The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	454052	510398	4120711	integrase,lysis,holin,terminase,capsid,tail,portal,head	Morganella_phage(22.45%)	75	469867:469913	509257:509303
WP_052715531.1|454052_457283_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
WP_036918873.1|457299_457641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|457640_457814_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|457985_458498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043103.1|459482_462203_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_046334700.1|462199_462544_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_052715532.1|462558_463155_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_036900272.1|463154_463349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469419.1|463348_463522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|463518_464130_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036907509.1|464126_464336_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|464332_464512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334702.1|464508_464766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072052191.1|464768_464942_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080942627.1|464934_465876_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.0	3.3e-64
WP_046334703.1|465872_466706_-	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	46.1	1.4e-21
WP_036918890.1|466718_467114_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|467113_467311_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_046334704.1|468491_469703_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
469867:469913	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_175233704.1|470087_470321_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	1.2e-31
WP_175233705.1|470388_471477_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.6	1.4e-13
WP_124740860.1|473523_475554_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	50.4	2.7e-167
WP_036970125.1|475553_476999_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	41.9	2.0e-84
WP_036970128.1|477008_477668_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	68.1	6.6e-59
WP_036970131.1|477661_478123_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	70.7	2.7e-59
WP_124740861.1|478122_478821_-|tail	phage tail protein	tail	Q9AYZ3	Salmonella_phage	42.9	4.4e-37
WP_175233793.1|478820_480059_-	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	68.7	9.3e-147
WP_175233706.1|480573_481056_-	packaged DNA stabilization protein p27	NA	B6SCV9	Bacteriophage	75.2	1.9e-63
WP_109910820.1|481036_481228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175233707.1|481281_482553_-|head	head protein	head	B6SCV8	Bacteriophage	74.2	2.1e-178
WP_124743769.1|482567_483467_-|capsid	phage capsid protein	capsid	B6SCV7	Bacteriophage	60.9	1.6e-79
WP_175233708.1|483477_485679_-|portal	portal protein	portal	B6SCZ3	Bacteriophage	86.6	0.0e+00
WP_175233709.1|485681_487094_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	88.1	2.3e-250
WP_069368037.1|487095_487479_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	73.2	2.5e-50
WP_161723695.1|487573_487801_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	53.4	3.9e-11
WP_175233710.1|488486_488936_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.2	1.3e-50
WP_049257603.1|488937_489270_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	71.3	2.0e-35
WP_049257602.1|489256_489550_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|489546_489936_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_036969493.1|490565_491069_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	88.0	4.0e-80
WP_049206611.1|491065_491281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175233711.1|491280_491901_-	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	54.1	2.7e-46
WP_159298380.1|492396_492840_-	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	94.6	3.8e-34
WP_064497299.1|492849_493119_-	DUF4752 family protein	NA	NA	NA	NA	NA
WP_064497300.1|493235_493529_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.9e-18
WP_064497301.1|493515_493737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124743660.1|494013_494400_-	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	52.8	3.8e-30
WP_175233794.1|494419_495787_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	64.0	7.3e-161
WP_110229454.1|495790_496627_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	57.0	2.6e-68
WP_175233712.1|496619_496796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049220837.1|496913_497240_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	79.6	6.2e-42
WP_004247720.1|497375_497561_-	hypothetical protein	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	45.9	1.2e-07
WP_004247719.1|497666_498392_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	57.3	1.4e-62
WP_175233713.1|498445_499336_+	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_175233714.1|499350_499533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175233715.1|499924_500200_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	52.2	3.3e-12
WP_036972282.1|500378_500510_+	hypothetical protein	NA	A0A0N7C2P4	Escherichia_phage	59.5	5.3e-05
WP_080047885.1|500675_500993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061064261.1|501004_501541_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_157836032.1|501707_501857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049216804.1|501931_502141_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049216802.1|502357_502621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049216800.1|502617_502872_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	1.9e-38
WP_049216798.1|502868_503687_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	97.8	7.0e-159
WP_049216795.1|503679_504486_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	98.9	6.7e-146
WP_124740880.1|504475_504976_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	68.9	1.3e-51
WP_071233772.1|504991_505330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175233716.1|505363_505528_+	hook protein	NA	NA	NA	NA	NA
WP_070487054.1|505563_505884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740882.1|505883_506228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064497318.1|506386_506752_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_063073713.1|506755_507109_+	DUF2591 family protein	NA	K7PH48	Enterobacterial_phage	33.9	8.8e-10
WP_063073712.1|507098_507644_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	61.5	1.8e-57
WP_064497319.1|508079_509237_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	4.0e-176
WP_017627899.1|509525_510398_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
509257:509303	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	781502	790346	4120711		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|781502_783071_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|783471_784152_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|784248_784824_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|784900_785479_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|785546_786572_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|786606_787062_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_175233723.1|787086_788223_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|788223_788808_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|789200_790346_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 4
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	1428160	1558207	4120711	transposase,integrase,tRNA	Escherichia_phage(35.48%)	102	1441802:1441816	1561501:1561515
WP_004246627.1|1428160_1429189_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_064497091.1|1429229_1429904_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|1430021_1430645_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_115287030.1|1431012_1432971_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	2.8e-89
WP_004246621.1|1433135_1433447_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_064497089.1|1433443_1435099_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_064497088.1|1435421_1437053_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_165469476.1|1438331_1438748_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	5.5e-43
