The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	0	2948	3970204		Bacillus_phage(100.0%)	2	NA	NA
WP_036918962.1|824_2192_+	LOG family protein	NA	NA	NA	NA	NA
WP_060557674.1|2198_2948_+	flap endonuclease Xni	NA	B6V2K6	Bacillus_phage	29.1	2.3e-15
>prophage 2
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	6142	22294	3970204	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_060557671.1|6142_7357_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	31.8	4.2e-59
WP_060557670.1|7359_7803_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_060557669.1|8120_8969_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.1	2.9e-14
WP_060557668.1|9078_10173_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_004245505.1|10921_12184_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	1.6e-13
WP_060557667.1|12428_13763_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_060557666.1|13861_15778_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.5	1.5e-23
WP_060557665.1|15770_19409_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	22.8	1.2e-08
WP_060557664.1|19405_22294_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.3	6.0e-72
>prophage 3
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	27825	31926	3970204		Vibrio_phage(50.0%)	3	NA	NA
WP_004245521.1|27825_28677_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.5	2.4e-125
WP_004245522.1|28708_29593_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_060557658.1|29679_31926_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.6	5.1e-10
>prophage 4
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	35319	42735	3970204		Acidithiobacillus_phage(40.0%)	5	NA	NA
WP_004245527.1|35319_36021_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.6	4.3e-24
WP_004245528.1|36148_36601_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	5.2e-31
WP_017827532.1|36600_37170_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	52.7	2.7e-53
WP_060557656.1|37285_39640_+	DNA polymerase II	NA	B3GAM5	uncultured_virus	24.3	6.9e-26
WP_060557655.1|39831_42735_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.7	1.3e-21
>prophage 5
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	50878	52561	3970204		Aeromonas_phage(50.0%)	2	NA	NA
WP_060557649.1|50878_51700_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A2R4ALY4	Aeromonas_phage	45.6	9.5e-07
WP_060557648.1|52075_52561_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	1.1e-31
>prophage 6
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	60845	76367	3970204		Bacillus_virus(28.57%)	12	NA	NA
WP_060557643.1|60845_63803_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	28.9	1.9e-81
WP_060557642.1|63836_65732_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.1	2.3e-96
WP_060557641.1|65839_66430_-	esterase YqiA	NA	NA	NA	NA	NA
WP_060557640.1|66433_67273_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_060557639.1|67504_68134_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.6	5.6e-23
WP_060557638.1|68347_69745_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004249472.1|70070_70799_+	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	36.1	2.0e-24
WP_060557637.1|70806_71970_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.8	3.7e-89
WP_060557636.1|72223_73009_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004245565.1|73184_73838_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	2.3e-43
WP_060557635.1|74323_74632_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_036905068.1|74942_76367_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	5.1e-40
>prophage 7
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	81117	82341	3970204		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_060557631.1|81117_82341_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.4	3.8e-92
>prophage 8
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	87091	92587	3970204	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_060557627.1|87091_88120_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	4.6e-107
WP_001144069.1|88462_88678_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_060557626.1|88791_90540_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	2.3e-74
WP_004245586.1|90730_92587_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	1.6e-33
>prophage 9
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	105030	117396	3970204	protease	Caulobacter_phage(37.5%)	12	NA	NA
WP_060557588.1|105030_106551_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	6.1e-07
WP_060557587.1|106706_108275_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-10
WP_060557586.1|108675_109356_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|109446_110022_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_060557585.1|110098_110677_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.0	3.2e-33
WP_004245605.1|110744_111770_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|111804_112260_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_060557584.1|112284_113433_-	TerD family protein	NA	NA	NA	NA	NA
WP_004245609.1|113433_114018_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_060557583.1|114408_115554_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
WP_060557582.1|115546_116317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557581.1|116319_117396_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.5	2.0e-36
>prophage 10
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	123262	125777	3970204	holin	Bodo_saltans_virus(33.33%)	3	NA	NA
WP_060557577.1|123262_124459_+	tetracycline efflux MFS transporter Tet(J)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	5.1e-09
WP_004249433.1|124719_125010_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	44.7	7.5e-15
WP_004245624.1|125516_125777_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	63.1	2.4e-25
>prophage 11
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	137809	140185	3970204		Hokovirus(100.0%)	1	NA	NA
WP_060557566.1|137809_140185_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.8	3.0e-13
>prophage 12
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	144913	145180	3970204		Pectobacterium_bacteriophage(100.0%)	1	NA	NA
WP_060557562.1|144913_145180_+	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	53.9	1.4e-15
>prophage 13
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	151449	152772	3970204		Geobacillus_virus(100.0%)	1	NA	NA
WP_062814520.1|151449_152772_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.0	9.8e-78
>prophage 14
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	158425	162239	3970204	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_060557555.1|158425_160015_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	5.7e-32
WP_175212398.1|161822_162239_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.3	1.7e-44
>prophage 15
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	169732	171377	3970204	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_175212399.1|169732_170938_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	2.6e-186
WP_107034670.1|170960_171377_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.3	2.2e-44
>prophage 16
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	174700	175945	3970204		Enterococcus_phage(100.0%)	1	NA	NA
WP_060556501.1|174700_175945_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	2.8e-87
>prophage 17
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	185815	186619	3970204		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_060556495.1|185815_186619_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	8.4e-08
>prophage 18
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	218959	220952	3970204		Vibrio_phage(50.0%)	2	NA	NA
WP_004245716.1|218959_220606_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	2.4e-190
WP_004249265.1|220658_220952_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	3.3e-10
>prophage 19
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	248940	250578	3970204		Hepacivirus(100.0%)	1	NA	NA
WP_060556304.1|248940_250578_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.9	5.3e-41
>prophage 20
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	256402	266215	3970204		Vibrio_phage(25.0%)	9	NA	NA
WP_060556309.1|256402_257917_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	3.4e-10
WP_060556310.1|257959_259102_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_060556311.1|259171_260392_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_060556312.1|260469_262026_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.2	8.3e-36
WP_060556313.1|262091_262877_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_060556314.1|262916_263510_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_060556315.1|263573_263966_-	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_060556316.1|264679_265342_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	31.8	1.8e-27
WP_060556317.1|265603_266215_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	4.1e-23
>prophage 21
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	270018	270722	3970204	holin	Proteus_phage(50.0%)	2	NA	NA
WP_060556320.1|270018_270408_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	65.0	1.4e-40
WP_060556321.1|270404_270722_-|holin	phage holin family protein	holin	R9W0A1	Serratia_phage	46.7	2.2e-20
>prophage 22
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	288680	290099	3970204		Pseudomonas_phage(100.0%)	1	NA	NA
WP_060556329.1|288680_290099_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.8	4.3e-47
>prophage 23
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	299077	299872	3970204		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_060556338.1|299077_299872_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	8.3e-16
>prophage 24
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	327718	330796	3970204		Leptospira_phage(100.0%)	1	NA	NA
WP_175212401.1|327718_330796_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	4.0e-58
>prophage 25
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	346438	347713	3970204		Pandoravirus(100.0%)	1	NA	NA
WP_060556375.1|346438_347713_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	4.4e-19
>prophage 26
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	355229	366473	3970204	tRNA	Morganella_phage(16.67%)	10	NA	NA
WP_004245886.1|355229_355547_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004245887.1|355682_356726_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_060556382.1|356842_357622_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004250112.1|357618_358479_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245891.1|358462_359578_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_060556383.1|360021_361359_-	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.1	7.2e-28
WP_060556384.1|361639_362674_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_175212402.1|362780_363764_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_004245896.1|363931_365341_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	3.3e-193
WP_060556386.1|365381_366473_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	4.5e-28
>prophage 27
