The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	0	9529	4055965		Wolbachia_phage(33.33%)	10	NA	NA
WP_175216646.1|273_1542_+	O-antigen ligase RfaL	NA	NA	NA	NA	NA
WP_017826991.1|1534_2713_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_036919452.1|2709_3816_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063073832.1|3819_4821_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_063073831.1|4959_6087_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004246483.1|6236_6404_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004246485.1|6415_6652_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004249942.1|6899_7571_-	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	27.8	1.8e-19
WP_020946516.1|7878_9087_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	1.6e-47
WP_063073830.1|9070_9529_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	4.6e-51
>prophage 2
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	13467	13851	4055965		Escherichia_phage(100.0%)	1	NA	NA
WP_063073825.1|13467_13851_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	56.3	3.5e-28
>prophage 3
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	19604	27115	4055965		Bacillus_virus(33.33%)	7	NA	NA
WP_063073821.1|19604_22019_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	55.4	4.5e-12
WP_063073820.1|22039_23128_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004246506.1|23139_24243_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.1	3.8e-51
WP_063073819.1|24247_25648_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004246509.1|26370_26514_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004246510.1|26531_26891_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_012368639.1|26854_27115_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	3.5e-16
>prophage 4
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	55570	57433	4055965		Tupanvirus(100.0%)	1	NA	NA
WP_036919411.1|55570_57433_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
>prophage 5
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	60440	61403	4055965		Bacillus_phage(100.0%)	1	NA	NA
WP_020946490.1|60440_61403_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	8.7e-60
>prophage 6
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	74161	144412	4055965	protease,integrase,tRNA,transposase	Stx_converting_phage(10.0%)	60	86742:86758	138071:138087
WP_004246556.1|74161_74746_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004249797.1|74894_75299_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.3	1.4e-22
WP_012368617.1|75595_76261_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_004246560.1|76657_77314_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004246561.1|77727_78390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246562.1|78674_79313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246563.1|79337_79652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249799.1|79825_81739_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246565.1|81760_82435_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004249975.1|82619_83069_+	metal-binding protein	NA	NA	NA	NA	NA
WP_017628740.1|83163_84684_-	MFS transporter	NA	NA	NA	NA	NA
WP_017628741.1|84676_85780_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012368614.1|85901_86540_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246570.1|86632_88039_-	YfcC family protein	NA	NA	NA	NA	NA
86742:86758	attL	ACTTTACCTACCGCCAG	NA	NA	NA	NA
WP_063073812.1|88048_89182_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_012368613.1|90056_90869_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_017628742.1|90957_91245_+	YjeO family protein	NA	NA	NA	NA	NA
WP_004249808.1|91272_91677_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_017628743.1|91751_92879_-	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023843642.1|92943_93951_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017628744.1|93999_95691_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004249814.1|95703_96780_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.1e-26
WP_001353740.1|97708_97948_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|99444_99918_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|100012_100537_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_001206315.1|100594_101383_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001444089.1|101458_101956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|102016_102388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271300.1|102797_103175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251879.1|103405_105022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001243518.1|105022_106549_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001276994.1|106551_108219_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|108215_110324_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|110310_111132_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246586.1|111291_113118_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_004246587.1|113275_114649_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246588.1|114799_115216_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246589.1|115237_116620_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246591.1|116654_117518_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246592.1|117575_119117_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246594.1|119131_119665_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246595.1|119677_120148_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246596.1|120209_120449_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246597.1|120494_121319_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246598.1|121350_121728_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246599.1|122343_122970_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017628745.1|122966_124865_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004249871.1|125244_125685_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004246603.1|125784_126246_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004246604.1|126406_127399_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246605.1|127399_128857_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_017628746.1|128864_130364_-	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	38.0	3.0e-22
WP_004246607.1|130644_131571_+	ribokinase	NA	NA	NA	NA	NA
WP_012368605.1|131652_133050_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_004249867.1|133130_133817_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628596.1|139834_140572_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
138071:138087	attR	CTGGCGGTAGGTAAAGT	NA	NA	NA	NA
WP_017628597.1|140562_141981_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_012368603.1|141984_142677_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_017628598.1|142763_143132_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	4.2e-39
WP_063693479.1|143203_144412_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
>prophage 7
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	148533	213124	4055965	transposase,integrase,tRNA	Staphylococcus_phage(13.33%)	60	186192:186208	199321:199337
WP_004249862.1|148533_150492_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004249861.1|150859_151483_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_012368600.1|151600_152275_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_036895833.1|152362_152779_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	7.6e-45
WP_155290689.1|152801_153998_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.0	5.4e-184
WP_004246627.1|154058_155087_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004249859.1|155088_155799_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246629.1|155795_156470_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004249858.1|156514_157330_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_017628602.1|157411_158356_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_004249857.1|158510_159605_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_012368596.1|159657_160179_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_004246639.1|160759_161875_-	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
WP_017628603.1|161881_162415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628604.1|162398_162998_-	fimbrial assembly protein	NA	NA	NA	NA	NA
WP_017628605.1|162985_163810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628606.1|163926_166461_+	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_004249852.1|166794_167598_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004246647.1|167687_168245_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004249850.1|168600_170709_+	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_004246651.1|170782_171196_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_004246652.1|171223_172108_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004246655.1|172312_173932_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.7e-140
WP_004249849.1|174047_174749_-	pirin family protein	NA	NA	NA	NA	NA
WP_012368590.1|175900_177106_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004246659.1|177414_178914_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_004246660.1|178985_179318_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_004246661.1|179731_180166_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_017628608.1|180419_181760_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_004246663.1|181888_182638_+	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_012368588.1|182708_183455_-	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_004249995.1|183458_185501_-	oligopeptidase A	NA	NA	NA	NA	NA
WP_001218908.1|186134_187319_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
186192:186208	attL	CTTGCTGATGGCGGCGG	NA	NA	NA	NA
WP_119563495.1|188163_189117_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_169774393.1|189345_190150_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	4.4e-33
WP_000429836.1|192118_192553_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|192624_192975_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|192988_193264_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|193299_193722_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|193773_195468_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|195485_195848_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|195844_196081_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|196116_196785_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000179844.1|196859_198539_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|198541_199534_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
199321:199337	attR	CTTGCTGATGGCGGCGG	NA	NA	NA	NA
WP_000376623.1|199502_200003_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|200130_200970_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|200963_201311_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|201533_201986_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|202070_202703_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|202840_203671_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|203801_204356_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_014839980.1|205582_205999_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_014839979.1|206003_206522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|206521_207310_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049824851.1|207329_207800_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067855.1|207809_208514_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|208643_209459_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001038045.1|211181_211841_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_053409934.1|211933_213124_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
>prophage 8
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	244790	266140	4055965		uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_041707154.1|244790_246917_-	DEAD/DEAH box helicase	NA	G3MA40	Bacillus_virus	24.2	3.2e-06
WP_012368391.1|246931_253354_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.9	3.2e-65
WP_012368392.1|253546_258517_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.8	7.5e-14
WP_109828968.1|258519_261375_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.3	8.1e-29
WP_012368394.1|261509_262433_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012368395.1|262750_263050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368396.1|263137_264043_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	26.2	8.1e-07
WP_025441399.1|265276_266140_+	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	46.8	4.1e-61
>prophage 9
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	272727	322915	4055965	transposase,integrase	Salmonella_phage(33.33%)	45	276708:276724	290342:290358
WP_000214122.1|272727_273942_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|274158_275043_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|275967_276672_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
276708:276724	attL	CTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_046788546.1|276756_277158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344976.1|277166_280118_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|280120_280681_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|280806_281157_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|281359_282373_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|282539_283382_+	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_000050382.1|283477_284086_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|284143_284935_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|285196_286456_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|286548_287340_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|287509_287842_+	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_109023896.1|288743_289019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|289021_289813_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_000612791.1|291338_292202_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
290342:290358	attR	GGCACTGTTGCAAATAG	NA	NA	NA	NA
WP_175216651.1|292239_292452_+	GrpB family protein	NA	NA	NA	NA	NA
WP_001067855.1|292485_293190_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000820574.1|293340_296187_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|296257_296416_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001535681.1|296570_297389_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_000855064.1|297730_298204_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535682.1|298219_298696_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|298758_298980_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001390338.1|299142_299520_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094437.1|299566_299944_+	toxin	NA	NA	NA	NA	NA
WP_000761716.1|299940_300429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060589331.1|300358_300646_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001274561.1|300730_301576_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_017628609.1|302118_303153_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_004246668.1|304200_304521_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004246669.1|304660_305284_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_004246670.1|305373_306057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628610.1|306079_308575_+	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004249837.1|308588_310196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|310288_310966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628611.1|311055_311979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|312170_312440_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628612.1|312432_313371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628613.1|313370_316415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175216652.1|317684_319856_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004249011.1|319928_320447_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_053828396.1|321267_321684_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_063693206.1|321706_322915_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
>prophage 10
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	326697	329638	4055965		Vibrio_phage(50.0%)	2	NA	NA
WP_004246679.1|326697_328254_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	33.3	2.8e-07
WP_004246680.1|328267_329638_+	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	23.7	2.1e-06
>prophage 11
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	335594	337085	4055965		Aeromonas_phage(100.0%)	1	NA	NA
WP_004246686.1|335594_337085_+	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	26.6	2.9e-22
>prophage 12
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	340703	343487	4055965		Salmonella_phage(50.0%)	2	NA	NA
WP_063073865.1|340703_342683_+	acyltransferase	NA	C6ZR20	Salmonella_phage	27.8	6.0e-47
WP_004246695.1|342773_343487_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-17
>prophage 13
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	349121	352177	4055965		Escherichia_phage(100.0%)	2	NA	NA
WP_004246705.1|349121_349763_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	3.3e-63
WP_017628626.1|349759_352177_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.0	2.4e-138
>prophage 14
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	355552	358266	4055965		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_004246710.1|355552_356308_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.6e-16
WP_004246711.1|356309_357317_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_004246712.1|357303_358266_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.3	2.5e-51
>prophage 15
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	365149	365686	4055965		Escherichia_phage(100.0%)	1	NA	NA
WP_063073864.1|365149_365686_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	30.6	9.9e-13
>prophage 16
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	371283	372882	4055965		Planktothrix_phage(50.0%)	2	NA	NA
WP_004246731.1|371283_372093_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	2.4e-10
WP_004246732.1|372129_372882_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.6e-08
>prophage 17
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	400736	402095	4055965		Moraxella_phage(100.0%)	1	NA	NA
WP_004249062.1|400736_402095_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.4	3.5e-62
>prophage 18
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	419557	427401	4055965		Bacillus_phage(60.0%)	8	NA	NA
WP_017628645.1|419557_420397_-	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	65.7	8.3e-06
WP_017628646.1|420600_421335_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004246787.1|421349_422126_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	6.9e-15