WP_004249865.1|1438834_1439527_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064497334.1|1439530_1440949_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_064497335.1|1440939_1441677_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
1441802:1441816	attL	TTTTTTATAAATTTA	NA	NA	NA	NA
WP_004249867.1|1447848_1448535_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
1441802:1441816	attL	TTTTTTATAAATTTA	NA	NA	NA	NA
WP_012368605.1|1448615_1450013_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_004246607.1|1450094_1451021_-	ribokinase	NA	NA	NA	NA	NA
WP_064497151.1|1451301_1452801_+	ATPase RavA	NA	A0A0N7A9S6	Sulfolobus_monocaudavirus	29.2	8.6e-22
WP_064497150.1|1452808_1454266_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|1454266_1455259_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|1455419_1455881_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_064497149.1|1455981_1456422_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004246600.1|1456801_1458700_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004246599.1|1458696_1459323_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|1459937_1460315_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|1460346_1461171_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|1461216_1461456_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|1461517_1461988_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|1462000_1462534_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|1462548_1464090_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|1464147_1465011_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|1465045_1466428_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|1466449_1466866_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_064497148.1|1467016_1468390_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.7	3.3e-28
WP_049210449.1|1468547_1470374_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	2.1e-131
WP_001029679.1|1470533_1471355_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|1471341_1473450_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|1473446_1475114_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|1475916_1477491_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_001067855.1|1477515_1478220_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_175233796.1|1478229_1478571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|1478590_1479379_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|1479378_1479897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|1479901_1480318_-	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_001067855.1|1480703_1481408_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|1481525_1481729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|1482688_1483036_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|1483258_1483711_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|1483795_1484428_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|1484565_1485396_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
1484562:1484576	attR	TTTTTTATAAATTTA	NA	NA	NA	NA
WP_063840321.1|1485526_1486081_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
1484562:1484576	attR	TTTTTTATAAATTTA	NA	NA	NA	NA
WP_000742814.1|1488290_1489316_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|1489737_1490490_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|1492296_1492782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|1492978_1494069_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|1494158_1494974_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001445143.1|1495256_1495508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|1495538_1497032_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|1497143_1497449_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|1497476_1498691_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001067784.1|1500711_1501416_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|1501500_1501902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491481.1|1504848_1505298_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	2.5e-49
WP_001067858.1|1505322_1506027_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000493383.1|1506329_1507190_+	EamA family transporter	NA	NA	NA	NA	NA
WP_042005022.1|1509176_1509413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|1510303_1511107_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043260.1|1511166_1511982_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000018329.1|1513415_1514231_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_014839978.1|1515452_1516241_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|1516240_1516759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175233730.1|1516711_1517176_-	FosA3/FosA4 family fosfomycin resistance glutathione transferase	NA	NA	NA	NA	NA
WP_175233731.1|1518404_1518581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001334766.1|1521398_1522229_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|1523301_1524006_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|1524119_1524896_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|1525124_1526150_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|1526571_1527324_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|1529134_1529620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|1530994_1531810_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001445143.1|1532092_1532344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255015.1|1533978_1534284_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|1534311_1535526_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_000520143.1|1535742_1536564_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|1537550_1538255_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|1538338_1538740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344976.1|1538748_1541700_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_050491481.1|1541702_1542152_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	2.5e-49
WP_001067858.1|1542176_1542881_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000804064.1|1544075_1545275_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_031606906.1|1545380_1546007_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_042005022.1|1546038_1546275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480972.1|1546328_1547165_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001043260.1|1548027_1548843_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_024192851.1|1549150_1549363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1549387_1550092_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|1550281_1551097_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|1551247_1551952_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|1552749_1553250_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|1554209_1554557_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|1554720_1555512_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777554.1|1555528_1556002_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_070342364.1|1555998_1556844_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000071896.1|1557229_1557766_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|1557880_1558207_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
1561501:1561515	attR	ATTTTCAGCGTGACA	NA	NA	NA	NA
>prophage 5
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	2702153	2714114	4120711		Mycobacterium_phage(25.0%)	13	NA	NA
WP_004246075.1|2702153_2703353_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|2703961_2704930_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|2704955_2707082_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|2707110_2707515_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|2707526_2707751_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|2708032_2708506_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|2708703_2708913_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|2709097_2709238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|2709981_2710356_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|2710371_2711337_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|2711438_2712083_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|2712440_2712704_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|2712902_2714114_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 6
