithiobacillus_phage(40.0%)	5	NA	NA
WP_004245527.1|3679549_3680251_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.6	4.3e-24
WP_004245528.1|3680378_3680831_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	5.2e-31
WP_004249488.1|3680830_3681400_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	53.3	7.2e-54
WP_017628571.1|3681515_3683870_+	DNA polymerase II	NA	B3GAM5	uncultured_virus	24.8	2.8e-27
WP_004249485.1|3684061_3686965_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.3	2.8e-21
>prophage 260
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3695110	3696794	4104163		Aeromonas_phage(50.0%)	2	NA	NA
WP_004245544.1|3695110_3695932_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A2R4ALY4	Aeromonas_phage	45.6	9.5e-07
WP_004245545.1|3696308_3696794_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	1.5e-31
>prophage 261
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3705071	3717948	4104163		Bacillus_virus(33.33%)	10	NA	NA
WP_036970408.1|3705071_3708029_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	28.6	3.8e-82
WP_109023949.1|3708062_3709958_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.1e-95
WP_004245556.1|3710065_3710656_-	esterase YqiA	NA	NA	NA	NA	NA
WP_004250217.1|3710659_3711499_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_004245558.1|3711730_3712360_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.6	4.3e-23
WP_004245559.1|3712573_3713971_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004249472.1|3714299_3715028_+	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	36.1	2.0e-24
WP_004245561.1|3715035_3716199_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.1	3.7e-89
WP_004249471.1|3716333_3717119_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004245565.1|3717294_3717948_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	2.3e-43
>prophage 262
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3721279	3722704	4104163		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004249466.1|3721279_3722704_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	8.7e-40
>prophage 263
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3727454	3728678	4104163		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_017628565.1|3727454_3728678_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.4	2.9e-92
>prophage 264
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3733425	3738915	4104163	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_004245584.1|3733425_3734448_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.9	3.5e-107
WP_001144069.1|3734790_3735006_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017628562.1|3735119_3736868_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	7.8e-75
WP_004245586.1|3737058_3738915_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	1.6e-33
>prophage 265
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3742459	3743098	4104163		Burkholderia_phage(100.0%)	1	NA	NA
WP_017628558.1|3742459_3743098_+	7-cyano-7-deazaguanine synthase	NA	A5A3S4	Burkholderia_phage	28.2	2.2e-11
>prophage 266
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3754443	3766805	4104163	protease	Caulobacter_phage(37.5%)	12	NA	NA
WP_017628548.1|3754443_3755964_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	4.7e-07
WP_004245601.1|3756119_3757688_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3758088_3758769_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3758865_3759441_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3759517_3760096_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3760163_3761189_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3761223_3761679_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_109023971.1|3761703_3762840_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|3762840_3763425_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3763817_3764963_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
WP_004245612.1|3764955_3765726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245613.1|3765728_3766805_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.1	8.9e-37
>prophage 267
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3772670	3775191	4104163	holin	Bodo_saltans_virus(33.33%)	3	NA	NA
WP_017628543.1|3772670_3773867_+	tetracycline efflux MFS transporter Tet(J)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	5.1e-09
WP_004249433.1|3774133_3774424_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	44.7	7.5e-15
WP_004245624.1|3774930_3775191_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	63.1	2.4e-25
>prophage 268
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3779993	3782369	4104163		Hokovirus(100.0%)	1	NA	NA
WP_017628540.1|3779993_3782369_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.5	2.3e-13
>prophage 269
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3787097	3787364	4104163		Pectobacterium_bacteriophage(100.0%)	1	NA	NA
WP_004249427.1|3787097_3787364_+	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	53.9	6.2e-16
>prophage 270
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3793633	3794956	4104163		Geobacillus_virus(100.0%)	1	NA	NA
WP_004245639.1|3793633_3794956_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.3	2.0e-78
>prophage 271
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3800610	3805047	4104163		Streptococcus_phage(25.0%)	5	NA	NA
WP_004249415.1|3800610_3802200_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	5.7e-32