WP_004249075.1|422156_423059_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004246789.1|423060_424020_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_017628647.1|424095_425136_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	36.0	1.2e-49
WP_175216654.1|425338_426679_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.2	2.0e-09
WP_004246792.1|426678_427401_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	8.3e-31
>prophage 19
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	436403	441234	4055965		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
WP_004249083.1|436403_437450_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.9	1.7e-08
WP_004246801.1|437629_439039_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004246802.1|439398_441234_+	ribosome-dependent GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.7	1.6e-22
>prophage 20
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	449825	451217	4055965		environmental_Halophage(100.0%)	1	NA	NA
WP_017628656.1|449825_451217_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	76.4	9.7e-52
>prophage 21
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	455603	458713	4055965		Bordetella_phage(50.0%)	3	NA	NA
WP_004246819.1|455603_457730_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.5	2.6e-11
WP_004246820.1|457759_458035_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004246821.1|458089_458713_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.2	1.0e-21
>prophage 22
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	478263	480241	4055965		Planktothrix_phage(50.0%)	2	NA	NA
WP_004246844.1|478263_479247_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.5e-17
WP_004250067.1|479239_480241_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.3e-18
>prophage 23
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	496400	504151	4055965		uncultured_virus(20.0%)	6	NA	NA
WP_012368519.1|496400_499199_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	9.0e-73
WP_004246867.1|499420_499939_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	7.1e-16
WP_004249106.1|500397_501021_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_004246869.1|501295_501868_+	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_004246870.1|502240_502816_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_004246871.1|502933_504151_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.4	7.2e-27
>prophage 24
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	510247	518031	4055965		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_017628668.1|510247_511792_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	53.3	2.2e-36
WP_012368515.1|511898_513626_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.0	1.7e-05
WP_012368514.1|514081_515773_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	1.0e-07
WP_012368513.1|516099_518031_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.7	2.1e-73
>prophage 25
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	525146	544404	4055965	transposase	uncultured_Caudovirales_phage(14.29%)	16	NA	NA
WP_017628670.1|525146_525539_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.3	1.8e-16
WP_004249124.1|525538_525907_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_004246894.1|525937_526231_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004246896.1|526358_526733_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004246897.1|526832_527303_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_012368509.1|527382_529497_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	4.7e-58
WP_004249692.1|529564_530749_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
WP_004246899.1|531021_531399_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_004246900.1|531406_531952_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	4.5e-13
WP_004246901.1|532097_532526_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004246903.1|532530_533232_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004246904.1|533559_534057_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004246905.1|534120_534486_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004246906.1|534838_538867_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	1.4e-21
WP_004246908.1|538989_543219_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.1e-66
WP_017628671.1|543411_544404_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	41.6	4.6e-48
>prophage 26
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	554575	558470	4055965		Sodalis_phage(50.0%)	4	NA	NA
WP_004246922.1|554575_554848_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.7	8.0e-19
WP_004246923.1|554862_555555_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004249142.1|555578_556868_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012368501.1|556880_558470_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	9.3e-67
>prophage 27
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	576902	580574	4055965		Dickeya_phage(100.0%)	1	NA	NA
WP_017628489.1|576902_580574_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.0	2.1e-21
>prophage 28
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	590284	595568	4055965		Shigella_phage(33.33%)	4	NA	NA
WP_004245906.1|590284_590896_+	repressor LexA	NA	U5P451	Shigella_phage	45.6	2.5e-12
WP_004245904.1|591084_591615_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_004249162.1|591956_592481_-	single-stranded DNA-binding protein SSB1	NA	I3PGW4	Xanthomonas_phage	67.0	7.6e-58
WP_004249165.1|592733_595568_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
>prophage 29
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	600333	602875	4055965		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_004245898.1|600333_601425_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	4.5e-28
WP_004245896.1|601465_602875_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	3.3e-193
>prophage 30
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	606826	612954	4055965		Sodalis_phage(25.0%)	6	NA	NA
WP_004245892.1|606826_608164_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
WP_004245891.1|608607_609723_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_004250112.1|609706_610567_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245888.1|610563_611343_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004245887.1|611459_612503_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245886.1|612636_612954_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
>prophage 31
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	620471	621746	4055965		Pandoravirus(100.0%)	1	NA	NA
WP_004249177.1|620471_621746_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.6e-19
>prophage 32
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	637490	640568	4055965		Leptospira_phage(100.0%)	1	NA	NA
WP_017628500.1|637490_640568_-	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.6	4.0e-58
>prophage 33
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	668388	669183	4055965		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245819.1|668388_669183_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	2.2e-16
>prophage 34
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	678162	679581	4055965		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245806.1|678162_679581_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.5	2.8e-46
>prophage 35
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	685254	695072	4055965		Apis_mellifera_filamentous_virus(25.0%)	9	NA	NA
WP_012368460.1|685254_685866_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	33.8	3.0e-21
WP_004250150.1|686127_686790_+	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	31.8	1.8e-27
WP_036907348.1|687508_687901_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_004245797.1|687964_688558_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_017628515.1|688597_689383_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_017628516.1|689448_691005_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.8	3.2e-35
WP_004245794.1|691082_692303_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_004245793.1|692372_693515_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004245792.1|693557_695072_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	7.6e-10
>prophage 36
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	700897	702535	4055965		Hepacivirus(100.0%)	1	NA	NA
WP_004249237.1|700897_702535_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.6	1.7e-39
>prophage 37
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	730540	732533	4055965		uncultured_virus(50.0%)	2	NA	NA
WP_004249265.1|730540_730834_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	3.3e-10
WP_004245716.1|730886_732533_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	2.4e-190
>prophage 38
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	762819	763623	4055965		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245678.1|762819_763623_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	8.4e-08
>prophage 39
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	773674	774919	4055965		Enterococcus_phage(100.0%)	1	NA	NA
WP_004245666.1|773674_774919_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	2.8e-87
>prophage 40
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	778243	779891	4055965	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_017628529.1|778243_778660_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	4.5e-45
WP_063693491.1|778682_779891_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	8.1e-188
>prophage 41
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	788766	790356	4055965		Streptococcus_phage(100.0%)	1	NA	NA
WP_004245645.1|788766_790356_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	5.7e-32
>prophage 42
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	796010	797333	4055965		Geobacillus_virus(100.0%)	1	NA	NA
WP_004245639.1|796010_797333_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.3	2.0e-78
>prophage 43
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	803602	803869	4055965		Pectobacterium_bacteriophage(100.0%)	1	NA	NA
WP_004249427.1|803602_803869_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	53.9	6.2e-16
>prophage 44
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	808597	810973	4055965		Hokovirus(100.0%)	1	NA	NA
WP_017628540.1|808597_810973_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.5	2.3e-13
>prophage 45
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	815775	818296	4055965	holin	Cronobacter_phage(33.33%)	3	NA	NA
WP_004245624.1|815775_816036_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	63.1	2.4e-25
WP_004249433.1|816542_816833_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	44.7	7.5e-15
WP_017628543.1|817099_818296_-	tetracycline efflux MFS transporter Tet(J)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	5.1e-09
>prophage 46
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	824161	836523	4055965	protease	Caulobacter_phage(37.5%)	12	NA	NA
WP_004245613.1|824161_825238_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.1	8.9e-37
WP_004245612.1|825240_826011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628546.1|826003_827149_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
WP_004250201.1|827541_828126_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628547.1|828126_829263_+	TerD family protein	NA	NA	NA	NA	NA
WP_004245607.1|829287_829743_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004245605.1|829777_830803_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|830870_831449_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|831525_832101_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_012368337.1|832197_832878_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245601.1|833278_834847_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_017628548.1|835002_836523_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	4.7e-07
>prophage 47
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	847868	848507	4055965		Burkholderia_phage(100.0%)	1	NA	NA
WP_017628558.1|847868_848507_-	7-cyano-7-deazaguanine synthase	NA	A5A3S4	Burkholderia_phage	28.2	2.2e-11
>prophage 48
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	852051	857541	4055965	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_004245586.1|852051_853908_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	1.6e-33
WP_017628562.1|854098_855847_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	7.8e-75
WP_001144069.1|855960_856176_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004245584.1|856518_857541_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.9	3.5e-107
>prophage 49
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	862288	863512	4055965		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_175216655.1|862288_863512_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.2	1.9e-91
>prophage 50
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	868262	869687	4055965		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004249466.1|868262_869687_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	8.7e-40
>prophage 51
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	873018	885895	4055965		Bacillus_virus(33.33%)	10	NA	NA
WP_004245565.1|873018_873672_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	2.3e-43
WP_004249471.1|873847_874633_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004245561.1|874767_875931_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.1	3.7e-89
WP_004249472.1|875938_876667_-	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	36.1	2.0e-24
WP_004245559.1|876995_878393_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004245558.1|878606_879236_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.6	4.3e-23
WP_004250217.1|879467_880307_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_004245556.1|880310_880901_+	esterase YqiA	NA	NA	NA	NA	NA
WP_063073859.1|881008_882904_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.8	8.7e-96
WP_049212329.1|882937_885895_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	28.6	3.8e-82
>prophage 52
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	894173	895857	4055965		Bacillus_phage(50.0%)	2	NA	NA
WP_004245545.1|894173_894659_+	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	1.5e-31
WP_004245544.1|895035_895857_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A2R4ALY4	Aeromonas_phage	45.6	9.5e-07
>prophage 53
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	904002	911418	4055965		Acidithiobacillus_phage(40.0%)	5	NA	NA
WP_004249485.1|904002_906906_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.3	2.8e-21
WP_017628571.1|907097_909452_-	DNA polymerase II	NA	B3GAM5	uncultured_virus	24.8	2.8e-27
WP_004249488.1|909567_910137_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	53.3	7.2e-54
WP_004245528.1|910136_910589_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	5.2e-31
WP_004245527.1|910716_911418_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.6	4.3e-24
>prophage 54
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	914811	918912	4055965		Hokovirus(50.0%)	3	NA	NA
WP_004249490.1|914811_917058_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.6	3.9e-10
WP_004245522.1|917144_918029_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004245521.1|918060_918912_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.5	2.4e-125
>prophage 55
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	925289	941579	4055965	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_017628576.1|925289_928178_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.3	1.2e-72
WP_049195255.1|928174_931813_+	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	23.2	3.1e-09
WP_017628578.1|931805_933722_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.6	2.9e-22
WP_004249500.1|933820_935155_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004245505.1|935399_936662_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	1.6e-13
WP_017628579.1|937425_938520_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_004245501.1|938628_939477_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.1	4.9e-14
WP_004245500.1|939918_940362_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_017628581.1|940364_941579_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	32.1	3.8e-60
>prophage 56
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	944768	947829	4055965		Bacillus_phage(50.0%)	3	NA	NA
WP_017628582.1|944768_945518_-	flap endonuclease Xni	NA	B6V2K6	Bacillus_phage	29.5	7.9e-16
WP_004249505.1|945524_946892_-	LOG family protein	NA	NA	NA	NA	NA
WP_004245492.1|946983_947829_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.8e-43
>prophage 57
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	964579	966203	4055965		Flavobacterium_phage(50.0%)	2	NA	NA
WP_004248717.1|964579_965338_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.0	2.7e-24
WP_004245467.1|965339_966203_+	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	32.4	2.2e-06
>prophage 58
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	974186	980294	4055965		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_004245458.1|974186_974777_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	44.2	1.4e-31
WP_004248711.1|974799_978282_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.1	3.4e-202
WP_004245456.1|978294_979254_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_004250252.1|979550_980294_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.8	4.7e-13
>prophage 59
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	987842	988874	4055965		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245446.1|987842_988874_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.5	3.2e-36
>prophage 60
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1001223	1001895	4055965		Vibrio_phage(100.0%)	1	NA	NA
WP_004250261.1|1001223_1001895_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A088FAQ4	Vibrio_phage	27.5	2.3e-14
>prophage 61
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1006157	1021372	4055965	tRNA	uncultured_Mediterranean_phage(25.0%)	14	NA	NA
WP_012368298.1|1006157_1006889_+	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	27.8	1.5e-08
WP_017627873.1|1007109_1008531_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_004244356.1|1008542_1009451_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_036895543.1|1009462_1010920_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.9	7.1e-37
WP_017627875.1|1010919_1011534_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	40.0	8.1e-27
WP_026090399.1|1011825_1012116_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017627876.1|1012155_1012902_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004248690.1|1012903_1013386_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_004248688.1|1013385_1014438_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_004244347.1|1014415_1015180_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	2.1e-64