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	371236	376522	3970204		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_060556390.1|371236_374071_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
WP_004249162.1|374322_374847_+	single-stranded DNA-binding protein SSB1	NA	I3PGW4	Xanthomonas_phage	67.0	7.6e-58
WP_060556391.1|375188_375719_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_004245906.1|375910_376522_-	repressor LexA	NA	U5P451	Shigella_phage	45.6	2.5e-12
>prophage 28
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	386239	389911	3970204		Dickeya_phage(100.0%)	1	NA	NA
WP_060556397.1|386239_389911_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.0	2.1e-21
>prophage 29
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	408327	412222	3970204		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_060557169.1|408327_409917_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.2e-66
WP_060557170.1|409929_411219_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_060557171.1|411242_411935_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004246922.1|411949_412222_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.7	8.0e-19
>prophage 30
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	422394	441628	3970204	transposase	Sodalis_phage(14.29%)	16	NA	NA
WP_060557180.1|422394_423363_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	41.2	2.9e-47
WP_004246908.1|423555_427785_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.1e-66
WP_004246906.1|427907_431936_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	1.4e-21
WP_004246905.1|432288_432654_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004246904.1|432717_433215_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004246903.1|433542_434244_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_060557181.1|434248_434677_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004246900.1|434822_435368_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	4.5e-13
WP_004246899.1|435375_435753_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_124743347.1|436025_437210_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
WP_012368509.1|437277_439392_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	4.7e-58
WP_004246897.1|439471_439942_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004246896.1|440041_440416_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004246894.1|440543_440837_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_060557554.1|440867_441236_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_060557553.1|441235_441628_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.3	1.4e-16
>prophage 31
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	448743	456522	3970204		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_060557548.1|448743_450675_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.7	1.6e-73
WP_060557547.1|451001_452693_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	1.0e-07
WP_060557546.1|453143_454871_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.7	4.5e-06
WP_060557545.1|454977_456522_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.6	1.4e-35
>prophage 32
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	462613	472128	3970204	transposase	Klosneuvirus(14.29%)	8	NA	NA
WP_060557541.1|462613_463831_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.0e-25
WP_004246870.1|463948_464524_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_175212404.1|464780_465989_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.8e-187
WP_175212405.1|466011_466428_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	3.4e-45
WP_004246869.1|466644_467217_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_060556807.1|467491_468115_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_060556806.1|468584_469103_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	4.2e-16
WP_060556813.1|469329_472128_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	1.2e-72
>prophage 33
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	490290	492268	3970204		Bacillus_virus(50.0%)	2	NA	NA
WP_060556794.1|490290_491292_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.9e-18
WP_004250066.1|491284_492268_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.5e-17
>prophage 34
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	510969	514079	3970204		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_004246821.1|510969_511593_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.2	1.0e-21
WP_004246820.1|511647_511923_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004246819.1|511952_514079_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.5	2.6e-11
>prophage 35
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	518424	519816	3970204		environmental_Halophage(100.0%)	1	NA	NA
WP_004246815.1|518424_519816_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	77.1	5.1e-53
>prophage 36
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	528295	533126	3970204		Tupanvirus(50.0%)	3	NA	NA
WP_004246802.1|528295_530131_-	ribosome-dependent GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.7	1.6e-22
WP_004246801.1|530490_531900_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004249083.1|532079_533126_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.9	1.7e-08
>prophage 37
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	542128	549971	3970204		Bacillus_phage(60.0%)	8	NA	NA
WP_004246792.1|542128_542851_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	8.3e-31
WP_060556766.1|542850_544191_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.2	3.4e-09
WP_060556765.1|544393_545434_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	36.0	8.8e-50
WP_060556764.1|545509_546469_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_060556763.1|546470_547373_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_175212406.1|547403_548180_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	6.9e-15
WP_017628646.1|548194_548929_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004249074.1|549131_549971_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	65.7	8.3e-06
>prophage 38
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	563244	564000	3970204		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_175212407.1|563244_564000_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.9	3.4e-11
>prophage 39
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	567431	568790	3970204		Moraxella_phage(100.0%)	1	NA	NA
WP_060556747.1|567431_568790_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.4	5.9e-62
>prophage 40
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	596625	598224	3970204		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_060556726.1|596625_597378_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	8.4e-10
WP_060556725.1|597414_598224_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.7	1.2e-09
>prophage 41
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	603795	604362	3970204		Escherichia_phage(100.0%)	1	NA	NA
WP_060556719.1|603795_604362_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	29.9	2.0e-11
>prophage 42
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	611255	617033	3970204		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004246712.1|611255_612218_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.3	2.5e-51
WP_060556712.1|612204_613212_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_004246710.1|613213_613969_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.8	4.3e-14
WP_060556711.1|614040_614367_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_114078337.1|614497_615802_-	MFS transporter	NA	NA	NA	NA	NA
WP_060556710.1|615872_617033_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	29.9	7.6e-34
>prophage 43
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	630048	633107	3970204		Escherichia_phage(100.0%)	2	NA	NA
WP_060556702.1|630048_632469_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.0	1.2e-137
WP_060556701.1|632465_633107_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.5	9.6e-63
>prophage 44
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	638740	639454	3970204		Bacillus_virus(100.0%)	1	NA	NA
WP_004246695.1|638740_639454_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-17
>prophage 45
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	643199	644690	3970204		Aeromonas_phage(100.0%)	1	NA	NA
WP_017827145.1|643199_644690_-	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	26.8	1.3e-22
>prophage 46
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	650645	653586	3970204		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_060556690.1|650645_652016_-	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	23.7	2.1e-06
WP_004246679.1|652029_653586_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	33.3	2.8e-07
>prophage 47
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	675517	687593	3970204	integrase,capsid	Cronobacter_phage(28.57%)	13	674525:674539	698119:698133
674525:674539	attL	AAATATATAAAAATA	NA	NA	NA	NA
WP_012368586.1|675517_676552_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	2.5e-65
WP_135092165.1|677586_677805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167755263.1|678335_678491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135003225.1|678480_678645_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.5	1.8e-05
WP_152118458.1|678995_681698_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.9	9.0e-62
WP_152118457.1|681694_681925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152118459.1|681921_682410_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	62.0	1.6e-38
WP_036918681.1|682501_683035_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	55.7	1.9e-32
WP_152118456.1|683031_684048_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	49.3	4.7e-80
WP_152118455.1|684065_684926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135092153.1|684976_685186_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_152118454.1|685301_686222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152118453.1|686381_687593_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	67.6	3.7e-156
698119:698133	attR	TATTTTTATATATTT	NA	NA	NA	NA
>prophage 48
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	701212	702832	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060556664.1|701212_702832_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	4.9e-140
>prophage 49
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	713267	714383	3970204		Enterobacteria_phage(100.0%)	1	NA	NA
WP_060556654.1|713267_714383_+	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
>prophage 50
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	717813	779547	3970204	tRNA,integrase,transposase	Escherichia_phage(31.25%)	49	719437:719455	768499:768517
WP_060556651.1|717813_718629_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.5	5.3e-66
WP_004246629.1|718673_719348_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_060556650.1|719344_720055_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
719437:719455	attL	AAACTATGCACTAAAAGCA	NA	NA	NA	NA