WP_000854920.1|3802456_3803104_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	46.5	5.5e-42
WP_024015942.1|3803221_3803473_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	45.0	8.4e-07
WP_040132807.1|3803528_3804398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025587951.1|3804438_3805047_+	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	43.8	2.1e-35
>prophage 272
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3813099	3814820	4104163	integrase	Mycobacterium_phage(50.0%)	2	3812830:3812844	3814552:3814566
3812830:3812844	attL	CGTTCTCATTGTCAG	NA	NA	NA	NA
WP_063100060.1|3813099_3814059_-|integrase	integron integrase	integrase	W8EHC2	Mycobacterium_phage	26.8	4.1e-09
WP_000777554.1|3814346_3814820_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
3814552:3814566	attR	CTGACAATGAGAACG	NA	NA	NA	NA
>prophage 273
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3818418	3828969	4104163		Rhizobium_phage(33.33%)	13	NA	NA
WP_175223893.1|3818418_3820074_-	VWA domain-containing protein	NA	L7TNG1	Rhizobium_phage	30.6	1.4e-09
WP_032479263.1|3820143_3820584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027441.1|3820645_3821599_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_175223894.1|3821697_3822465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001959209.1|3822464_3823424_-	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	L7TKP0	Rhizobium_phage	35.0	1.1e-30
WP_175223895.1|3823633_3824650_-	YqaJ viral recombinase family protein	NA	U6C712	Ralstonia_phage	37.4	9.0e-07
WP_015066581.1|3824710_3824854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036063.1|3824936_3825755_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	53.5	2.3e-53
WP_012368368.1|3825834_3826254_-	single-stranded DNA-binding protein	NA	A0A0R6PHK0	Moraxella_phage	41.4	1.9e-19
WP_175223896.1|3826269_3826596_-	plasmid-related protein	NA	NA	NA	NA	NA
WP_025574392.1|3826963_3827566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025610722.1|3827707_3827887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025610721.1|3827997_3828969_+	ATP-binding protein	NA	Q677Q6	Lymphocystis_disease_virus	32.4	1.7e-18
>prophage 274
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3833362	3835039	4104163		Bacillus_phage(100.0%)	1	NA	NA
WP_025610717.1|3833362_3835039_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	22.2	6.1e-08
>prophage 275
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3847996	3920839	4104163	protease,integrase,transposase	uncultured_virus(18.18%)	57	3901748:3901762	3907824:3907838
WP_071237192.1|3847996_3848917_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	97.0	1.1e-173
WP_175223899.1|3848981_3849119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000076135.1|3849131_3850241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001901413.1|3850237_3852967_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000356586.1|3853531_3854470_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002026815.1|3854462_3855254_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_000180225.1|3855473_3855860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001901415.1|3855856_3856429_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_000647307.1|3856503_3857793_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_001901416.1|3857792_3858692_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000667167.1|3858675_3859302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433889.1|3859298_3859580_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001167483.1|3859868_3860456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033754.1|3860482_3861118_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000546513.1|3861104_3861665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661885.1|3861674_3863495_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000475921.1|3863543_3865694_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000494310.1|3865848_3868500_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.3	6.8e-46
WP_000205527.1|3868543_3870619_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_001167231.1|3870635_3873293_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001095580.1|3873292_3876919_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_000283752.1|3876934_3878698_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000687848.1|3878714_3882392_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000645939.1|3882410_3882995_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_001021937.1|3882991_3883591_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000617210.1|3883600_3884527_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000284113.1|3884595_3884910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196208.1|3884997_3885903_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	25.6	8.1e-07
WP_000182836.1|3886285_3886543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116661.1|3886541_3886991_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_001883756.1|3886998_3887268_+	hypothetical protein	NA	A0A218MNF2	uncultured_virus	76.3	9.3e-28
WP_001043260.1|3889696_3890512_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3890572_3891376_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3891375_3892212_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000214122.1|3893165_3894380_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3894596_3895481_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|3895511_3897005_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_081353079.1|3900232_3901420_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	34.6	3.7e-52