WP_004244345.1|1015173_1015800_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_004244344.1|1015953_1017078_+	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244343.1|1017752_1018742_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_175216656.1|1018807_1021372_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.4	6.2e-28
>prophage 62
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1045811	1046105	4055965		Morganella_phage(100.0%)	1	NA	NA
WP_012368285.1|1045811_1046105_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.0	3.7e-06
>prophage 63
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1071989	1073873	4055965		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004244279.1|1071989_1073873_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	2.4e-109
>prophage 64
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1086427	1094436	4055965	protease	uncultured_virus(33.33%)	8	NA	NA
WP_017627895.1|1086427_1089382_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.5	2.6e-115
WP_004244266.1|1089516_1089918_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_026090402.1|1089883_1090405_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004244263.1|1090407_1091331_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_017627896.1|1091370_1092228_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004244260.1|1092313_1093099_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.9	1.3e-05
WP_012368271.1|1093149_1093779_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004250296.1|1093749_1094436_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	4.6e-31
>prophage 65
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1102807	1133229	4055965	integrase,tRNA	Morganella_phage(50.0%)	34	1107179:1107200	1127999:1128020
WP_004244247.1|1102807_1104199_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
WP_004244246.1|1104264_1105206_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244244.1|1105842_1106055_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_017627899.1|1106058_1106931_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
1107179:1107200	attL	GAATCCTGTAGGGCGTACCATT	NA	NA	NA	NA
WP_112843632.1|1107363_1108575_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_053828381.1|1108786_1109863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053828380.1|1110013_1110235_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.4	5.7e-07
WP_053828379.1|1110234_1110654_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.3	1.4e-38
WP_053828378.1|1110666_1111461_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	50.9	2.6e-25
WP_175216718.1|1111481_1112489_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	53.5	2.2e-77
WP_071843629.1|1112481_1112655_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_049257505.1|1112657_1112852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900274.1|1112848_1113058_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_175216657.1|1113054_1113666_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_162837557.1|1113662_1113836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175216658.1|1113835_1114021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175216659.1|1114020_1114617_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	3.8e-29
WP_175216660.1|1114631_1114976_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	8.2e-45
WP_175216661.1|1114972_1117720_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.5	3.4e-226
WP_175216662.1|1118039_1118477_+	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	58.8	5.1e-15
WP_175216663.1|1118551_1119064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|1119235_1119409_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036900256.1|1119408_1119750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175216664.1|1119766_1122997_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	41.9	1.2e-100
WP_036900254.1|1123063_1123432_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	66.0	2.8e-27
WP_157742853.1|1123959_1124892_+	Abi family protein	NA	NA	NA	NA	NA
WP_053828370.1|1125127_1125547_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	82.5	7.1e-59
WP_175216665.1|1126357_1126546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175216666.1|1127199_1127487_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	79.5	2.7e-33
WP_017627900.1|1128505_1129201_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
1127999:1128020	attR	GAATCCTGTAGGGCGTACCATT	NA	NA	NA	NA
WP_004244239.1|1129603_1130275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627901.1|1130465_1131092_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	2.2e-11
WP_004244232.1|1131528_1131864_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	1.4e-20
WP_026090403.1|1131939_1133229_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	4.6e-173
>prophage 66
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1152637	1153393	4055965		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_017627908.1|1152637_1153393_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	2.3e-15
>prophage 67
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1167916	1168672	4055965		Citrobacter_phage(100.0%)	1	NA	NA
WP_036907548.1|1167916_1168672_-	trimeric autotransporter adhesin AipA	NA	A0A2H4YFT7	Citrobacter_phage	36.7	6.7e-07
>prophage 68
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1199229	1200384	4055965		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004244148.1|1199229_1200384_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.5	2.6e-127
>prophage 69
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1205290	1205966	4055965		Burkholderia_virus(50.0%)	2	NA	NA
WP_017627925.1|1205290_1205632_+	addiction module killer protein	NA	A4JWV2	Burkholderia_virus	37.8	3.2e-09
WP_004244143.1|1205621_1205966_+	DNA-binding protein	NA	A0A141GEX5	Brucella_phage	38.8	3.7e-05
>prophage 70
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1212407	1218133	4055965		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_004244137.1|1212407_1213967_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.3	3.3e-08
WP_004244135.1|1214849_1215794_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_017627927.1|1216324_1218133_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.5	1.9e-47
>prophage 71
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1241908	1244398	4055965		uncultured_virus(100.0%)	1	NA	NA
WP_017627931.1|1241908_1244398_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	8.5e-99
>prophage 72
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1251816	1252212	4055965		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017627934.1|1251816_1252212_+	8-oxo-dGTP diphosphatase MutT	NA	H6X3M3	Enterobacteria_phage	32.0	3.3e-05
>prophage 73
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1263781	1265209	4055965		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244077.1|1263781_1265209_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	3.2e-42
>prophage 74
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1289405	1296309	4055965		Bacillus_phage(66.67%)	4	NA	NA
WP_004248535.1|1289405_1290656_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.3e-103
WP_175216668.1|1290732_1292856_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.5	9.0e-41
WP_063073765.1|1292869_1294234_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012368220.1|1294236_1296309_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.8	6.5e-44
>prophage 75
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1304429	1307306	4055965		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004248527.1|1304429_1307306_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	9.3e-267
>prophage 76
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1310996	1319586	4055965	tRNA	Brevibacillus_phage(20.0%)	8	NA	NA
WP_004244032.1|1310996_1311938_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
WP_004244030.1|1311971_1312679_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244029.1|1312688_1314422_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_096043105.1|1314593_1315691_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004244024.1|1315700_1317215_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_004244007.1|1317811_1318021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244005.1|1318328_1318538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|1319037_1319586_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
>prophage 77
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1327861	1328107	4055965		Salmonella_phage(100.0%)	1	NA	NA
WP_012368173.1|1327861_1328107_+	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
>prophage 78
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1331595	1334003	4055965		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_017627943.1|1331595_1332555_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	26.3	8.2e-18
WP_004248507.1|1332986_1334003_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	5.7e-86
>prophage 79
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1339017	1342929	4055965		Aeromonas_phage(50.0%)	2	NA	NA
WP_004243978.1|1339017_1340652_+	sodium/sugar symporter	NA	A0A240F3J2	Aeromonas_phage	39.0	7.5e-88
WP_004243977.1|1340889_1342929_+	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.4	4.8e-15
>prophage 80
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1355835	1356414	4055965		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004243957.1|1355835_1356414_+	hypothetical protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	5.1e-31
>prophage 81
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1373941	1377627	4055965		Mycobacterium_phage(50.0%)	4	NA	NA
WP_017627952.1|1373941_1375378_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	32.7	6.1e-49
WP_017627953.1|1375683_1376097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627954.1|1376180_1376540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243915.1|1377144_1377627_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
>prophage 82
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1382563	1385469	4055965		Canid_alphaherpesvirus(33.33%)	3	NA	NA
WP_026090412.1|1382563_1383244_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.6	1.9e-56
WP_004248459.1|1383578_1383962_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_004243902.1|1384113_1385469_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	2.3e-42
>prophage 83
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1389854	1397485	4055965	tRNA	Tupanvirus(25.0%)	9	NA	NA
WP_004243894.1|1389854_1391651_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_017627956.1|1391665_1392637_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004248457.1|1392832_1393513_+	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004243892.1|1393509_1394418_+	GTPase Era	NA	NA	NA	NA	NA
WP_017627957.1|1394430_1395171_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243888.1|1395240_1395972_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004243887.1|1395971_1396352_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243886.1|1396381_1396642_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004248453.1|1396954_1397485_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
>prophage 84
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1405731	1415808	4055965		Bacillus_phage(50.0%)	5	NA	NA
WP_017627961.1|1405731_1409622_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	7.7e-131
WP_004248446.1|1410309_1411758_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	5.4e-13
WP_096043115.1|1411841_1412768_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004243867.1|1412779_1414117_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	2.6e-09
WP_004248444.1|1414191_1415808_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.6	2.3e-97
>prophage 85
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1418838	1420092	4055965		Aeromonas_phage(100.0%)	1	NA	NA
WP_004243862.1|1418838_1420092_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	9.2e-102
>prophage 86
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1425922	1432518	4055965		Faustovirus(20.0%)	8	NA	NA
WP_004243849.1|1425922_1427137_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	9.4e-35
WP_004243847.1|1427161_1427548_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	5.4e-53
WP_004243846.1|1427638_1427962_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	6.3e-23
WP_004243844.1|1428010_1428532_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_017627967.1|1428543_1430394_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.4	2.1e-102
WP_004243842.1|1430396_1430732_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004243841.1|1430747_1430942_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004243837.1|1431222_1432518_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.6	2.5e-38
>prophage 87
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1440928	1441354	4055965		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_004243827.1|1440928_1441354_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	36.8	2.1e-18
>prophage 88
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1445523	1446807	4055965	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004243819.1|1445523_1446807_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	24.9	3.2e-25
>prophage 89
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1453387	1467898	4055965		Streptococcus_phage(33.33%)	13	NA	NA
WP_004243807.1|1453387_1454284_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	32.9	5.5e-24
WP_004243806.1|1454535_1455567_+	thiosulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_004243805.1|1455566_1456400_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_004243804.1|1456399_1457242_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_017627973.1|1457261_1458350_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	36.8	4.8e-30
WP_004243801.1|1458555_1459437_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.5	2.6e-58
WP_004243800.1|1459527_1460037_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_063073766.1|1460086_1461814_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.4	1.9e-17
WP_004243798.1|1461957_1462215_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004248422.1|1462545_1463499_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	1.4e-73
WP_004243796.1|1463647_1464418_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004243794.1|1464640_1465696_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004248419.1|1465870_1467898_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.9	2.4e-144
>prophage 90
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1475979	1476282	4055965		Morganella_phage(100.0%)	1	NA	NA
WP_004243781.1|1475979_1476282_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	37.9	6.0e-07
>prophage 91
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1494883	1495969	4055965		Pandoravirus(100.0%)	1	NA	NA
WP_004243753.1|1494883_1495969_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.5	8.2e-91
>prophage 92
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1505863	1506991	4055965		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_017627981.1|1505863_1506991_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.9	2.0e-23
>prophage 93
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1513538	1515056	4055965		Mollivirus(100.0%)	1	NA	NA
WP_004243730.1|1513538_1515056_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	2.0e-90
>prophage 94
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1543155	1544985	4055965		Oenococcus_phage(100.0%)	1	NA	NA
WP_017627997.1|1543155_1544985_+	SLC13 family permease	NA	Q6A201	Oenococcus_phage	32.6	1.9e-15
>prophage 95
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1574744	1589554	4055965		Pseudomonas_phage(33.33%)	10	NA	NA
WP_004248382.1|1574744_1576199_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.5	6.5e-99
WP_004248380.1|1576481_1577024_+	membrane protein	NA	NA	NA	NA	NA
WP_004248379.1|1577128_1578340_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004243656.1|1578530_1578764_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_170827686.1|1578871_1579135_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	60.6	8.5e-18
WP_004248376.1|1579174_1580305_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	3.4e-172
WP_004250699.1|1580316_1582608_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.1	2.4e-305
WP_004243650.1|1582969_1583707_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_036971114.1|1583891_1586525_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	1.4e-104
WP_017628005.1|1586725_1589554_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	24.3	1.7e-34
>prophage 96
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1595397	1615183	4055965	plate,lysis,holin	Burkholderia_phage(20.0%)	22	NA	NA
WP_004243642.1|1595397_1596135_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	44.8	2.6e-56
WP_004243640.1|1596380_1597196_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
WP_004248367.1|1597576_1597876_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_017628006.1|1597878_1598283_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_017628007.1|1598279_1598729_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_107033812.1|1598765_1599278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|1599286_1600774_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_012368088.1|1600784_1601237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|1601296_1601755_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_017628009.1|1601837_1604141_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004250719.1|1604143_1604632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|1604644_1604965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|1604933_1605746_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243621.1|1605748_1606441_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|1606437_1606782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628010.1|1606774_1607962_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_017628011.1|1607958_1608615_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628013.1|1609929_1610109_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243612.1|1610677_1611220_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_004243611.1|1611335_1612112_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243609.1|1612115_1612733_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_012368081.1|1612744_1615183_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 97
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1627621	1636376	4055965		Edwardsiella_phage(20.0%)	7	NA	NA
WP_017628015.1|1627621_1629199_+	YadA-like family protein	NA	A0A0B6VPC9	Edwardsiella_phage	46.4	3.9e-09
WP_004243593.1|1629330_1629648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243592.1|1629877_1630300_-	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.7	7.3e-11