WP_060556649.1|720056_721085_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060556648.1|721125_721800_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|721917_722541_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_060556647.1|722909_724868_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_060556646.1|725032_725344_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_060556645.1|725340_726996_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_060556644.1|727318_728950_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_060556643.1|728968_729661_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_060556642.1|729664_731083_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_060556641.1|731073_731811_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|737844_738531_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_175212410.1|738611_740009_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_060556638.1|740093_741020_-	ribokinase	NA	NA	NA	NA	NA
WP_060556637.1|741300_742800_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	8.6e-22
WP_060556636.1|742807_744265_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|744265_745258_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|745418_745880_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_060556635.1|745979_746420_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_060556634.1|746799_748698_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_060556633.1|748694_749321_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|749935_750313_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|750344_751169_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|751214_751454_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|751515_751986_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|751998_752532_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_060556632.1|752546_754088_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|754145_755009_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|755043_756426_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|756447_756864_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_060556631.1|757014_758388_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_060556630.1|758544_760371_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	2.1e-131
WP_001029679.1|760530_761352_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|761338_763447_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|763443_765111_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|765913_767488_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_001067855.1|767512_768217_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|768666_770142_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
768499:768517	attR	TGCTTTTAGTGCATAGTTT	NA	NA	NA	NA
WP_000155092.1|770197_771082_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_121523926.1|771271_771505_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001067855.1|771618_772323_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|772512_773328_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|773478_774183_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|774673_775534_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000287615.1|775584_777129_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|777251_778775_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|778761_779547_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
>prophage 51
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	783505	818214	3970204	integrase,transposase	Escherichia_phage(30.77%)	35	773501:773515	819095:819109
773501:773515	attL	ATTTTCAGCGTGACA	NA	NA	NA	NA
WP_000845054.1|783505_784519_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|784721_785072_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|785197_785758_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_046788546.1|788694_789096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|789180_789885_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|790809_791694_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|791916_793131_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|793158_793464_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|793575_795069_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_172767591.1|795099_795342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767592.1|795289_796045_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|796466_797492_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|797720_798497_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|798610_799315_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201164.1|800095_800908_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|800911_801277_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|801281_801920_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|801930_802962_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|802966_803296_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|803489_803780_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|803835_805476_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|805664_807194_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_015056391.1|807404_807689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|808450_809155_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|809260_810466_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|810621_810825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|810952_811792_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|811785_812133_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|812296_813088_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777554.1|813104_813578_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_070342364.1|813574_814420_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000071896.1|814805_815342_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|815456_815783_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|815970_816210_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_060557308.1|817137_818214_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	4.9e-27
819095:819109	attR	ATTTTCAGCGTGACA	NA	NA	NA	NA
>prophage 52
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	838563	838968	3970204		Stx_converting_phage(100.0%)	1	NA	NA
WP_060557314.1|838563_838968_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	53.7	1.0e-22
>prophage 53
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	851386	853430	3970204		Bacillus_virus(50.0%)	2	NA	NA
WP_060557284.1|851386_852292_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.9	9.8e-13
WP_124743929.1|852467_853430_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	3.9e-60
>prophage 54
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	856437	858300	3970204		Tupanvirus(100.0%)	1	NA	NA
WP_060557281.1|856437_858300_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.4e-13
>prophage 55
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	886162	892447	3970204		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_060557262.1|886162_892447_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	1.5e-43
>prophage 56
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	897345	898359	3970204		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_060557258.1|897345_898359_-	hypothetical protein	NA	Q331X4	Clostridium_botulinum_C_phage	30.8	1.2e-14
>prophage 57
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	902226	905494	3970204	integrase	Pseudomonas_phage(50.0%)	3	902862:902875	907429:907442
WP_060557255.1|902226_903900_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.5	5.8e-35
902862:902875	attL	TGCTGATAAGTCTT	NA	NA	NA	NA
WP_060557254.1|903960_904296_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060557253.1|904318_905494_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	24.3	6.6e-09
907429:907442	attR	TGCTGATAAGTCTT	NA	NA	NA	NA
>prophage 58
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	908810	916321	3970204		Staphylococcus_phage(33.33%)	7	NA	NA
WP_012368639.1|908810_909071_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	3.5e-16
WP_004246510.1|909034_909394_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004246509.1|909411_909555_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004246507.1|910277_911678_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004246506.1|911682_912786_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.1	3.8e-51
WP_004246505.1|912797_913886_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_060557250.1|913906_916321_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	55.4	4.5e-12
>prophage 59
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	928116	930725	3970204		Xanthomonas_phage(33.33%)	3	NA	NA
WP_004246490.1|928116_928575_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	6.0e-51
WP_060557240.1|928558_929767_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	1.4e-46
WP_060557239.1|930053_930725_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	27.8	1.0e-19
>prophage 60
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	937471	938778	3970204		Bacillus_phage(50.0%)	2	NA	NA
WP_060557234.1|937471_938296_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.4	9.5e-23
WP_004246474.1|938292_938778_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	6.6e-24
>prophage 61
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	950585	956826	3970204		Synechococcus_phage(25.0%)	5	NA	NA
WP_012368661.1|950585_951524_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	35.3	6.3e-31
WP_060557223.1|951791_952991_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.8e-36
WP_060557222.1|953000_954026_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	8.0e-19
WP_060557221.1|954565_955531_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_060557220.1|955533_956826_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	36.6	7.7e-11
>prophage 62
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	962863	969302	3970204		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_060557215.1|962863_964030_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.2	1.3e-118
WP_060557214.1|964074_965007_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	31.4	7.8e-05
WP_060557213.1|965009_965744_-	DUF2837 family protein	NA	NA	NA	NA	NA
WP_060557212.1|965727_967038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557311.1|967027_967813_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.2	1.5e-12
WP_060557211.1|967805_968891_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_060557210.1|968909_969302_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	49.3	2.7e-28
>prophage 63
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	973410	976925	3970204		Moumouvirus(33.33%)	3	NA	NA
WP_060557206.1|973410_974511_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.1	3.1e-21
WP_036919531.1|974822_976214_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_004246432.1|976226_976925_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
>prophage 64
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	985571	989260	3970204		Salmonella_phage(50.0%)	3	NA	NA
WP_060557199.1|985571_986759_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.9	2.6e-13
WP_004246422.1|986869_988402_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|988444_989260_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
>prophage 65