WP_005737822.1|3901447_3901732_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
3901748:3901762	attL	TATTAAATGTACGAT	NA	NA	NA	NA
WP_000348524.1|3903905_3904349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3904813_3905788_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001995600.1|3905790_3906060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218618.1|3906061_3907303_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.8	1.3e-76
WP_000211147.1|3907432_3909451_-	ATP-binding protein	NA	NA	NA	NA	NA
3907824:3907838	attR	ATCGTACATTTAATA	NA	NA	NA	NA
WP_000127615.1|3909596_3909785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036973667.1|3910223_3910316_-	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_004249304.1|3910685_3911222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628535.1|3911211_3912132_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_004245652.1|3912443_3912890_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017628534.1|3912858_3913269_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_017628533.1|3913398_3914412_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_017628532.1|3914528_3914792_-	DUF1435 family protein	NA	NA	NA	NA	NA
WP_004245658.1|3914975_3915518_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017628531.1|3915514_3917152_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_012368409.1|3917580_3919020_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_063693491.1|3919191_3920400_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	8.1e-188
WP_017628529.1|3920422_3920839_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	4.5e-45
>prophage 276
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3924163	3925408	4104163		Enterococcus_phage(100.0%)	1	NA	NA
WP_004245666.1|3924163_3925408_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	2.8e-87
>prophage 277
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3935324	3936128	4104163		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245678.1|3935324_3936128_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	8.4e-08
>prophage 278
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3966413	3968406	4104163		Vibrio_phage(50.0%)	2	NA	NA
WP_004245716.1|3966413_3968060_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	2.4e-190
WP_004249265.1|3968112_3968406_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	3.3e-10
>prophage 279
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	3996411	3998049	4104163		Hepacivirus(100.0%)	1	NA	NA
WP_165469442.1|3996411_3998049_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.4	2.2e-39
>prophage 280
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4003874	4013692	4104163		Vibrio_phage(25.0%)	9	NA	NA
WP_175223900.1|4003874_4005389_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	7.6e-10
WP_004245793.1|4005431_4006574_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_064497144.1|4006643_4007864_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_017628516.1|4007941_4009498_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.8	3.2e-35
WP_017628515.1|4009563_4010349_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004245797.1|4010388_4010982_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_036907348.1|4011045_4011438_-	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_004250150.1|4012156_4012819_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	31.8	1.8e-27
WP_012368460.1|4013080_4013692_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	33.8	3.0e-21
>prophage 281
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4019365	4020784	4104163		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245806.1|4019365_4020784_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.5	2.8e-46
>prophage 282
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4029763	4030558	4104163		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245819.1|4029763_4030558_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	2.2e-16
>prophage 283
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4058376	4061454	4104163		Leptospira_phage(100.0%)	1	NA	NA
WP_017628500.1|4058376_4061454_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	4.0e-58
>prophage 284
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4077198	4078473	4104163		Pandoravirus(100.0%)	1	NA	NA
WP_004249177.1|4077198_4078473_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.6e-19
>prophage 285
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4085990	4092118	4104163		Morganella_phage(25.0%)	6	NA	NA
WP_004245886.1|4085990_4086308_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004245887.1|4086441_4087485_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245888.1|4087601_4088381_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004250112.1|4088377_4089238_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245891.1|4089221_4090337_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_004245892.1|4090780_4092118_-	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
>prophage 286
NZ_CP053684	Proteus mirabilis strain MPE5139 chromosome, complete genome	4104163	4096069	4098611	4104163		Salmonella_phage(50.0%)	2	NA	NA
WP_004245896.1|4096069_4097479_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	3.3e-193
WP_004245898.1|4097519_4098611_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	4.5e-28