WP_012368073.1|1630400_1631180_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_004250754.1|1631986_1633522_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.5	8.5e-158
WP_017628016.1|1633942_1635151_-	multidrug efflux MFS transporter MdtG	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	5.9e-05
WP_004243585.1|1635434_1636376_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	45.2	9.4e-67
>prophage 98
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1640748	1643829	4055965		Escherichia_phage(100.0%)	1	NA	NA
WP_012368067.1|1640748_1643829_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.6	1.1e-07
>prophage 99
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1649038	1650617	4055965		Morganella_phage(50.0%)	3	NA	NA
WP_004243573.1|1649038_1649251_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
WP_004243572.1|1649359_1649554_+	protein DsrB	NA	NA	NA	NA	NA
WP_004248352.1|1649918_1650617_+	MgtC family protein	NA	G3MA03	Bacillus_virus	47.0	3.3e-16
>prophage 100
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1660077	1665881	4055965		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_012368063.1|1660077_1661784_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	6.8e-15
WP_004243556.1|1661843_1663490_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	6.6e-07
WP_170827685.1|1663520_1664387_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_004243552.1|1664379_1665432_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	1.2e-06
WP_004243551.1|1665491_1665881_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	3.5e-07
>prophage 101
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1680591	1681578	4055965		Clostridium_phage(100.0%)	1	NA	NA
WP_004243530.1|1680591_1681578_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	39.1	3.6e-16
>prophage 102
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1715643	1717578	4055965		Morganella_phage(100.0%)	3	NA	NA
WP_012368049.1|1715643_1716078_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.8	1.3e-26
WP_012368048.1|1716207_1717026_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004243477.1|1717134_1717578_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	2.5e-09
>prophage 103
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1722553	1728924	4055965		Pandoravirus(33.33%)	6	NA	NA
WP_017628031.1|1722553_1723948_-	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	39.6	3.6e-38
WP_004243469.1|1724060_1724243_+	YoaH family protein	NA	NA	NA	NA	NA
WP_004248304.1|1724340_1724736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243467.1|1724852_1725077_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	70.5	8.9e-16
WP_004243466.1|1726439_1727909_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_017628032.1|1728039_1728924_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.8	4.3e-13
>prophage 104
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1739617	1743266	4055965	tRNA	Phage_TP(50.0%)	3	NA	NA
WP_004243450.1|1739617_1740997_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	82.1	2.7e-179
WP_004243449.1|1741116_1741824_-	two-component system response regulator BaeR	NA	NA	NA	NA	NA
WP_004243448.1|1741889_1743266_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	31.6	2.4e-34
>prophage 105
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1751276	1752743	4055965		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004243443.1|1751276_1752743_+	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	30.0	3.7e-54
>prophage 106
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1762308	1766260	4055965		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_004243435.1|1762308_1762938_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.1	2.8e-30
WP_004248288.1|1762951_1763992_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	3.0e-74
WP_004248287.1|1764223_1764850_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004243429.1|1764958_1766260_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	1.3e-61
>prophage 107
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1770837	1771194	4055965		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004243423.1|1770837_1771194_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.3	1.7e-13
>prophage 108
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1777469	1778183	4055965		Synechococcus_phage(100.0%)	1	NA	NA
WP_004243413.1|1777469_1778183_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.6e-37
>prophage 109
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1795820	1842423	4055965	tail,integrase,terminase,holin	Salmonella_phage(21.05%)	55	1800653:1800669	1838072:1838088
WP_004243392.1|1795820_1797209_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
WP_004243391.1|1797378_1798845_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_004250844.1|1798929_1800507_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1800653:1800669	attL	ATAAAAATAATTTCAAC	NA	NA	NA	NA
WP_104836508.1|1800726_1801923_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.4	3.1e-139
WP_004250849.1|1802118_1802316_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
WP_104836507.1|1802318_1802960_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	60.6	8.6e-72
WP_060555937.1|1802956_1803430_-	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.7	1.2e-70
WP_060555936.1|1803464_1804181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425471.1|1804250_1804784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836506.1|1804783_1805278_-	ASCH domain-containing protein	NA	A0A077KCB2	Edwardsiella_phage	26.4	2.9e-11
WP_104836505.1|1805277_1805562_-	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	90.4	2.0e-44
WP_004250861.1|1805598_1805793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250862.1|1805846_1806104_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_046334323.1|1806147_1807188_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.4	3.5e-99
WP_175216671.1|1807233_1808958_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	47.6	9.3e-113
WP_004243375.1|1808944_1809106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|1809354_1809963_-	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_064505757.1|1810040_1810319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243371.1|1810458_1810644_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_104836504.1|1810654_1811497_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
WP_004243368.1|1811496_1812222_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_046334325.1|1812468_1812882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836503.1|1812878_1813274_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.0	2.0e-34
WP_158660325.1|1813396_1813744_+	DUF2591 family protein	NA	NA	NA	NA	NA
WP_104836501.1|1813803_1814145_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.1	4.8e-29
WP_143475678.1|1814173_1814821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836499.1|1814866_1815436_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	48.1	2.0e-43
WP_175216672.1|1815435_1816920_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	9.5e-231
WP_004243356.1|1817104_1817317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175216673.1|1817326_1818991_+|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.9	1.7e-199
WP_004243354.1|1818987_1819302_+	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_046334336.1|1819331_1820009_+	peptidase	NA	T1SAP9	Salmonella_phage	64.3	4.0e-43
WP_004243350.1|1820024_1821005_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_104836494.1|1821063_1821495_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	2.5e-30
WP_020945807.1|1821503_1821845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945806.1|1821908_1822220_+	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	8.8e-14
WP_104836493.1|1822219_1822825_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	6.7e-66
WP_124740946.1|1822824_1825287_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
WP_124740947.1|1825270_1825759_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	4.6e-49
WP_175216674.1|1825758_1826307_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_124740948.1|1826309_1829393_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.9	1.4e-164
WP_124740949.1|1829392_1832764_+	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.2	2.6e-183
WP_124740950.1|1832775_1833075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243332.1|1833099_1833351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175216675.1|1833524_1835720_+	hypothetical protein	NA	A0A2P0QGN7	Salmonella_phage	48.1	1.3e-127
WP_175216676.1|1835835_1836690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175216677.1|1836836_1837271_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_124740919.1|1837260_1838187_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	85.4	2.8e-148
1838072:1838088	attR	ATAAAAATAATTTCAAC	NA	NA	NA	NA
WP_124740918.1|1838186_1838549_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	61.5	5.8e-33
WP_124740917.1|1838748_1839120_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_004243326.1|1839116_1839389_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_036936219.1|1839391_1839736_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.3	7.0e-44
WP_124740916.1|1839735_1840230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628042.1|1840607_1841387_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.4e-31
WP_004243319.1|1841370_1842423_+	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
>prophage 110
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1846709	1852125	4055965		Bacillus_virus(25.0%)	7	NA	NA
WP_004248260.1|1846709_1847333_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.8	9.1e-18
WP_004243309.1|1847352_1848045_-	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	46.6	1.1e-56
WP_004243308.1|1848152_1848410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243305.1|1849180_1849588_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_017628047.1|1849584_1850139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368022.1|1850237_1851026_-	glucose 1-dehydrogenase	NA	H2EEJ0	Moumouvirus	25.9	5.7e-09
WP_004243300.1|1851411_1852125_+	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	33.5	5.0e-20
>prophage 111
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1861869	1863702	4055965		Bacillus_phage(100.0%)	1	NA	NA
WP_004243286.1|1861869_1863702_+	excinuclease ABC subunit UvrC	NA	U5J9C9	Bacillus_phage	34.8	2.4e-05
>prophage 112
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1867117	1867504	4055965		uncultured_virus(100.0%)	1	NA	NA
WP_004248250.1|1867117_1867504_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	72.4	2.2e-14
>prophage 113
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1883701	1884343	4055965		Tupanvirus(100.0%)	1	NA	NA
WP_017628058.1|1883701_1884343_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.0	7.4e-23
>prophage 114
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1889622	1900830	4055965		Streptococcus_phage(20.0%)	10	NA	NA
WP_004250914.1|1889622_1891590_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.8	8.3e-41
WP_004248228.1|1891679_1892486_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017628061.1|1892929_1893793_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004243254.1|1894178_1895027_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	1.1e-13
WP_004243253.1|1895065_1895557_-	YchJ family protein	NA	NA	NA	NA	NA
WP_012368013.1|1895720_1896740_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_004243251.1|1896921_1897827_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	1.9e-64
WP_004248222.1|1898082_1899090_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.7	1.9e-33
WP_004243249.1|1899319_1899724_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004243248.1|1900233_1900830_+	thymidine kinase	NA	A0A2K9V5L3	Klebsiella_phage	59.0	3.6e-56
>prophage 115
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1905921	1907461	4055965		Planktothrix_phage(100.0%)	2	NA	NA
WP_004243243.1|1905921_1906635_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-23
WP_049195210.1|1906624_1907461_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	3.7e-14
>prophage 116
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1921711	1924838	4055965		Planktothrix_phage(33.33%)	3	NA	NA
WP_004243228.1|1921711_1922701_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.8e-15
WP_175216678.1|1922697_1923705_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.0	6.8e-15
WP_012368005.1|1924502_1924838_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	46.7	3.5e-08
>prophage 117
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1932597	1942119	4055965	holin	Vibrio_phage(33.33%)	7	NA	NA
WP_004248207.1|1932597_1934640_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.6	1.2e-21
WP_004248206.1|1934849_1935452_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004243216.1|1935476_1936952_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004250946.1|1936997_1938665_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.5	2.1e-53
WP_004250947.1|1939051_1940302_+	cytosine permease	NA	NA	NA	NA	NA
WP_012368001.1|1940291_1941569_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_017628067.1|1941654_1942119_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	35.8	4.2e-20
>prophage 118
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1945658	1947044	4055965		Morganella_phage(100.0%)	3	NA	NA
WP_004243205.1|1945658_1946087_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.4e-22
WP_004243204.1|1946201_1946540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243203.1|1946606_1947044_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	2.7e-24
>prophage 119
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1952321	1953107	4055965		Cronobacter_phage(100.0%)	1	NA	NA
WP_012367995.1|1952321_1953107_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	65.2	2.2e-85
>prophage 120
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1960897	1961692	4055965		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004243181.1|1960897_1961692_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	6.8e-10
>prophage 121
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1969478	1974109	4055965		Pandoravirus(50.0%)	3	NA	NA
WP_004248179.1|1969478_1970528_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.3	4.7e-83
WP_004243173.1|1970648_1971515_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004243172.1|1971733_1974109_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.2	3.3e-177
>prophage 122
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1980528	1985732	4055965		uncultured_virus(33.33%)	5	NA	NA
WP_004248176.1|1980528_1980897_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.7	1.5e-12
WP_004243165.1|1980914_1982411_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004243163.1|1982455_1983202_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.9	9.3e-09
WP_004243162.1|1983176_1984484_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_017628080.1|1984490_1985732_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.6	1.3e-84
>prophage 123
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	1996350	2001828	4055965		Orpheovirus(25.0%)	5	NA	NA
WP_004243145.1|1996350_1997007_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.2	3.2e-21
WP_004243144.1|1997096_1998251_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.6	2.5e-85
WP_004248166.1|1998553_1999771_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.0	1.5e-11
WP_004243142.1|1999890_2000793_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004243141.1|2000802_2001828_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.1	1.7e-32
>prophage 124
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2010869	2016839	4055965	tRNA	Planktothrix_phage(66.67%)	6	NA	NA
WP_004248155.1|2010869_2012144_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
WP_004243115.1|2012264_2013134_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004243113.1|2013212_2013824_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_004243111.1|2014041_2014830_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004243110.1|2015038_2015848_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_004248150.1|2015837_2016839_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.1	5.8e-06
>prophage 125
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2034163	2038221	4055965	tRNA	Escherichia_phage(50.0%)	5	NA	NA
WP_004243086.1|2034163_2035084_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
WP_004243084.1|2035442_2036111_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004251042.1|2036551_2036854_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_017628086.1|2036942_2037332_-	VOC family protein	NA	NA	NA	NA	NA
WP_004243080.1|2037684_2038221_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.4	2.2e-20
>prophage 126
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2043156	2044941	4055965		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004248134.1|2043156_2044941_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.6	2.9e-16
>prophage 127
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2050171	2053144	4055965		Acinetobacter_phage(100.0%)	3	NA	NA
WP_017628090.1|2050171_2051545_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.6	1.4e-39
WP_004243063.1|2051550_2052549_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	9.7e-54
WP_004248130.1|2052550_2053144_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	37.9	6.8e-31
>prophage 128
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2060624	2065853	4055965	protease	Bodo_saltans_virus(33.33%)	4	NA	NA
WP_004243049.1|2060624_2061671_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.9	1.7e-24
WP_063073810.1|2062003_2062252_-	YciN family protein	NA	NA	NA	NA	NA
WP_004243046.1|2062557_2065155_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.3	5.4e-88
WP_017628093.1|2065328_2065853_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	47.9	4.3e-37
>prophage 129
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2078141	2078741	4055965		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004243033.1|2078141_2078741_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	6.7e-42
>prophage 130
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2082725	2084669	4055965		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_017628098.1|2082725_2084669_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	29.5	9.5e-05
>prophage 131
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2134045	2135230	4055965		Salmonella_phage(100.0%)	1	NA	NA
WP_017628113.1|2134045_2135230_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	1.2e-13
>prophage 132
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2138433	2143856	4055965		Tupanvirus(50.0%)	4	NA	NA
WP_017628114.1|2138433_2140032_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	1.8e-57