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	992429	993770	3970204		Erwinia_phage(100.0%)	1	NA	NA
WP_004246417.1|992429_993770_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
>prophage 66
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1009434	1012378	3970204		Hokovirus(50.0%)	2	NA	NA
WP_060557191.1|1009434_1010865_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.0	4.0e-61
WP_060554986.1|1010875_1012378_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	3.7e-57
>prophage 67
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1017249	1018974	3970204		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004246391.1|1017249_1018974_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
>prophage 68
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1030340	1032194	3970204		Acinetobacter_phage(100.0%)	1	NA	NA
WP_060557310.1|1030340_1032194_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	25.5	2.3e-08
>prophage 69
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1041190	1044296	3970204		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004246971.1|1041190_1042138_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.5	4.2e-30
WP_124743347.1|1043111_1044296_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
>prophage 70
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1063611	1067531	3970204	tRNA	Prochlorococcus_phage(25.0%)	5	NA	NA
WP_060558448.1|1063611_1064562_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	2.8e-10
WP_004246933.1|1064588_1065104_-	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	39.6	1.4e-16
WP_060558450.1|1065235_1066393_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	31.5	5.4e-32
WP_049196684.1|1066411_1066969_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_004249883.1|1066961_1067531_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.6	2.4e-09
>prophage 71
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1079270	1080920	3970204		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_060557406.1|1079270_1080920_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.2	2.9e-63
>prophage 72
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1089100	1094453	3970204		Bacillus_phage(33.33%)	4	NA	NA
WP_060557400.1|1089100_1091122_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	9.0e-115
WP_004246357.1|1091196_1092705_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_060557399.1|1092708_1094007_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	28.7	3.8e-34
WP_004246355.1|1094126_1094453_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.4	6.6e-20
>prophage 73
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1098971	1105148	3970204		Catovirus(20.0%)	6	NA	NA
WP_004246349.1|1098971_1100102_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.2	1.1e-29
WP_060557396.1|1100098_1101361_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	25.6	1.3e-23
WP_173020899.1|1101351_1102425_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.3	9.3e-103
WP_004249667.1|1102443_1103325_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	8.4e-110
WP_060557395.1|1103302_1104016_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_060557394.1|1104017_1105148_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	37.8	1.2e-20
>prophage 74
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1121580	1125522	3970204		Brevibacillus_phage(50.0%)	3	NA	NA
WP_060557382.1|1121580_1122504_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	25.4	4.8e-23
WP_046335068.1|1122503_1123220_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_060557381.1|1123365_1125522_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	2.3e-116
>prophage 75
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1128808	1130638	3970204		Catovirus(100.0%)	1	NA	NA
WP_060557376.1|1128808_1130638_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.3	1.2e-86
>prophage 76
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1145240	1145786	3970204		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_060557367.1|1145240_1145786_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.9e-28
>prophage 77
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1149177	1152528	3970204		Vibrio_phage(50.0%)	2	NA	NA
WP_060557364.1|1149177_1150494_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	33.3	6.2e-16
WP_060557363.1|1150515_1152528_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.7	8.2e-60
>prophage 78
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1158040	1162721	3970204		Cedratvirus(50.0%)	3	NA	NA
WP_004249629.1|1158040_1159339_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.4e-65
WP_004249627.1|1159764_1160193_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_060557360.1|1160231_1162721_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
>prophage 79
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1185113	1186848	3970204		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004246260.1|1185113_1185641_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	4.2e-56
WP_004249610.1|1185840_1186848_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.4	4.4e-70
>prophage 80
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1190421	1192733	3970204		Vibrio_phage(25.0%)	4	NA	NA
WP_004246255.1|1190421_1190688_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.2	8.6e-18
WP_004246254.1|1190872_1191220_+	putative DNA-binding transcriptional regulator	NA	A0A1C6ZDN4	Pseudomonas_phage	50.0	1.2e-06
WP_004246253.1|1191298_1191715_+	putative DNA-binding transcriptional regulator	NA	C9DGL1	Escherichia_phage	53.8	3.9e-09
WP_060557344.1|1191761_1192733_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	1.4e-09
>prophage 81
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1198561	1201435	3970204	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_060557341.1|1198561_1200511_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.8	1.4e-117
WP_004246242.1|1200592_1201435_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.8e-16
>prophage 82
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1205774	1208525	3970204		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_060557340.1|1205774_1208525_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.1e-26
>prophage 83
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1214153	1219418	3970204		Catovirus(50.0%)	4	NA	NA
WP_026090516.1|1214153_1215989_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	7.2e-55
WP_060557336.1|1216597_1216972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246223.1|1216995_1217712_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_060557335.1|1217714_1219418_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	69.9	1.9e-214
>prophage 84
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1226191	1233473	3970204		Trichoplusia_ni_ascovirus(25.0%)	9	NA	NA
WP_060557327.1|1226191_1226473_-	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.2	4.7e-14
WP_060557326.1|1226759_1227011_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_060557325.1|1227126_1227567_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_004249586.1|1228152_1228362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246203.1|1228388_1228853_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	5.0e-53
WP_004246202.1|1228857_1230996_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_004246200.1|1231341_1231728_-	RidA family protein	NA	NA	NA	NA	NA
WP_004246198.1|1232065_1232524_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_060557324.1|1232537_1233473_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.7e-52
>prophage 85
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1238822	1243763	3970204	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_060558174.1|1238822_1241711_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	1.3e-146
WP_004246185.1|1241724_1242174_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_060558172.1|1242254_1243763_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	2.4e-48
>prophage 86
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1249210	1253018	3970204		Streptococcus_phage(66.67%)	4	NA	NA
WP_131728035.1|1249210_1249489_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	51.9	2.4e-10
WP_060558165.1|1249548_1249893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558164.1|1249973_1251278_-	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	51.3	2.8e-109
WP_175212445.1|1251641_1253018_+	AAA family ATPase	NA	M1NSM1	Streptococcus_phage	32.0	9.9e-49
>prophage 87
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1257377	1258514	3970204		Mycobacterium_phage(100.0%)	1	NA	NA
WP_060558160.1|1257377_1258514_-	RNA ligase RtcB family protein	NA	R4TNH6	Mycobacterium_phage	27.3	1.4e-27
>prophage 88
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1266031	1273158	3970204		Micromonas_sp._RCC1109_virus(33.33%)	6	NA	NA
WP_060558141.1|1266031_1267726_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.8	3.1e-60
WP_004246140.1|1267729_1268014_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_060558139.1|1268064_1268961_-	cation transporter	NA	NA	NA	NA	NA
WP_004246138.1|1269037_1269616_-	helix-turn-helix transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	41.7	8.2e-05
WP_060558137.1|1269854_1271042_+	MFS transporter	NA	NA	NA	NA	NA
WP_004246136.1|1271811_1273158_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.7	4.4e-158
>prophage 89
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1286956	1290309	3970204		Micromonas_pusilla_virus(50.0%)	4	NA	NA
WP_060558118.1|1286956_1288594_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	33.2	1.3e-39
WP_004246118.1|1288719_1288986_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_060558116.1|1288989_1289520_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004249525.1|1289523_1290309_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.2	3.6e-27
>prophage 90
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1299330	1299951	3970204		Streptococcus_phage(100.0%)	1	NA	NA
WP_004246103.1|1299330_1299951_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.8	9.7e-20
>prophage 91
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1317256	1317919	3970204		Bacillus_phage(100.0%)	1	NA	NA
WP_004245430.1|1317256_1317919_-	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	28.3	5.9e-07
>prophage 92
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1325243	1326797	3970204		Escherichia_phage(100.0%)	1	NA	NA
WP_004245426.1|1325243_1326797_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	33.3	2.4e-19
>prophage 93
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1343492	1345811	3970204		Tupanvirus(50.0%)	2	NA	NA
WP_060557727.1|1343492_1344470_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	20.8	1.6e-05
WP_060557728.1|1344731_1345811_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	4.6e-09
>prophage 94
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1353405	1354545	3970204		Vibrio_phage(50.0%)	2	NA	NA
WP_004245400.1|1353405_1354080_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.9	3.6e-60
WP_060557733.1|1354290_1354545_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	4.1e-09
>prophage 95
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1359643	1362837	3970204		Streptococcus_phage(50.0%)	2	NA	NA