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	2750073	2798450	4120711	integrase,lysis,tail	Proteus_phage(18.75%)	80	2749987:2750005	2805370:2805388
2749987:2750005	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_026090525.1|2750073_2751075_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	9.7e-70
WP_012367595.1|2751031_2751277_-	excisionase	NA	NA	NA	NA	NA
WP_036907939.1|2751273_2751594_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	51.9	1.3e-15
WP_162837621.1|2751586_2751763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907940.1|2751920_2752196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907941.1|2752188_2752416_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	71.2	5.3e-24
WP_036907942.1|2752468_2753053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907943.1|2753124_2753421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907944.1|2753485_2754166_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.8	9.8e-66
WP_171944324.1|2754168_2754342_-	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	93.0	2.1e-25
WP_049197573.1|2754385_2754586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175233774.1|2754601_2755189_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	82.9	1.5e-46
WP_087740865.1|2755178_2755877_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	61.6	6.3e-76
WP_004247463.1|2755873_2756758_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.5	7.7e-95
WP_004247464.1|2756754_2757006_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	4.1e-38
WP_004247465.1|2757002_2757266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837622.1|2757273_2757429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247466.1|2757517_2757745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247467.1|2757867_2758143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|2758307_2758493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|2758489_2758642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247471.1|2758827_2759040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247473.1|2759146_2759467_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	5.0e-20
WP_004245992.1|2760214_2760736_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	78.5	5.6e-61
WP_004245991.1|2760973_2761315_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004245990.1|2761323_2762007_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	1.5e-130
WP_004245989.1|2762089_2762299_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_049195174.1|2762444_2762792_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.0	3.2e-36
WP_004251793.1|2762887_2763061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195176.1|2763057_2763825_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_046335275.1|2763824_2765210_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_049195179.1|2765235_2765685_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|2765763_2766054_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|2766050_2766407_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|2766406_2767039_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|2767350_2767872_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|2768030_2768453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|2768506_2768776_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017827434.1|2768775_2769246_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_004244729.1|2769227_2769386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195183.1|2769388_2769850_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_004247494.1|2770197_2770782_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|2770778_2770985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245978.1|2770981_2771140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247495.1|2771173_2771776_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_004247496.1|2771778_2773266_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.3e-264
WP_004247497.1|2773265_2774636_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	5.3e-119
WP_004247498.1|2774632_2775754_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	6.1e-105
WP_036907977.1|2775865_2776627_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_004245970.1|2776640_2777594_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|2777596_2777881_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004245968.1|2777921_2778401_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_046334552.1|2778403_2778754_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	41.6	5.1e-18
WP_046334553.1|2778755_2779337_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.8e-47
WP_046334555.1|2779333_2779735_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|2779780_2780437_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_049197577.1|2780488_2780794_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	54.5	1.1e-21
WP_049197578.1|2780808_2781099_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	4.1e-13
WP_049197579.1|2781190_2781562_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	64.7	1.3e-35
WP_004247510.1|2781575_2781758_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_049197580.1|2782148_2782352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197581.1|2782326_2782824_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_046334559.1|2783083_2783917_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	55.6	3.7e-67
WP_004245955.1|2783986_2784148_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_049197582.1|2784261_2784519_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_004245953.1|2784619_2785465_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	36.0	1.2e-31
WP_012367638.1|2785451_2785871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245950.1|2785863_2786532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|2786629_2786863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197583.1|2786930_2789861_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.6	3.6e-133
WP_004245945.1|2789872_2790163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197584.1|2790182_2790383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|2790526_2790868_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004247517.1|2790864_2791608_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
WP_004247518.1|2791604_2792315_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
WP_004247519.1|2792311_2792917_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
WP_004247520.1|2792968_2797162_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	1.7e-301
WP_004245936.1|2797155_2797524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|2797525_2798140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|2798189_2798450_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
2805370:2805388	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 7
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	2975103	3053752	4120711	plate,protease,tRNA	Bacillus_phage(23.53%)	57	NA	NA
WP_004244558.1|2975103_2975418_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|2975448_2977743_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|2977862_2978081_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|2978400_2979093_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_064497115.1|2979094_2980846_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	6.8e-18