WP_012367926.1|2140164_2141169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367925.1|2141602_2142199_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012367924.1|2142353_2143856_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.6	1.4e-32
>prophage 133
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2154666	2157741	4055965		Tupanvirus(50.0%)	3	NA	NA
WP_004248056.1|2154666_2156409_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.2	9.0e-39
WP_004242917.1|2156503_2156833_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004242916.1|2156877_2157741_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.4	2.7e-20
>prophage 134
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2170924	2180916	4055965		Escherichia_phage(66.67%)	8	NA	NA
WP_017628118.1|2170924_2173369_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
WP_004242892.1|2173380_2173998_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628119.1|2173999_2174860_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242890.1|2174999_2175611_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242888.1|2175663_2176125_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242887.1|2176124_2176811_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242886.1|2177146_2178847_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017628120.1|2178858_2180916_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
>prophage 135
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2186062	2188819	4055965		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_026090432.1|2186062_2188819_-	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	6.4e-23
>prophage 136
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2191959	2192952	4055965	integrase	Thermus_phage(100.0%)	1	2179035:2179049	2196284:2196298
2179035:2179049	attL	TAATCATTTTACTTT	NA	NA	NA	NA
WP_004251263.1|2191959_2192952_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
WP_004251263.1|2191959_2192952_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
2196284:2196298	attR	TAATCATTTTACTTT	NA	NA	NA	NA
>prophage 137
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2200006	2205389	4055965		Clostridium_phage(33.33%)	3	NA	NA
WP_017628125.1|2200006_2201980_-	ATP-binding protein	NA	X5JAK5	Clostridium_phage	36.3	4.5e-79
WP_017628126.1|2202224_2202425_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	68.5	6.7e-15
WP_017628129.1|2203823_2205389_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.7	8.7e-41
>prophage 138
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2213924	2216947	4055965		Escherichia_phage(100.0%)	2	NA	NA
WP_004242832.1|2213924_2214554_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.1	3.2e-63
WP_004248020.1|2214550_2216947_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.2	1.4e-146
>prophage 139
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2230941	2234838	4055965		Catovirus(100.0%)	1	NA	NA
WP_017628136.1|2230941_2234838_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.0	1.5e-57
>prophage 140
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2245236	2247916	4055965		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_017628143.1|2245236_2246235_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	1.9e-62
WP_017628144.1|2246362_2247916_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.4e-06
>prophage 141
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2251561	2252212	4055965		Bacillus_virus(100.0%)	1	NA	NA
WP_004242790.1|2251561_2252212_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.4	2.7e-20
>prophage 142
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2259153	2269007	4055965	tRNA	Staphylococcus_phage(33.33%)	9	NA	NA
WP_004242778.1|2259153_2260842_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	1.9e-33
WP_004242776.1|2261144_2261738_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_026090434.1|2261828_2262524_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012367884.1|2262623_2264561_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	1.1e-85
WP_004242773.1|2264646_2264991_+	RidA family protein	NA	NA	NA	NA	NA
WP_012367883.1|2265020_2265884_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004247986.1|2266174_2266507_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_012367881.1|2266508_2266949_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004242768.1|2267531_2269007_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.7	5.6e-82
>prophage 143
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2273055	2278965	4055965	transposase	Clostridium_phage(33.33%)	7	NA	NA
WP_004242759.1|2273055_2274384_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	2.8e-16
WP_004242757.1|2274396_2275341_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_004242756.1|2275415_2276141_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	9.9e-16
WP_004247983.1|2276133_2276919_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004242751.1|2277758_2277944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628149.1|2278378_2278696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600918.1|2278776_2278965_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.0	2.5e-11
>prophage 144
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2291805	2301683	4055965	tRNA	Tupanvirus(40.0%)	10	NA	NA
WP_004242732.1|2291805_2292816_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	6.9e-07
WP_004242731.1|2292828_2293452_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004242730.1|2293554_2294076_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.0	5.3e-11
WP_004242729.1|2294200_2294956_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004247981.1|2294984_2295419_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_017628154.1|2295422_2297207_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	38.4	7.1e-07
WP_004242719.1|2297474_2297873_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_004242718.1|2298057_2298807_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	29.5	4.3e-14
WP_017628155.1|2298809_2299784_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_017628156.1|2300120_2301683_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.5	4.2e-19
>prophage 145
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2305328	2307059	4055965	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004242704.1|2305328_2307059_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	8.0e-88
>prophage 146
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2319629	2326860	4055965		uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_017628159.1|2319629_2321330_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.2	2.1e-32
WP_004247966.1|2321410_2321935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247964.1|2321931_2322210_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_175216684.1|2322287_2323217_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_004242689.1|2323224_2324079_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	7.5e-47
WP_004242688.1|2324136_2324952_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004247962.1|2324929_2325778_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004242680.1|2325777_2326860_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	5.1e-08
>prophage 147
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2329989	2330937	4055965		Tupanvirus(100.0%)	1	NA	NA
WP_004242665.1|2329989_2330937_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	1.7e-44
>prophage 148
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2338502	2339429	4055965		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080975004.1|2338502_2339429_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	65.7	7.5e-08
>prophage 149
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2356924	2358998	4055965		Streptococcus_phage(50.0%)	3	NA	NA
WP_004242629.1|2356924_2357293_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	37.4	4.6e-09
WP_017628169.1|2357409_2358429_-	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_017628170.1|2358506_2358998_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	40.5	9.1e-13
>prophage 150
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2362446	2375931	4055965	tRNA	Tupanvirus(62.5%)	13	NA	NA
WP_004242621.1|2362446_2364429_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	1.3e-20
WP_004242618.1|2364428_2365409_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.1	5.6e-38
WP_004247945.1|2365408_2366554_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	1.9e-37
WP_004242614.1|2366688_2367438_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.0	3.0e-07
WP_004242613.1|2367439_2368474_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004242612.1|2368756_2369053_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_004247944.1|2369057_2371445_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004242610.1|2371459_2372443_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	3.8e-34
WP_120655563.1|2372619_2372667_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004242609.1|2372767_2373124_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004242608.1|2373167_2373365_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012367833.1|2373459_2373999_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	2.8e-15
WP_004242605.1|2374002_2375931_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	8.0e-129
>prophage 151
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2382128	2383016	4055965		Klosneuvirus(100.0%)	1	NA	NA
WP_004251467.1|2382128_2383016_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.2	1.4e-08
>prophage 152
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2387566	2388133	4055965		Bacillus_phage(100.0%)	1	NA	NA
WP_004242580.1|2387566_2388133_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.8	2.3e-07
>prophage 153
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2394582	2396643	4055965		Moraxella_phage(100.0%)	1	NA	NA
WP_004247931.1|2394582_2396643_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	9.2e-83
>prophage 154
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2402497	2402839	4055965		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004242565.1|2402497_2402839_-	YebY family protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	32.7	1.5e-06
>prophage 155
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2405851	2415811	4055965		Morganella_phage(60.0%)	15	NA	NA
WP_004242557.1|2405851_2406286_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.5	7.7e-24
WP_004242555.1|2406596_2406992_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_004251474.1|2407443_2407992_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_017628179.1|2408078_2408816_-	phosphatase	NA	NA	NA	NA	NA
WP_017628180.1|2408989_2409421_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	37.4	5.1e-20
WP_004247922.1|2409547_2410411_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004242548.1|2410553_2410937_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004242544.1|2411171_2411948_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242542.1|2411965_2412163_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_004247920.1|2412538_2413099_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004251481.1|2413161_2413404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628181.1|2413431_2413845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242536.1|2414213_2414495_-	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_004242534.1|2414921_2415143_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004247917.1|2415634_2415811_-	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
>prophage 156
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2419819	2421700	4055965		Streptococcus_phage(50.0%)	2	NA	NA
WP_004251487.1|2419819_2421046_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
WP_004247912.1|2421058_2421700_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
>prophage 157
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2427681	2427894	4055965		Morganella_phage(100.0%)	1	NA	NA
WP_004247907.1|2427681_2427894_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
>prophage 158
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2432587	2436184	4055965		Phage_21(66.67%)	7	NA	NA
WP_017827607.1|2432587_2432740_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	6.8e-20
WP_017628187.1|2433159_2433408_+	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_017628188.1|2433806_2434142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628189.1|2434322_2434763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628190.1|2435002_2435335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628191.1|2435487_2435625_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	90.7	4.9e-17
WP_004247902.1|2436019_2436184_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
>prophage 159
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2440445	2504530	4055965	transposase,integrase,protease,portal,lysis,terminase,tail,capsid,head	Enterobacteria_phage(23.53%)	74	2446136:2446152	2496039:2496055
WP_139208638.1|2440445_2441039_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	80.4	1.7e-77
WP_063073887.1|2441079_2441319_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	68.4	2.0e-21
WP_017827679.1|2441335_2441602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073888.1|2441598_2442285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049219065.1|2442284_2442617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073889.1|2442606_2445810_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	55.5	2.9e-277
WP_064971711.1|2445824_2446475_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	45.9	4.8e-46
2446136:2446152	attL	ATGAAAATAAAGCAGCA	NA	NA	NA	NA
WP_063073890.1|2446378_2447107_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	1.4e-89
WP_063073891.1|2447128_2447833_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.1	1.7e-65
WP_004247884.1|2447885_2448461_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	34.1	4.9e-18
WP_063073892.1|2448555_2448885_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	54.6	6.7e-28
WP_063073893.1|2448885_2451879_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	33.8	1.3e-109
WP_080591809.1|2451847_2452168_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	42.0	9.7e-16
WP_049202041.1|2452188_2452578_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	39.4	3.1e-16
WP_074153257.1|2452589_2453111_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.2e-65
WP_036973524.1|2453122_2453518_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_063073895.1|2453517_2454081_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_063073894.1|2454090_2454363_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
WP_049209887.1|2454374_2454716_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
WP_096058092.1|2454804_2456793_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	63.9	1.0e-248
WP_063073930.1|2456758_2458249_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	1.6e-190
WP_004247869.1|2458245_2458461_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_063073929.1|2458457_2460560_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.9	7.7e-295
WP_049209882.1|2460556_2461051_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.6	2.3e-48
WP_004247866.1|2461063_2461576_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	1.1e-58
WP_063073928.1|2462046_2462325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073927.1|2462391_2462967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073926.1|2463206_2463668_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.7	5.5e-12
WP_166465087.1|2463670_2463829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073925.1|2463810_2464281_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	4.0e-50
WP_063073924.1|2464280_2464550_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	46.7	7.4e-17
WP_063073923.1|2464700_2465090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073921.1|2465334_2466222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073920.1|2466495_2467518_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	68.3	1.2e-128
WP_049202017.1|2467819_2468026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247850.1|2468331_2468604_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_004247849.1|2468609_2468867_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012367807.1|2469021_2469282_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063073919.1|2469503_2469902_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	54.5	2.3e-30
WP_063073918.1|2469914_2470988_-	conserved phage C-terminal domain-containing protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	6.4e-27
WP_063073917.1|2471306_2471966_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.4	1.7e-46
WP_012367804.1|2472222_2472465_+	excisionase	NA	NA	NA	NA	NA
WP_063073916.1|2472445_2473573_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	59.0	4.1e-117
WP_049206744.1|2474471_2476589_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049206743.1|2476581_2477286_+	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_096043110.1|2477824_2478932_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	4.0e-40
WP_049219712.1|2479541_2479742_-	hypothetical protein	NA	Q77Z09	Phage_21	92.6	3.3e-22
WP_060555884.1|2480306_2482613_+	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
WP_049219717.1|2482666_2482915_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063073912.1|2483185_2483395_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_049219720.1|2487801_2488200_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
WP_049219722.1|2488278_2488614_-	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_017628351.1|2488630_2489212_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_017628352.1|2489211_2489808_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628353.1|2489808_2493084_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_004242485.1|2493210_2493402_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628354.1|2493426_2493705_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017628355.1|2493701_2494118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628356.1|2494182_2494848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628357.1|2494857_2495199_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_063073913.1|2495204_2495678_-	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.6	2.8e-11
WP_017628359.1|2495667_2495997_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628360.1|2495996_2496296_-|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
2496039:2496055	attR	TGCTGCTTTATTTTCAT	NA	NA	NA	NA
WP_017628361.1|2496334_2497501_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_004242476.1|2497504_2498173_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628362.1|2498190_2499459_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_017628363.1|2499458_2501192_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_006537822.1|2501145_2501613_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_006537823.1|2501735_2501948_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