WP_060557736.1|1359643_1362040_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	4.7e-131
WP_004248875.1|1362210_1362837_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	44.2	5.0e-16
>prophage 96
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1366364	1370438	3970204		Staphylococcus_phage(33.33%)	4	NA	NA
WP_060557741.1|1366364_1367030_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	9.4e-13
WP_004248880.1|1367022_1368000_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004245383.1|1368340_1369195_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	2.5e-42
WP_060557742.1|1369289_1370438_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.2	1.8e-43
>prophage 97
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1373900	1374995	3970204		Planktothrix_phage(100.0%)	1	NA	NA
WP_060557747.1|1373900_1374995_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	3.4e-20
>prophage 98
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1390587	1391631	3970204		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245330.1|1390587_1391631_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
>prophage 99
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1405533	1414399	3970204		Thermobifida_phage(20.0%)	11	NA	NA
WP_004245308.1|1405533_1406388_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_004245307.1|1406472_1406940_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004248916.1|1407096_1407384_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_060557765.1|1407407_1408883_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004245304.1|1408942_1409668_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_004245303.1|1409674_1410208_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_060557766.1|1410188_1410767_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_060557767.1|1410784_1411342_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.9	3.0e-52
WP_060557768.1|1411369_1412356_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	9.6e-38
WP_004252691.1|1412361_1413342_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004245298.1|1413586_1414399_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
>prophage 100
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1422137	1424792	3970204		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_017628225.1|1422137_1423208_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
WP_020945150.1|1423400_1424792_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
>prophage 101
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1429311	1429821	3970204	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_060557775.1|1429311_1429821_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.6e-23
>prophage 102
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1440683	1443020	3970204		Hokovirus(100.0%)	1	NA	NA
WP_004245272.1|1440683_1443020_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.0	4.0e-42
>prophage 103
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1451709	1455517	3970204		Caulobacter_phage(50.0%)	4	NA	NA
WP_004245257.1|1451709_1452300_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	5.6e-09
WP_004245256.1|1452322_1452700_-	YraN family protein	NA	NA	NA	NA	NA
WP_060557788.1|1452804_1454577_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_060557789.1|1454638_1455517_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.5	6.7e-51
>prophage 104
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1468045	1469755	3970204		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_175212418.1|1468045_1469755_-	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.5	1.4e-07
>prophage 105
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1475281	1481897	3970204		Klosneuvirus(33.33%)	6	NA	NA
WP_060557801.1|1475281_1476949_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.6	7.1e-41
WP_060557802.1|1477290_1479210_+	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	37.5	2.6e-07
WP_060557803.1|1479311_1479623_+	trp operon repressor	NA	NA	NA	NA	NA
WP_004248953.1|1479712_1480252_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_004245229.1|1480303_1480951_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_060557804.1|1480994_1481897_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.2	1.5e-08
>prophage 106
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1498529	1499483	3970204		Cyanophage(100.0%)	1	NA	NA
WP_060557810.1|1498529_1499483_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.4	1.1e-11
>prophage 107
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1514840	1526218	3970204	tRNA	Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
WP_060557815.1|1514840_1516766_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.2	4.2e-146
WP_004245212.1|1516871_1518008_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.7	2.8e-17
WP_060557816.1|1518082_1518928_-	EamA family transporter	NA	NA	NA	NA	NA
WP_060557817.1|1519384_1520557_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	48.9	5.6e-85
WP_060557818.1|1520751_1521669_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004248964.1|1521742_1522003_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_060557819.1|1522433_1523375_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_060557820.1|1523404_1526218_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.1	1.6e-85
>prophage 108
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1529711	1530875	3970204		Halovirus(100.0%)	1	NA	NA
WP_060557824.1|1529711_1530875_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	2.0e-50
>prophage 109
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1542190	1543021	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060557827.1|1542190_1543021_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.9	1.0e-64
>prophage 110
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1546147	1547341	3970204		Orpheovirus(100.0%)	1	NA	NA
WP_060557831.1|1546147_1547341_-	cystathionine beta-lyase	NA	A0A2I2L687	Orpheovirus	21.8	2.3e-09
>prophage 111
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1562311	1563220	3970204		Salmonella_phage(100.0%)	1	NA	NA
WP_060557841.1|1562311_1563220_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	55.9	1.2e-90
>prophage 112
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1571391	1578573	3970204		Bacillus_phage(66.67%)	4	NA	NA
WP_155195808.1|1571391_1575117_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	25.2	3.8e-10
WP_060557848.1|1575113_1576346_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_004249004.1|1576567_1577257_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	40.7	6.1e-39
WP_060557850.1|1577280_1578573_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.6	9.1e-28
>prophage 113
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1592539	1599420	3970204	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
WP_004245143.1|1592539_1593682_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	4.2e-93
WP_004245142.1|1593768_1594104_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.9e-10
WP_012367466.1|1594136_1595984_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004247209.1|1595994_1596963_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	2.0e-48
WP_004245139.1|1597081_1597531_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_060557859.1|1597579_1598737_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	8.9e-51
WP_004245137.1|1598949_1599420_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.6e-30
>prophage 114
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1606459	1607968	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060557872.1|1606459_1607968_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	2.7e-15
>prophage 115
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1624981	1637945	3970204	protease,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(14.29%)	11	NA	NA
WP_060557893.1|1624981_1626355_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.0	2.3e-61
WP_060557895.1|1626454_1627975_-	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
WP_060557897.1|1628032_1628611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175212420.1|1628805_1629222_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
WP_175212421.1|1629244_1630444_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.2	4.9e-185
WP_060557538.1|1630598_1630913_+	transcriptional regulator BolA	NA	NA	NA	NA	NA
WP_060557537.1|1631235_1632540_+	trigger factor	NA	NA	NA	NA	NA
WP_004245088.1|1632796_1633420_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
WP_004245087.1|1633563_1634835_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	7.3e-131
WP_004245086.1|1635093_1637448_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	5.2e-223
WP_004247229.1|1637669_1637945_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	6.0e-22
>prophage 116
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1641735	1646629	3970204		Bacillus_phage(66.67%)	4	NA	NA
WP_004245081.1|1641735_1642434_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.2	5.3e-83
WP_004245080.1|1642591_1643053_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_060557534.1|1643109_1644855_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	8.4e-53
WP_060557533.1|1644841_1646629_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	8.1e-43
>prophage 117
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1661396	1664152	3970204		Klosneuvirus(50.0%)	2	NA	NA
WP_060557526.1|1661396_1661948_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	9.5e-27
WP_060557525.1|1662175_1664152_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.2	1.0e-46
>prophage 118
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1684890	1689674	3970204		Mamastrovirus(33.33%)	4	NA	NA
WP_060557515.1|1684890_1686471_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	53.2	3.6e-18
WP_004245039.1|1686629_1687172_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.3	1.7e-15
WP_020945227.1|1687228_1687882_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_060557514.1|1688732_1689674_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	2.7e-21
>prophage 119
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1694845	1695397	3970204		Escherichia_phage(100.0%)	1	NA	NA
WP_004245030.1|1694845_1695397_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.2	7.2e-35
>prophage 120
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1703002	1703299	3970204		Morganella_phage(100.0%)	1	NA	NA
WP_060557500.1|1703002_1703299_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.0	2.5e-05
>prophage 121
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1709859	1710900	3970204		Bacillus_virus(100.0%)	1	NA	NA
WP_060557495.1|1709859_1710900_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-31
>prophage 122
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1720846	1726786	3970204		unidentified_phage(50.0%)	5	NA	NA
WP_072196796.1|1720846_1722430_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.3	7.4e-24
WP_060557487.1|1722517_1722847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244998.1|1722908_1723364_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_060557486.1|1723560_1724271_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_060557485.1|1724356_1726786_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	32.1	1.1e-42