WP_017628444.1|2980848_2982618_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|2982756_2983716_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|2984258_2984753_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_175233778.1|2984880_2988768_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|2988880_2989486_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|2989496_2990846_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|2990979_2992269_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|2992448_2992781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|2993181_2994231_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|2994303_2995209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|2995566_2996307_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|2996414_2998697_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|2998751_2999606_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017628443.1|3000276_3002034_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|3002261_3003299_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|3003373_3004642_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|3004778_3006209_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|3006345_3007434_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|3007630_3008917_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|3009205_3009883_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|3010064_3011738_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|3011802_3012090_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_017628440.1|3012553_3014923_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|3014959_3016705_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|3016701_3017703_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|3018198_3018414_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|3018828_3019008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|3019012_3019774_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017628439.1|3019897_3020728_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|3021107_3021881_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|3021890_3023213_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|3023193_3023925_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|3023921_3028379_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|3028661_3029315_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|3029720_3030434_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_049194798.1|3030783_3032499_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|3032830_3033379_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|3033428_3034079_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|3034171_3034645_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|3034735_3036472_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_064497434.1|3036458_3037820_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628436.1|3037857_3041406_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|3041408_3042872_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|3042877_3043528_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|3043529_3044318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|3044321_3047033_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|3047041_3047797_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|3047789_3049148_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|3049149_3049701_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|3049702_3050971_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|3050975_3052013_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|3051976_3053752_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	3214265	3240450	4120711	integrase,lysis,protease,terminase,capsid,head,tRNA	Morganella_phage(36.36%)	33	3215034:3215048	3225709:3225723
WP_004247117.1|3214265_3215369_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3215034:3215048	attL	AAATGCTTTAAATTT	NA	NA	NA	NA
WP_004247118.1|3215474_3215927_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|3215919_3216549_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|3216687_3217941_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_036908088.1|3218050_3219184_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	6.5e-155
WP_017628380.1|3219158_3219410_-	excisionase	NA	NA	NA	NA	NA
WP_036908086.1|3219495_3220020_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
WP_017628378.1|3220304_3220937_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|3221037_3221244_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_036908083.1|3221281_3221758_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_036908081.1|3222019_3222199_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_052124643.1|3222756_3223272_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
WP_036908080.1|3223293_3224100_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
WP_036908078.1|3224096_3225122_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
WP_036908077.1|3225421_3226501_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
3225709:3225723	attR	AAATGCTTTAAATTT	NA	NA	NA	NA
WP_036908076.1|3227004_3227403_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
WP_004247137.1|3227742_3227955_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|3228356_3228878_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|3229201_3229537_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_063073914.1|3229640_3230567_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036908073.1|3230983_3231412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|3231564_3231816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|3232259_3232529_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|3232528_3232999_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_162837602.1|3232980_3233139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905787.1|3233141_3233603_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_155115349.1|3234261_3234417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001967215.1|3234500_3234839_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_006537823.1|3234841_3235054_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
WP_006537822.1|3235176_3235644_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_017628363.1|3235597_3237331_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_004242476.1|3238611_3239280_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|3239283_3240450_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
>prophage 9
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	3512339	3522331	4120711		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|3512339_3514397_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_064497103.1|3514408_3516109_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|3516444_3517131_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|3517130_3517592_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|3517644_3518256_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|3518395_3519256_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|3519257_3519875_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|3519886_3522331_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 10
NZ_CP053683	Proteus mirabilis strain MPE0027 chromosome, complete genome	4120711	4038271	4057074	4120711	plate,lysis,holin	Escherichia_phage(21.43%)	21	NA	NA
WP_012368081.1|4038271_4040710_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|4040721_4041339_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|4041342_4042119_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|4042234_4042777_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|4043345_4043525_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_017628011.1|4044839_4045496_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|4045492_4046680_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|4046672_4047017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|4047013_4047706_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|4047708_4048521_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|4048489_4048810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|4048822_4049311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628009.1|4049313_4051617_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|4051699_4052158_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|4052217_4052670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|4052680_4054168_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|4054176_4054689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|4054725_4055175_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|4055171_4055576_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|4055578_4055878_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|4056258_4057074_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