WP_001967215.1|2501950_2502289_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905787.1|2503186_2503648_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_162837602.1|2503650_2503809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900946.1|2503790_2504261_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905789.1|2504260_2504530_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
>prophage 160
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2508834	2520102	4055965	integrase	Morganella_phage(46.15%)	14	2511067:2511081	2521742:2521756
WP_004247137.1|2508834_2509047_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_036908076.1|2509386_2509785_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
WP_036908077.1|2510288_2511368_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
2511067:2511081	attL	AAATTTAAAGCATTT	NA	NA	NA	NA
WP_036908078.1|2511667_2512693_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
WP_036908080.1|2512689_2513496_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
WP_052124643.1|2513517_2514033_-	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
WP_036908081.1|2514590_2514770_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_036908083.1|2515031_2515508_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_006537203.1|2515545_2515752_-	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_017628378.1|2515852_2516485_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_036908086.1|2516769_2517294_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
WP_017628380.1|2517379_2517631_+	excisionase	NA	NA	NA	NA	NA
WP_036908088.1|2517605_2518739_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	6.5e-155
WP_004251822.1|2518848_2520102_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
2521742:2521756	attR	AAATTTAAAGCATTT	NA	NA	NA	NA
>prophage 161
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2523188	2524559	4055965		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004247115.1|2523188_2524559_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.2e-112
>prophage 162
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2530082	2532982	4055965		Vibrio_phage(50.0%)	3	NA	NA
WP_004247834.1|2530082_2530940_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.9	1.9e-21
WP_004247833.1|2531030_2532278_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004247832.1|2532277_2532982_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.8	2.5e-32
>prophage 163
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2546800	2547445	4055965		Erwinia_phage(100.0%)	1	NA	NA
WP_004247091.1|2546800_2547445_-	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.9	7.0e-21
>prophage 164
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2550775	2551904	4055965		Ralstonia_phage(50.0%)	2	NA	NA
WP_004247087.1|2550775_2551012_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	1.5e-10
WP_004247085.1|2551169_2551904_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.2e-14
>prophage 165
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2568885	2570535	4055965		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_017628389.1|2568885_2570535_+	alpha-keto acid decarboxylase family protein	NA	E4WLQ6	Ostreococcus_tauri_virus	22.1	2.0e-16
>prophage 166
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2576179	2578186	4055965		Acinetobacter_phage(100.0%)	1	NA	NA
WP_017628391.1|2576179_2578186_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	27.6	3.1e-11
>prophage 167
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2582883	2583729	4055965		Catovirus(100.0%)	1	NA	NA
WP_004251877.1|2582883_2583729_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	9.4e-26
>prophage 168
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2588929	2595988	4055965		Vibrio_phage(50.0%)	7	NA	NA
WP_004247050.1|2588929_2589544_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.9	2.0e-09
WP_004247049.1|2589729_2590077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247802.1|2590592_2591777_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.9	3.6e-23
WP_004247801.1|2591812_2592517_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004251887.1|2592711_2594475_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.2	3.1e-95
WP_004247799.1|2594615_2594900_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_017628393.1|2594983_2595988_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	9.7e-86
>prophage 169
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2600911	2601557	4055965		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004247035.1|2600911_2601097_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	52.5	1.4e-11
WP_004247034.1|2601143_2601557_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
>prophage 170
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2607952	2609534	4055965		Morganella_phage(100.0%)	2	NA	NA
WP_004247022.1|2607952_2608879_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	65.5	2.7e-98
WP_004247021.1|2609321_2609534_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
>prophage 171
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2614816	2617966	4055965		Indivirus(100.0%)	4	NA	NA
WP_017628404.1|2614816_2615620_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	39.1	1.8e-42
WP_004247012.1|2615675_2616572_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017628405.1|2616716_2617022_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004247010.1|2617021_2617966_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
>prophage 172
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2622444	2624496	4055965		Bacillus_phage(100.0%)	1	NA	NA
WP_017628409.1|2622444_2624496_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	2.3e-17
>prophage 173
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2630743	2692469	4055965	protease,plate,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	51	NA	NA
WP_017628411.1|2630743_2632486_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_004244680.1|2632569_2633088_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_004244679.1|2633403_2633574_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004244678.1|2634062_2634467_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_017628412.1|2634554_2635127_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004244676.1|2635126_2636779_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_004244675.1|2636771_2638076_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_004244674.1|2638153_2640085_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
WP_004247681.1|2640091_2642206_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_049194712.1|2642315_2643458_+	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_012367736.1|2643724_2644276_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_004251935.1|2644490_2645501_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004247678.1|2645857_2646889_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_017628415.1|2647050_2649666_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	5.7e-21
WP_004244666.1|2650007_2651222_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_017827340.1|2651236_2651428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244664.1|2651501_2652902_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	1.5e-81
WP_121909311.1|2653246_2654359_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	1.3e-96
WP_004244662.1|2654711_2655902_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_156868377.1|2656033_2656189_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_049194410.1|2656326_2657289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244657.1|2658182_2658797_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_071587364.1|2658808_2659360_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	63.3	3.2e-14
WP_049195263.1|2659564_2659882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194413.1|2660131_2661049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155289805.1|2661121_2661271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247666.1|2661450_2662014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080974994.1|2662487_2663057_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_046335376.1|2663122_2663527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000326.1|2663523_2664033_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.0	1.7e-14
WP_049195076.1|2664903_2665314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964539.1|2666273_2666414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195253.1|2666575_2667043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335381.1|2667042_2667306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194460.1|2668112_2668568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894566.1|2669373_2669841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195080.1|2670067_2670679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693455.1|2670706_2675407_-	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.9	3.0e-28
WP_004251951.1|2675471_2675891_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_175216685.1|2675902_2678095_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004246976.1|2678178_2678697_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247653.1|2680594_2681095_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_063073902.1|2681115_2682594_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004244624.1|2682599_2683031_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_049194445.1|2683038_2684814_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_049194444.1|2684777_2685815_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004247648.1|2685819_2687088_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_063073901.1|2687089_2687641_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_026164596.1|2687642_2689001_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244617.1|2688993_2689749_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_175216686.1|2689757_2692469_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	4.2e-83
>prophage 174
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2707475	2708129	4055965		Escherichia_phage(100.0%)	1	NA	NA
WP_004247636.1|2707475_2708129_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
>prophage 175
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2720085	2725002	4055965		Bacillus_phage(66.67%)	4	NA	NA
WP_004244589.1|2720085_2721831_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_017628440.1|2721867_2724237_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_074153259.1|2724421_2724658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244587.1|2724714_2725002_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
>prophage 176
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2729370	2732026	4055965		Streptococcus_phage(50.0%)	2	NA	NA
WP_004244582.1|2729370_2730459_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628442.1|2730595_2732026_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
>prophage 177
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2738107	2741238	4055965		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004244576.1|2738107_2740390_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244575.1|2740497_2741238_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
>prophage 178
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2744535	2764282	4055965	protease,tRNA	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
WP_049195444.1|2744535_2745825_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.4e-97
WP_012367706.1|2745958_2747308_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244569.1|2747318_2747924_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_053828337.1|2748036_2751900_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244566.1|2752027_2752522_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004244564.1|2753064_2754024_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_017628444.1|2754162_2755932_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_063073899.1|2755934_2757686_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_012367702.1|2757687_2758380_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244560.1|2758699_2758918_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_175216687.1|2759037_2761332_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.0e-170
WP_004244558.1|2761362_2761677_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244557.1|2761966_2762176_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.4e-15
WP_017628445.1|2762338_2764282_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	6.5e-38
>prophage 179
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2770075	2775671	4055965		Planktothrix_phage(33.33%)	8	NA	NA
WP_012367698.1|2770075_2770804_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
WP_004244550.1|2770818_2771553_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004244549.1|2771583_2772288_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244548.1|2772287_2772956_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_012367696.1|2773098_2774232_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.5	3.5e-23
WP_012367695.1|2774260_2774764_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_004247610.1|2774934_2775237_-	YbjC family protein	NA	NA	NA	NA	NA
WP_004244541.1|2775407_2775671_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
>prophage 180
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2783055	2787259	4055965		Stx2-converting_phage(50.0%)	4	NA	NA
WP_004247605.1|2783055_2784258_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	50.1	4.0e-102
WP_004244532.1|2784415_2785036_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_017628448.1|2785032_2785854_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244529.1|2786359_2787259_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	2.5e-08
>prophage 181
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2792871	2800693	4055965	transposase,tRNA	Bodo_saltans_virus(20.0%)	7	NA	NA
WP_012367689.1|2792871_2793489_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.6e-14
WP_017628450.1|2793631_2794783_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_004244520.1|2795096_2795594_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004247595.1|2795713_2797120_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.7	8.6e-32
WP_053867585.1|2797293_2798502_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_053828334.1|2798524_2798941_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.6e-45
WP_004247594.1|2799112_2800693_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	3.8e-36
>prophage 182
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2804620	2809477	4055965	tRNA	Catovirus(66.67%)	4	NA	NA
WP_004244515.1|2804620_2805202_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
WP_004247591.1|2805278_2805920_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_004247590.1|2806132_2807245_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_017628455.1|2807449_2809477_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	6.0e-26
>prophage 183
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2815805	2816468	4055965		Vibrio_phage(100.0%)	1	NA	NA
WP_004244504.1|2815805_2816468_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.4	7.6e-55
>prophage 184
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2822507	2827278	4055965		Enterococcus_phage(33.33%)	4	NA	NA
WP_049195239.1|2822507_2823086_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.5	2.2e-18
WP_004244497.1|2823434_2824325_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004244496.1|2824602_2825109_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	26.3	2.6e-07
WP_017628458.1|2825169_2827278_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	7.5e-48
>prophage 185
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2837183	2842381	4055965		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_017628461.1|2837183_2838578_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	2.9e-56
WP_004247574.1|2838888_2839587_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_004247573.1|2839604_2840591_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_017628462.1|2840611_2842381_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	4.1e-23
>prophage 186
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2848333	2849269	4055965		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628464.1|2848333_2849269_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	6.8e-25
>prophage 187
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2856741	2861164	4055965		Klosneuvirus(50.0%)	4	NA	NA
WP_017628469.1|2856741_2858019_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	3.8e-18
WP_012367675.1|2858075_2859065_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_012367674.1|2859213_2860035_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_004244454.1|2860099_2861164_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.7	6.3e-19
>prophage 188
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2866380	2878160	4055965		Moraxella_phage(25.0%)	6	NA	NA
WP_096043113.1|2866380_2871747_-	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.9	6.2e-06
WP_017628474.1|2871761_2873321_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004247554.1|2873496_2874963_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.6	7.9e-12
WP_004244443.1|2875313_2876066_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004244442.1|2876138_2877197_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
WP_036900878.1|2877440_2878160_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	34.0	8.3e-23
>prophage 189
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2900224	2901991	4055965		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004244416.1|2900224_2901991_-	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.5	5.8e-17
>prophage 190
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2914608	2915760	4055965		Enterobacteria_phage(100.0%)	1	NA	NA
WP_063073869.1|2914608_2915760_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	41.6	1.2e-60
>prophage 191
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2921173	2925332	4055965		Enterobacteria_phage(50.0%)	4	NA	NA
WP_012367657.1|2921173_2921656_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.4	9.4e-39
WP_063073870.1|2921812_2923456_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_004244392.1|2923530_2924082_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_017628481.1|2924546_2925332_+	esterase	NA	A0A1L5C1K3	Mycobacterium_phage	36.1	1.3e-05
>prophage 192
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2929683	2983480	4055965	tail,integrase,tRNA,lysis	Proteus_phage(22.73%)	75	2931389:2931407	2983549:2983567
WP_012367653.1|2929683_2931351_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