>prophage 123
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1730885	1731230	3970204		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004244992.1|1730885_1731230_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	2.0e-27
>prophage 124
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1735050	1736376	3970204		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_060557480.1|1735050_1736376_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.4	6.0e-35
>prophage 125
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1740092	1743096	3970204		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_004244983.1|1740092_1741730_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	9.7e-152
WP_004244982.1|1741794_1743096_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.2	6.8e-132
>prophage 126
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1746699	1750942	3970204		Lactobacillus_virus(33.33%)	5	NA	NA
WP_060557475.1|1746699_1748034_-	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	37.4	1.8e-07
WP_060557474.1|1748107_1748863_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_060557473.1|1748900_1749614_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_060557472.1|1749638_1750118_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	1.2e-49
WP_060557471.1|1750183_1750942_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	1.2e-40
>prophage 127
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1758560	1759355	3970204		Indivirus(100.0%)	1	NA	NA
WP_060557465.1|1758560_1759355_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.2	5.1e-13
>prophage 128
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1764490	1766919	3970204		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_060557461.1|1764490_1765894_+	Y4yA family PLP-dependent enzyme	NA	A0A0P0YN97	Yellowstone_lake_phycodnavirus	25.5	1.4e-05
WP_060557460.1|1765905_1766919_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	34.4	7.8e-35
>prophage 129
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1776986	1777199	3970204		Enterococcus_phage(100.0%)	1	NA	NA
WP_060557452.1|1776986_1777199_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	62.2	1.0e-05
>prophage 130
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1781168	1783172	3970204	holin	Vibrio_phage(100.0%)	1	NA	NA
WP_004244946.1|1781168_1783172_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.0	8.0e-23
>prophage 131
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1792680	1794135	3970204		Morganella_phage(50.0%)	2	NA	NA
WP_174815533.1|1792680_1793004_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.8	1.1e-06
WP_060557439.1|1793568_1794135_-	phase variation DNA invertase MrpI	NA	A0A2L1IV36	Escherichia_phage	52.4	4.3e-51
>prophage 132
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1801925	1802249	3970204		Morganella_phage(100.0%)	1	NA	NA
WP_004244917.1|1801925_1802249_+	transcriptional regulator MrpJ	NA	A0A1W6JNW5	Morganella_phage	55.3	1.6e-05
>prophage 133
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1810524	1812264	3970204		Bacillus_phage(100.0%)	1	NA	NA
WP_060557425.1|1810524_1812264_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.2	4.2e-28
>prophage 134
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1839492	1841658	3970204		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_060556545.1|1839492_1841658_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	2.3e-28
>prophage 135
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1849898	1850969	3970204		Bacillus_phage(100.0%)	1	NA	NA
WP_004244838.1|1849898_1850969_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
>prophage 136
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1857772	1858366	3970204		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_060556560.1|1857772_1858366_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.0	8.1e-16
>prophage 137
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1872934	1873513	3970204		Caulobacter_phage(100.0%)	1	NA	NA
WP_004244807.1|1872934_1873513_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.5e-14
>prophage 138
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1892139	1894508	3970204		Streptococcus_phage(100.0%)	2	NA	NA
WP_004247396.1|1892139_1893243_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	9.7e-63
WP_060556584.1|1893254_1894508_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.9	1.2e-98
>prophage 139
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1898662	1904278	3970204	tRNA	Pseudomonas_phage(25.0%)	4	NA	NA
WP_060556586.1|1898662_1899169_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	42.8	1.3e-27
WP_060556587.1|1899276_1900344_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	1.8e-114
WP_060556588.1|1901244_1903872_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.1	7.6e-82
WP_004244778.1|1904089_1904278_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	63.2	1.3e-12
>prophage 140
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1914160	1915249	3970204		Klebsiella_phage(100.0%)	1	NA	NA
WP_173020901.1|1914160_1915249_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	51.7	1.0e-88
>prophage 141
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1923483	1926060	3970204		Cronobacter_phage(100.0%)	1	NA	NA
WP_060556599.1|1923483_1926060_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.0	1.0e-126
>prophage 142
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1953473	1966875	3970204		Mycobacterium_phage(22.22%)	14	NA	NA
WP_060556952.1|1953473_1954673_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.3e-28
WP_060556953.1|1955282_1956251_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.3	2.4e-134
WP_072196779.1|1956276_1958403_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_060556954.1|1958431_1958836_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	2.8e-12
WP_004246071.1|1958847_1959072_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_060556955.1|1959353_1959827_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1960024_1960234_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|1960537_1961026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1961628_1962003_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1962018_1962984_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_107033958.1|1963085_1963730_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1964065_1964329_-	YbeD family protein	NA	NA	NA	NA	NA
WP_060556957.1|1964527_1965739_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.4	2.9e-105
WP_175212425.1|1965861_1966875_-	endolytic peptidoglycan transglycosylase RlpA	NA	H2BCY4	Synechococcus_phage	45.5	2.0e-06
>prophage 143
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1974150	1977818	3970204	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_060556963.1|1974150_1976733_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.2	2.4e-189
WP_060556964.1|1977092_1977818_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.6e-29
>prophage 144
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1983837	1984341	3970204		Streptomyces_phage(100.0%)	1	NA	NA
WP_060556969.1|1983837_1984341_+	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	36.8	9.3e-05
>prophage 145
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1988052	1989114	3970204		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004246031.1|1988052_1989114_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	2.5e-47
>prophage 146
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	1992905	1994018	3970204		Synechococcus_phage(100.0%)	1	NA	NA
WP_004246024.1|1992905_1994018_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	7.3e-34
>prophage 147
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2001627	2003295	3970204	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_012367653.1|2001627_2003295_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
>prophage 148
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2008324	2012484	3970204		Mycobacterium_phage(50.0%)	4	NA	NA
WP_175212426.1|2008324_2009110_-	esterase	NA	A0A1L5C1K3	Mycobacterium_phage	36.4	3.5e-06
WP_004244392.1|2009575_2010127_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_060556980.1|2010201_2011845_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_060556981.1|2012001_2012484_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.4	9.4e-39
>prophage 149
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2016782	2017937	3970204		Enterobacteria_phage(100.0%)	1	NA	NA
WP_060556984.1|2016782_2017937_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	42.0	5.5e-61
>prophage 150
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2030552	2032319	3970204		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004244416.1|2030552_2032319_+	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.5	5.8e-17
>prophage 151
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2054354	2066131	3970204		Vibrio_phage(25.0%)	5	NA	NA
WP_060557157.1|2054354_2055074_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	34.0	8.3e-23
WP_060557000.1|2055317_2056373_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	6.8e-82
WP_004244443.1|2056448_2057201_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_060557001.1|2057551_2059018_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	23.4	1.9e-10
WP_060557002.1|2060764_2066131_+	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.4	2.1e-06
>prophage 152
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2072776	2077200	3970204		Planktothrix_phage(50.0%)	4	NA	NA
WP_004244454.1|2072776_2073841_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.7	6.3e-19
WP_060557009.1|2073906_2074728_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_060557010.1|2074876_2075866_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_060557011.1|2075922_2077200_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	8.4e-18
>prophage 153
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2084672	2085608	3970204		Streptococcus_phage(100.0%)	1	NA	NA
WP_060557017.1|2084672_2085608_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	4.0e-25
>prophage 154
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2089861	2098809	3970204		Burkholderia_phage(33.33%)	7	NA	NA
WP_060557021.1|2089861_2091280_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	28.7	2.7e-09
WP_060557022.1|2091345_2092455_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060557023.1|2092470_2093622_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060557024.1|2093614_2095384_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-22
WP_004247573.1|2095404_2096391_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_020945379.1|2096408_2097107_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_155195693.1|2097417_2098809_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	2.9e-56
>prophage 155
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2108713	2113484	3970204		Bacillus_phage(33.33%)	4	NA	NA
WP_060557033.1|2108713_2110822_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.4	9.8e-48
WP_060557034.1|2110882_2111389_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	26.3	2.6e-07