2931389:2931407	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
WP_012367652.1|2931595_2931736_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.5	7.2e-16
WP_012367651.1|2932229_2932775_+	uroepithelial cell adherence major pilin UcaA	NA	NA	NA	NA	NA
WP_012367650.1|2932840_2933566_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_175216689.1|2933575_2936110_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017628485.1|2936119_2937202_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036919964.1|2937302_2937608_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247524.1|2938311_2938572_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_036905825.1|2938588_2938855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|2938851_2939538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|2939537_2939870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036976694.1|2943510_2944098_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	58.9	7.2e-57
WP_049195341.1|2944094_2944805_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_049195343.1|2944801_2945545_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.8	2.6e-88
WP_049195345.1|2945541_2945883_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004245944.1|2946026_2946227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195346.1|2946246_2946537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247512.1|2946576_2946789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195348.1|2946811_2949751_-|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	34.0	1.3e-133
WP_053089294.1|2949811_2950633_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
WP_049195350.1|2950758_2950992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064971710.1|2951059_2951332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195351.1|2951444_2951846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195353.1|2951998_2952388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049195354.1|2952552_2953389_+	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	59.6	1.3e-72
WP_049195202.1|2953660_2954149_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_049195199.1|2954705_2954993_-	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_049195198.1|2955007_2955313_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	8.7e-22
WP_004247505.1|2955364_2956021_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_049195195.1|2956066_2956468_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_049195193.1|2956464_2957046_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.5e-48
WP_004247502.1|2957047_2957398_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_012367632.1|2957400_2957880_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
WP_107033975.1|2957919_2958204_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004245970.1|2958206_2959160_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_036907977.1|2959173_2959935_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_012367629.1|2960046_2961168_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
WP_175216690.1|2961164_2962535_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	6.9e-119
WP_049195184.1|2962534_2964022_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.0e-264
WP_004247495.1|2964024_2964627_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_004245978.1|2964660_2964819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247494.1|2965018_2965603_-	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_049195183.1|2965950_2966412_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_004244729.1|2966414_2966573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827434.1|2966554_2967025_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_026164644.1|2967024_2967294_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_004247488.1|2967347_2967770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247148.1|2967928_2968450_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004245982.1|2968761_2969394_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004245983.1|2969393_2969750_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245984.1|2969746_2970037_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_049195179.1|2970115_2970565_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_046335275.1|2970590_2971976_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_049195176.1|2971975_2972743_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_004251793.1|2972739_2972913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195174.1|2973008_2973356_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.0	3.2e-36
WP_004245989.1|2973501_2973711_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_004245990.1|2973793_2974477_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	1.5e-130
WP_004245991.1|2974485_2974827_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004245992.1|2975064_2975586_+	hypothetical protein	NA	I6R9C4	Salmonella_phage	78.5	5.6e-61
WP_049195172.1|2976333_2976651_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	2.1e-18
WP_004245995.1|2976665_2976902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245996.1|2976873_2977155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245997.1|2977498_2977681_+	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
WP_004245998.1|2977808_2978063_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_004246000.1|2978059_2978878_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	97.1	3.5e-158
WP_036907946.1|2978870_2979677_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	94.3	3.9e-138
WP_153274246.1|2980182_2980344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334496.1|2980383_2980566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628829.1|2980850_2981303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628830.1|2981354_2981615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367596.1|2981772_2981949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247455.1|2981941_2982280_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_012367595.1|2982276_2982522_+	excisionase	NA	NA	NA	NA	NA
WP_049195171.1|2982478_2983480_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	2.8e-69
2983549:2983567	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 193
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2991132	2992245	4055965		Synechococcus_phage(100.0%)	1	NA	NA
WP_004246024.1|2991132_2992245_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	7.3e-34
>prophage 194
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	2996036	2997098	4055965		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004246031.1|2996036_2997098_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	2.5e-47
>prophage 195
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3000809	3001313	4055965		Streptomyces_phage(100.0%)	1	NA	NA
WP_004252236.1|3000809_3001313_-	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	36.8	9.3e-05
>prophage 196
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3007332	3011000	4055965	tRNA	Planktothrix_phage(50.0%)	2	NA	NA
WP_004246043.1|3007332_3008058_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.6e-29
WP_004247439.1|3008417_3011000_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.8e-189
>prophage 197
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3018275	3031328	4055965		Mycobacterium_phage(22.22%)	14	NA	NA
WP_058336147.1|3018275_3019241_+	endolytic peptidoglycan transglycosylase RlpA	NA	H2BCY4	Synechococcus_phage	45.5	1.9e-06
WP_004246054.1|3019367_3020579_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_026090527.1|3020777_3021041_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|3021398_3022043_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|3022144_3023110_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|3023125_3023500_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_162492994.1|3024243_3024384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246068.1|3024568_3024778_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|3024975_3025449_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|3025730_3025955_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|3025966_3026371_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004252248.1|3026399_3028526_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_012367584.1|3028551_3029520_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004246075.1|3030128_3031328_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 198
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3058840	3061417	4055965		Cronobacter_phage(100.0%)	1	NA	NA
WP_004244758.1|3058840_3061417_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.0	5.8e-127
>prophage 199
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3069654	3070743	4055965		Klebsiella_phage(100.0%)	1	NA	NA
WP_170832182.1|3069654_3070743_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	51.7	7.7e-89
>prophage 200
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3080627	3086243	4055965	tRNA	Vibrio_phage(25.0%)	4	NA	NA
WP_004244778.1|3080627_3080816_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	63.2	1.3e-12
WP_004247402.1|3081033_3083661_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.1	5.8e-82
WP_004247401.1|3084561_3085629_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	1.8e-114
WP_017628346.1|3085736_3086243_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	44.0	1.0e-27
>prophage 201
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3090397	3092766	4055965		Streptococcus_phage(100.0%)	2	NA	NA
WP_004244786.1|3090397_3091651_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.9	1.6e-98
WP_004247396.1|3091662_3092766_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	9.7e-63
>prophage 202
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3111368	3111947	4055965		Caulobacter_phage(100.0%)	1	NA	NA
WP_004244807.1|3111368_3111947_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.5e-14
>prophage 203
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3126515	3127109	4055965		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_004244829.1|3126515_3127109_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.0	6.2e-16
>prophage 204
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3133911	3135901	4055965	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_004244838.1|3133911_3134982_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
WP_004247373.1|3135652_3135901_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
>prophage 205
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3152276	3154439	4055965		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_017628323.1|3152276_3154439_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
>prophage 206
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3185609	3187349	4055965		Bacillus_phage(100.0%)	1	NA	NA
WP_004252439.1|3185609_3187349_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	1.4e-28
>prophage 207
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3195622	3195946	4055965		Morganella_phage(100.0%)	1	NA	NA
WP_004244917.1|3195622_3195946_-	transcriptional regulator MrpJ	NA	A0A1W6JNW5	Morganella_phage	55.3	1.6e-05
>prophage 208
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3203736	3205191	4055965		Escherichia_phage(50.0%)	2	NA	NA
WP_004247323.1|3203736_3204303_+	phase variation DNA invertase MrpI	NA	A0A2L1IV36	Escherichia_phage	52.4	2.0e-51
WP_170827682.1|3204867_3205191_-	helix-turn-helix domain-containing protein	NA	A0A1W6JNW5	Morganella_phage	41.8	1.1e-06
>prophage 209
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3216127	3218131	4055965	holin	Vibrio_phage(100.0%)	1	NA	NA
WP_004244946.1|3216127_3218131_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.0	8.0e-23
>prophage 210
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3222098	3222311	4055965		Enterococcus_phage(100.0%)	1	NA	NA
WP_004244951.1|3222098_3222311_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	62.2	1.0e-05
>prophage 211
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3232375	3233392	4055965		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628302.1|3232375_3233392_-	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	34.1	2.1e-35
>prophage 212
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3239944	3246690	4055965		Indivirus(25.0%)	7	NA	NA
WP_004247305.1|3239944_3240739_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.2	1.5e-12
WP_036894287.1|3240738_3241821_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_017628297.1|3242447_3243206_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	1.2e-40
WP_004244975.1|3243271_3243751_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	1.2e-49
WP_004247298.1|3243775_3244489_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017628296.1|3244526_3245282_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004244978.1|3245355_3246690_+	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	37.4	1.8e-07
>prophage 213
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3250303	3253307	4055965		Streptococcus_phage(50.0%)	2	NA	NA
WP_004244982.1|3250303_3251605_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.2	6.8e-132
WP_004244983.1|3251669_3253307_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	9.7e-152
>prophage 214
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3257022	3258348	4055965		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244987.1|3257022_3258348_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	7.8e-35
>prophage 215
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3262167	3262512	4055965		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004244992.1|3262167_3262512_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	2.0e-27
>prophage 216
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3266619	3272559	4055965		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_017628292.1|3266619_3269049_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.7	5.8e-44
WP_004244997.1|3269134_3269845_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004244998.1|3270041_3270497_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004244999.1|3270558_3270888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071524519.1|3270975_3272559_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.3	7.4e-24
>prophage 217
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3282506	3283547	4055965		Bacillus_virus(100.0%)	1	NA	NA
WP_004245012.1|3282506_3283547_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-31
>prophage 218
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3290110	3290407	4055965		Morganella_phage(100.0%)	1	NA	NA
WP_004245017.1|3290110_3290407_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.4	1.4e-05
>prophage 219
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3297634	3306864	4055965	transposase	Salmonella_phage(20.0%)	9	NA	NA
WP_063693470.1|3297634_3298843_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	4.3e-189
WP_053828325.1|3298865_3299282_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.2e-42
WP_004245034.1|3299622_3299805_-	DUF2526 family protein	NA	NA	NA	NA	NA
WP_017628285.1|3299893_3301123_-	MFS transporter	NA	NA	NA	NA	NA
WP_004245036.1|3301312_3302083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004245037.1|3302079_3303021_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	2.7e-21
WP_004245038.1|3303869_3304523_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004245039.1|3304582_3305125_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.3	1.7e-15
WP_004245040.1|3305283_3306864_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	53.2	3.6e-18
>prophage 220
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3328018	3330774	4055965		Bacteriophage(50.0%)	2	NA	NA
WP_017628277.1|3328018_3329995_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.8	2.3e-46
WP_012367485.1|3330222_3330774_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	9.5e-27
>prophage 221
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3345547	3350440	4055965		Bacillus_phage(66.67%)	4	NA	NA
WP_017628273.1|3345547_3347335_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.4e-42
WP_004247232.1|3347321_3349067_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.4e-54
WP_004245080.1|3349122_3349584_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004245081.1|3349741_3350440_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.2	5.3e-83
>prophage 222
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3354427	3359576	4055965	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_004247229.1|3354427_3354703_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	6.0e-22
WP_017628270.1|3354924_3357279_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	8.8e-223
WP_004245087.1|3357536_3358808_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	7.3e-131
WP_004245088.1|3358952_3359576_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
>prophage 223
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3364360	3365734	4055965		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004247225.1|3364360_3365734_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.4	8.6e-61
>prophage 224
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3382727	3384236	4055965		Staphylococcus_phage(100.0%)	1	NA	NA
WP_017628266.1|3382727_3384236_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	7.9e-15
>prophage 225
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3391277	3398158	4055965	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
WP_004245137.1|3391277_3391748_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.6e-30
WP_012367467.1|3391960_3393118_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.8e-51
WP_004245139.1|3393166_3393616_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_004247209.1|3393734_3394703_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	2.0e-48
WP_012367466.1|3394713_3396561_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004245142.1|3396593_3396929_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.9e-10
WP_004245143.1|3397015_3398158_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	4.2e-93
>prophage 226
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3417872	3425054	4055965		Bacillus_phage(66.67%)	4	NA	NA
WP_004245160.1|3417872_3419165_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.5	3.4e-27
WP_004249004.1|3419188_3419878_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	40.7	6.1e-39
WP_004252605.1|3420099_3421332_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_017628255.1|3421328_3425054_+	AAA family ATPase	NA	G3MAB6	Bacillus_virus	24.2	5.5e-09
>prophage 227
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3433160	3434069	4055965		Salmonella_phage(100.0%)	1	NA	NA
WP_004245172.1|3433160_3434069_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	56.2	2.4e-91
>prophage 228
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3449019	3453272	4055965		Orpheovirus(50.0%)	4	NA	NA
WP_017628249.1|3449019_3450213_+	cystathionine beta-lyase	NA	A0A2I2L687	Orpheovirus	22.1	4.6e-10
WP_004248983.1|3450337_3451009_+	DedA family protein	NA	NA	NA	NA	NA
WP_004248982.1|3451256_3452414_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012367446.1|3452441_3453272_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.9	1.3e-64
>prophage 229
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3464588	3465752	4055965		Halovirus(100.0%)	1	NA	NA
WP_017628247.1|3464588_3465752_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	2.6e-50
>prophage 230
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3469244	3483180	4055965	tRNA	Tupanvirus(20.0%)	10	NA	NA
WP_004248968.1|3469244_3472055_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.5	1.3e-87
WP_017628244.1|3472084_3473026_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004248964.1|3473456_3473717_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004245210.1|3473791_3474709_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004245211.1|3474897_3476076_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.9	1.9e-85
WP_063073860.1|3476616_3477753_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.9	2.8e-17
WP_017628243.1|3477859_3479785_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.4	4.2e-146
WP_012367436.1|3480309_3480897_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_017628242.1|3481058_3482042_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_004248961.1|3482226_3483180_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	8.8e-12
>prophage 231
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3499945	3508337	4055965	transposase	Streptococcus_phage(20.0%)	8	NA	NA
WP_017628237.1|3499945_3500848_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.2	1.5e-08
WP_004245229.1|3500891_3501539_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_004248953.1|3501590_3502130_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_004248952.1|3502219_3502531_-	trp operon repressor	NA	NA	NA	NA	NA
WP_175216694.1|3502632_3504552_-	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.3	1.8e-08
WP_004248950.1|3504893_3506561_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.6	1.9e-41
WP_012368857.1|3506689_3507106_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
WP_063693510.1|3507128_3508337_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.1e-187
>prophage 232
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3513836	3515546	4055965		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004252657.1|3513836_3515546_+	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.0	1.1e-07
>prophage 233
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3528085	3531887	4055965		Streptococcus_phage(50.0%)	4	NA	NA
WP_004245252.1|3528085_3528964_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.9	1.8e-51
WP_017628232.1|3529025_3530792_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004245256.1|3530896_3531274_+	YraN family protein	NA	NA	NA	NA	NA
WP_004245257.1|3531296_3531887_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	5.6e-09
>prophage 234
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3540576	3542913	4055965		Hokovirus(100.0%)	1	NA	NA
WP_004245272.1|3540576_3542913_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.0	4.0e-42
>prophage 235
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3553776	3554286	4055965	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245280.1|3553776_3554286_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
>prophage 236
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3558814	3561468	4055965		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_017628226.1|3558814_3560206_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
WP_017628225.1|3560397_3561468_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
>prophage 237
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3569207	3578072	4055965		Bacillus_virus(20.0%)	11	NA	NA
WP_004245298.1|3569207_3570020_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
WP_026090454.1|3570263_3571244_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_017628220.1|3571262_3572237_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
WP_004245301.1|3572264_3572822_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
WP_004245302.1|3572839_3573418_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004245303.1|3573398_3573932_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004245304.1|3573938_3574664_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_004248917.1|3574723_3576199_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004248916.1|3576222_3576510_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004245307.1|3576665_3577133_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004245308.1|3577217_3578072_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
>prophage 238
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3591966	3593010	4055965		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245330.1|3591966_3593010_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
>prophage 239
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3609698	3610793	4055965		Planktothrix_phage(100.0%)	1	NA	NA
WP_004248885.1|3609698_3610793_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.6e-20
>prophage 240
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3614256	3618331	4055965		Streptococcus_phage(33.33%)	4	NA	NA
WP_004245382.1|3614256_3615405_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	1.4e-43
WP_004245383.1|3615499_3616354_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	2.5e-42
WP_004248880.1|3616695_3617673_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004245385.1|3617665_3618331_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	9.4e-13
>prophage 241
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3621912	3625100	4055965		Dickeya_phage(50.0%)	2	NA	NA
WP_004248875.1|3621912_3622539_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	44.2	5.0e-16
WP_017628206.1|3622709_3625100_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	2.8e-131
>prophage 242
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3630196	3631336	4055965		Dickeya_phage(50.0%)	2	NA	NA
WP_004245397.1|3630196_3630451_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	4.1e-09
WP_004245400.1|3630661_3631336_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.9	3.6e-60
>prophage 243
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3638927	3641246	4055965		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004248870.1|3638927_3640007_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	4.6e-09
WP_004245408.1|3640268_3641246_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	20.8	2.1e-05
>prophage 244
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3657944	3659498	4055965		Escherichia_phage(100.0%)	1	NA	NA
WP_004245426.1|3657944_3659498_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	33.3	2.4e-19
>prophage 245
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3666822	3667485	4055965		Bacillus_phage(100.0%)	1	NA	NA
WP_004245430.1|3666822_3667485_+	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	28.3	5.9e-07
>prophage 246
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3684567	3685188	4055965		Streptococcus_phage(100.0%)	1	NA	NA
WP_017628747.1|3684567_3685188_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.8	9.7e-20
>prophage 247
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3694167	3697520	4055965		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004246116.1|3694167_3694953_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.8	3.6e-27
WP_004249526.1|3694956_3695487_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004246118.1|3695490_3695757_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004246119.1|3695882_3697520_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	28.4	7.7e-40
>prophage 248
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3711332	3718460	4055965		Moraxella_phage(33.33%)	6	NA	NA
WP_004246136.1|3711332_3712679_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.7	4.4e-158
WP_017628749.1|3713449_3714637_-	MFS transporter	NA	NA	NA	NA	NA
WP_004246138.1|3714875_3715454_+	helix-turn-helix transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	41.7	8.2e-05
WP_004249537.1|3715530_3716427_+	cation transporter	NA	NA	NA	NA	NA
WP_004246140.1|3716477_3716762_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004249538.1|3716765_3718460_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	31.8	1.5e-59
>prophage 249
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3725971	3731581	4055965	transposase	Mycobacterium_phage(33.33%)	5	NA	NA
WP_063073908.1|3725971_3727108_+	RNA ligase RtcB family protein	NA	R4TNH6	Mycobacterium_phage	27.1	8.8e-27
WP_004249548.1|3727107_3727719_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_012368780.1|3728193_3728451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096043054.1|3729933_3731142_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	3.6e-188
WP_053828314.1|3731164_3731581_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.5	1.3e-44
>prophage 250
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3737450	3742391	4055965	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_004246183.1|3737450_3738959_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	8.3e-49
WP_004246185.1|3739039_3739489_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004249581.1|3739502_3742391_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	7.4e-147
>prophage 251
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3747378	3754627	4055965		Paramecium_bursaria_Chlorella_virus(25.0%)	10	NA	NA
WP_004246197.1|3747378_3748314_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.9e-52
WP_004246198.1|3748327_3748786_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004246200.1|3749123_3749510_+	RidA family protein	NA	NA	NA	NA	NA
WP_004246202.1|3749855_3751994_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_004246203.1|3751998_3752463_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	5.0e-53
WP_004246204.1|3752489_3752699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246205.1|3752865_3753243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628759.1|3753251_3753692_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004246207.1|3753807_3754059_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_017628760.1|3754345_3754627_+	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.2	6.1e-14
>prophage 252
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3768014	3769718	4055965		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004246222.1|3768014_3769718_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	69.7	5.4e-214
>prophage 253
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3776361	3778197	4055965		Catovirus(100.0%)	1	NA	NA
WP_026090516.1|3776361_3778197_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	7.2e-55
>prophage 254
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3783826	3786577	4055965		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004246237.1|3783826_3786577_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.1e-26
>prophage 255
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3790916	3793781	4055965	protease	Pandoravirus(50.0%)	2	NA	NA
WP_004246242.1|3790916_3791759_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.8e-16
WP_004246243.1|3791840_3793781_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.8	8.3e-118
>prophage 256
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3799620	3801933	4055965		Indivirus(25.0%)	4	NA	NA
WP_004246252.1|3799620_3800592_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	1.4e-09
WP_004246253.1|3800638_3801055_-	putative DNA-binding transcriptional regulator	NA	C9DGL1	Escherichia_phage	53.8	3.9e-09
WP_004246254.1|3801133_3801481_-	putative DNA-binding transcriptional regulator	NA	A0A1C6ZDN4	Pseudomonas_phage	50.0	1.2e-06
WP_004246255.1|3801666_3801933_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.2	8.6e-18
>prophage 257
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3805506	3807241	4055965		Klosneuvirus(50.0%)	2	NA	NA
WP_004249610.1|3805506_3806514_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.4	4.4e-70
WP_004246260.1|3806713_3807241_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	4.2e-56
>prophage 258
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3827751	3832432	4055965		Lactococcus_phage(50.0%)	3	NA	NA
WP_063108942.1|3827751_3830241_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
WP_004249627.1|3830279_3830708_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004249629.1|3831133_3832432_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.4e-65
>prophage 259
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3837944	3841292	4055965		Wolbachia_phage(50.0%)	2	NA	NA
WP_020946614.1|3837944_3839954_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	1.5e-61
WP_104836185.1|3839975_3841292_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	33.3	6.2e-16
>prophage 260
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3845297	3845843	4055965		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004253041.1|3845297_3845843_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.5	1.3e-28
>prophage 261
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3860452	3862282	4055965		Catovirus(100.0%)	1	NA	NA
WP_175216698.1|3860452_3862282_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.1	1.0e-85
>prophage 262
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3865569	3869511	4055965		Bacillus_phage(50.0%)	3	NA	NA
WP_004246323.1|3865569_3867726_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	1.3e-116
WP_004249656.1|3867871_3868588_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_175216699.1|3868587_3869511_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.4	1.9e-24
>prophage 263
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3885945	3892122	4055965		uncultured_marine_virus(20.0%)	6	NA	NA
WP_004246343.1|3885945_3887076_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	37.8	1.2e-20
WP_004249666.1|3887077_3887791_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004249667.1|3887768_3888650_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	8.4e-110
WP_012368702.1|3888668_3889742_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.3	7.1e-103
WP_004246348.1|3889732_3890995_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.1	1.3e-23
WP_004246349.1|3890991_3892122_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.2	1.1e-29
>prophage 264
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3896640	3901993	4055965		Streptomyces_phage(33.33%)	4	NA	NA
WP_004246355.1|3896640_3896967_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.4	6.6e-20
WP_004249672.1|3897086_3898385_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	28.7	1.7e-34
WP_049197466.1|3898388_3899897_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004249673.1|3899971_3901993_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	6.2e-116
>prophage 265
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3909522	3911172	4055965		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004246367.1|3909522_3911172_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.3	5.0e-63
>prophage 266
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3922984	3926904	4055965	tRNA	Pandoravirus(25.0%)	5	NA	NA
WP_004249883.1|3922984_3923554_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.6	2.4e-09
WP_017827503.1|3923546_3924104_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_020946578.1|3924122_3925280_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	30.0	7.1e-32
WP_020946577.1|3925411_3925927_+	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	39.6	1.1e-16
WP_020946576.1|3925953_3926904_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	6.3e-10
>prophage 267
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3946210	3949316	4055965		Catovirus(50.0%)	2	NA	NA
WP_012368508.1|3946210_3947395_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
WP_004246971.1|3948368_3949316_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.5	4.2e-30
>prophage 268
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3958299	3960153	4055965		Acinetobacter_phage(100.0%)	1	NA	NA
WP_175216703.1|3958299_3960153_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	25.5	2.3e-08
>prophage 269
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3971480	3973205	4055965		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_020946563.1|3971480_3973205_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
>prophage 270
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3978077	3981021	4055965		Burkholderia_virus(50.0%)	2	NA	NA
WP_004246398.1|3978077_3979580_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
WP_121909210.1|3979590_3981021_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.7	4.0e-61
>prophage 271
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	3997489	3998830	4055965		Erwinia_phage(100.0%)	1	NA	NA
WP_004246417.1|3997489_3998830_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
>prophage 272
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	4003345	4007030	4055965		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_004246421.1|4003345_4004161_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_004246422.1|4004203_4005736_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246423.1|4005845_4007030_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
>prophage 273
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	4015681	4019195	4055965		Feldmannia_irregularis_virus(33.33%)	3	NA	NA
WP_004246432.1|4015681_4016380_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_112843198.1|4016392_4017784_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_175216707.1|4018094_4019195_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.1	1.1e-21
>prophage 274
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	4030007	4031174	4055965		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_175216713.1|4030007_4031174_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	3.8e-118
>prophage 275
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	4037210	4043002	4055965		Planktothrix_phage(25.0%)	5	NA	NA
WP_121909235.1|4037210_4038503_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	36.6	7.7e-11
WP_121909234.1|4038505_4039474_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004246460.1|4039561_4040587_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	6.1e-19
WP_121909233.1|4040596_4041796_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.8e-36
WP_004246462.1|4042063_4043002_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.4	8.3e-31
>prophage 276
NZ_CP053718	Proteus mirabilis strain MPE4069 chromosome, complete genome	4055965	4054810	4055296	4055965		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004246474.1|4054810_4055296_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	6.6e-24