WP_060557035.1|2111666_2112557_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_060557036.1|2112905_2113484_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.5	7.6e-19
>prophage 156
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2119523	2120186	3970204		Vibrio_phage(100.0%)	1	NA	NA
WP_004244504.1|2119523_2120186_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.4	7.6e-55
>prophage 157
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2126505	2131363	3970204	tRNA	Catovirus(66.67%)	4	NA	NA
WP_060557044.1|2126505_2128533_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	6.0e-26
WP_004247590.1|2128737_2129850_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004247591.1|2130063_2130705_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_060557045.1|2130781_2131363_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.1	9.7e-30
>prophage 158
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2135283	2141356	3970204	tRNA	Moraxella_phage(33.33%)	5	NA	NA
WP_060557048.1|2135283_2136864_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	2.9e-36
WP_060557049.1|2137108_2138515_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.3	8.6e-32
WP_004244520.1|2138633_2139131_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_060557050.1|2139444_2140596_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_060557051.1|2140738_2141356_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.6	4.2e-15
>prophage 159
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2146968	2151171	3970204		Cellulophaga_phage(50.0%)	4	NA	NA
WP_004252065.1|2146968_2147868_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	86.8	5.0e-09
WP_004244530.1|2148373_2149195_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244532.1|2149191_2149812_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_060557056.1|2149968_2151171_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	49.9	4.4e-101
>prophage 160
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2158565	2164167	3970204		Vibrio_phage(33.33%)	8	NA	NA
WP_004244541.1|2158565_2158829_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
WP_060557062.1|2158999_2159302_+	YbjC family protein	NA	NA	NA	NA	NA
WP_060557159.1|2159471_2159978_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_060557063.1|2160006_2161140_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.7e-22
WP_012367697.1|2161286_2161955_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_060557064.1|2161954_2162659_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244550.1|2162689_2163424_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060557160.1|2163438_2164167_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
>prophage 161
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2169968	2251111	3970204	tRNA,protease,plate	Bacillus_phage(15.79%)	59	NA	NA
WP_060557067.1|2169968_2171912_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.1e-37
WP_004244557.1|2172075_2172285_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.4e-15
WP_060557068.1|2172574_2172889_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.2e-13
WP_060557069.1|2172919_2175214_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.0e-170
WP_004244560.1|2175333_2175552_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_060557070.1|2175871_2176564_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_060557071.1|2176565_2178317_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
WP_060557072.1|2178319_2180089_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.9	1.7e-21
WP_060557073.1|2180230_2181190_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.5e-64
WP_004244566.1|2181732_2182227_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_175212430.1|2182354_2186164_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_175212431.1|2186276_2186882_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_060557161.1|2186892_2188242_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	6.9e-79
WP_060557076.1|2188374_2189664_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	9.2e-97
WP_081045311.1|2189845_2190178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557077.1|2190578_2191628_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_060557078.1|2191700_2192597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557079.1|2192957_2193698_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	1.4e-20
WP_060557080.1|2193805_2196088_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	7.9e-160
WP_004244577.1|2196142_2196997_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_060557081.1|2197667_2199425_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_060557082.1|2199652_2200690_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_060557083.1|2200765_2202031_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060557084.1|2202165_2203599_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.7	1.5e-07
WP_060557085.1|2203735_2204824_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	4.4e-84
WP_060557086.1|2205020_2206307_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|2206595_2207273_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|2207454_2209128_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|2209192_2209480_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_060557087.1|2209897_2212267_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	31.6	1.9e-23
WP_004244589.1|2212303_2214049_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_060557088.1|2214045_2215047_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|2215543_2215759_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|2216173_2216353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|2216357_2217119_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_175212432.1|2217227_2218073_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|2218452_2219226_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|2219235_2220558_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_060557090.1|2220538_2221267_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_060557091.1|2221263_2225721_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060557092.1|2226022_2226676_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	78.3	8.4e-99
WP_004247637.1|2227098_2227812_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_060557093.1|2228147_2229863_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|2230195_2230744_+	YcbK family protein	NA	NA	NA	NA	NA
WP_049208325.1|2230787_2231438_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|2231530_2232004_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_060557094.1|2232094_2233831_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_060557095.1|2233823_2235179_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060557096.1|2235216_2238765_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_060557097.1|2238767_2240231_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_060557098.1|2240236_2240887_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|2240888_2241677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557099.1|2241680_2244392_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	9.0e-86
WP_060557100.1|2244400_2245156_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_060557101.1|2245148_2246507_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|2246508_2247060_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_060557163.1|2247061_2248330_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_060557102.1|2248334_2249372_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_060557103.1|2249335_2251111_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 162
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2264561	2266139	3970204	integrase,transposase	uncultured_Caudovirales_phage(50.0%)	3	2265204:2265217	2269257:2269270
WP_081045313.1|2264561_2265089_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	56.4	4.4e-13
WP_049202934.1|2265081_2265417_+	hypothetical protein	NA	NA	NA	NA	NA
2265204:2265217	attL	TAGTTATTCAATTA	NA	NA	NA	NA
WP_081045314.1|2265620_2266139_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A059NT83	Lactococcus_phage	32.3	4.9e-09
WP_081045314.1|2265620_2266139_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A059NT83	Lactococcus_phage	32.3	4.9e-09
2269257:2269270	attR	TAGTTATTCAATTA	NA	NA	NA	NA
>prophage 163
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2274518	2275995	3970204		Clostridium_phage(50.0%)	3	NA	NA
WP_175212379.1|2274518_2274938_+	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	37.9	2.0e-13
WP_060557115.1|2274948_2275266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114078342.1|2275470_2275995_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	65.3	1.8e-14
>prophage 164
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2280511	2287820	3970204	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_120655562.1|2280511_2281624_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	6.0e-97
WP_017628416.1|2281968_2283369_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.6	6.9e-82
WP_004244665.1|2283442_2283634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244666.1|2283648_2284863_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_060557121.1|2285204_2287820_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	5.7e-21
>prophage 165
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2293439	2295371	3970204		Tupanvirus(100.0%)	1	NA	NA
WP_060557126.1|2293439_2295371_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
>prophage 166
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2309011	2311063	3970204		Bacillus_phage(100.0%)	1	NA	NA
WP_060557133.1|2309011_2311063_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.7	1.0e-17
>prophage 167
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2315398	2318548	3970204		Indivirus(100.0%)	4	NA	NA
WP_175212433.1|2315398_2316343_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
WP_004247011.1|2316342_2316648_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_060557140.1|2316792_2317689_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060557141.1|2317738_2318548_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	38.3	1.8e-42
>prophage 168
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2323832	2325428	3970204		Morganella_phage(100.0%)	2	NA	NA
WP_004247021.1|2323832_2324045_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
WP_060557146.1|2324501_2325428_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	64.7	1.7e-97
>prophage 169
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2330836	2373020	3970204	integrase,plate,head,terminase,lysis	Burkholderia_phage(21.95%)	56	2331642:2331666	2355054:2355078
WP_004247034.1|2330836_2331250_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
WP_060557166.1|2331296_2331482_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	8.4e-12
2331642:2331666	attL	CGGTCAGCATTCACAACTGACTTAT	NA	NA	NA	NA
WP_060557150.1|2332324_2333911_+	hypothetical protein	NA	P79669	Escherichia_phage	88.3	3.8e-278
WP_060557151.1|2334148_2335324_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	32.2	5.5e-32
WP_020945460.1|2335325_2335538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945461.1|2335952_2336123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|2336150_2336330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945462.1|2336377_2336878_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.0	3.6e-41
WP_087740825.1|2336877_2338845_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.5	6.4e-118
WP_004250523.1|2338857_2339118_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_004250525.1|2339117_2339450_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.6e-05
WP_060556278.1|2339707_2339908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556279.1|2339904_2340285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740824.1|2340635_2341328_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.8	2.4e-51
WP_049219173.1|2341434_2341680_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020945464.1|2341728_2342184_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_004250533.1|2342201_2342426_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_036895394.1|2342427_2343279_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.4	8.0e-33
WP_036895392.1|2343271_2343865_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_175212434.1|2343857_2345231_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_060556541.1|2345379_2346789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556540.1|2346896_2347490_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	5.6e-57
WP_060556640.1|2347501_2347813_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.3e-33
WP_087740823.1|2347847_2348396_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	8.2e-31
WP_175212380.1|2348523_2348844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250554.1|2348978_2349176_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
WP_155195676.1|2349318_2350365_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.4	2.4e-143
WP_004250558.1|2350633_2350903_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_060557316.1|2350902_2351373_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.2	8.9e-50
WP_162837620.1|2351354_2351513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557317.1|2351515_2351983_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.0	6.0e-22
WP_060557318.1|2352013_2352250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740821.1|2352383_2353412_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	1.1e-36
WP_060556612.1|2353600_2354998_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	5.6e-84
WP_087740820.1|2355002_2356505_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.6	2.1e-100
2355054:2355078	attR	CGGTCAGCATTCACAACTGACTTAT	NA	NA	NA	NA
WP_087741162.1|2356542_2357256_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.7	1.4e-33
WP_087740819.1|2357252_2358512_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
WP_036908136.1|2358511_2359009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740818.1|2359008_2360076_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	8.8e-53
WP_060556539.1|2360145_2360487_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	1.2e-08
WP_080047799.1|2360489_2360921_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	3.3e-11
WP_004250581.1|2360920_2361379_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250582.1|2361378_2361750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557411.1|2361736_2362252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740817.1|2362260_2363748_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	38.1	6.6e-83
WP_004250586.1|2363758_2364211_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|2364251_2364710_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_087740816.1|2364793_2367145_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.8	2.6e-17
WP_087740815.1|2367146_2367674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|2367673_2367991_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_087740814.1|2367956_2368772_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.3	1.1e-10
WP_175212435.1|2368774_2369467_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|2369463_2369808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740813.1|2369800_2370988_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.3	1.1e-69
WP_004250603.1|2370984_2371641_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_087740812.1|2371646_2373020_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	38.0	2.2e-16
>prophage 170
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2377023	2384067	3970204		Vibrio_phage(50.0%)	7	NA	NA
WP_004247043.1|2377023_2378028_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.9	7.4e-86
WP_004247799.1|2378111_2378396_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_060556895.1|2378536_2380300_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.0	5.3e-95
WP_004247801.1|2380494_2381199_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_060556890.1|2381234_2382419_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.9	4.7e-23
WP_004247049.1|2382934_2383282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556889.1|2383452_2384067_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.9	2.0e-09
>prophage 171
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2389270	2390116	3970204		Catovirus(100.0%)	1	NA	NA
WP_060556884.1|2389270_2390116_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	1.6e-25
>prophage 172
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2394820	2396803	3970204		Acinetobacter_phage(100.0%)	1	NA	NA
WP_060556880.1|2394820_2396803_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	27.6	3.1e-11
>prophage 173
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2402450	2404100	3970204		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_060556878.1|2402450_2404100_-	alpha-keto acid decarboxylase family protein	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.3	5.4e-17
>prophage 174
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2421082	2422211	3970204		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_060556871.1|2421082_2421817_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.2e-14
WP_004247087.1|2421974_2422211_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	1.5e-10
>prophage 175
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2425541	2426186	3970204		Erwinia_phage(100.0%)	1	NA	NA
WP_060556867.1|2425541_2426186_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.9	5.3e-21
>prophage 176
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2440006	2442906	3970204		Planktothrix_phage(50.0%)	3	NA	NA
WP_004247832.1|2440006_2440711_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.8	2.5e-32
WP_004247833.1|2440710_2441958_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_060556856.1|2442048_2442906_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.9	1.1e-21
>prophage 177
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2448423	2487921	3970204	tRNA,protease,integrase,tail,portal,capsid,head,terminase,lysis	Morganella_phage(25.0%)	50	2450115:2450133	2471568:2471586
WP_060556851.1|2448423_2449794_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.2e-112
WP_060556850.1|2449826_2450456_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
2450115:2450133	attL	AGATATTTTTTGTGATAAA	NA	NA	NA	NA
WP_060556849.1|2450458_2451562_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|2451667_2452120_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060556848.1|2452112_2452742_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|2452880_2454134_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_104836382.1|2454243_2455377_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	1.4e-154
WP_087803552.1|2455351_2455603_-	excisionase	NA	NA	NA	NA	NA
WP_049219749.1|2455688_2456213_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.0	2.3e-54
WP_175212437.1|2456358_2456502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081353450.1|2456734_2457166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233779.1|2457155_2459030_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	26.7	5.4e-13
WP_103004815.1|2459126_2459783_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	73.5	1.3e-86
WP_103004814.1|2459878_2460106_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	50.0	7.9e-12
WP_104836383.1|2460144_2460621_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	1.8e-45
WP_017628377.1|2460882_2461062_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_104836862.1|2461619_2462135_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_098943240.1|2462156_2462963_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	4.0e-90
WP_115370361.1|2462959_2463985_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	1.9e-84
WP_104836385.1|2464012_2464411_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	53.5	1.6e-31
WP_004244726.1|2464751_2464964_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_104836386.1|2465295_2465754_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_104836387.1|2466366_2467920_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	26.4	2.4e-19
WP_175212448.1|2468828_2469041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836388.1|2469521_2469944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|2470009_2470279_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_104836389.1|2470278_2470749_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	8.9e-50
WP_104836390.1|2470891_2471353_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	4.8e-24
WP_036937625.1|2471625_2471829_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
2471568:2471586	attR	AGATATTTTTTGTGATAAA	NA	NA	NA	NA
WP_036937622.1|2472655_2473168_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	65.7	1.9e-58
WP_036976739.1|2473249_2473657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937620.1|2473653_2473992_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	8.3e-42
WP_017628364.1|2474109_2474577_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|2474530_2476264_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|2476263_2477532_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|2477549_2478218_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|2478221_2479388_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|2479426_2479726_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|2479725_2480055_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|2480044_2480518_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|2480523_2480865_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|2480874_2481540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|2481604_2482021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|2482017_2482296_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|2482320_2482512_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|2482638_2485914_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|2485914_2486511_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|2486510_2487092_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|2487108_2487444_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|2487522_2487921_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
>prophage 178
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2493111	2496183	3970204		Escherichia_phage(50.0%)	2	NA	NA
WP_081041966.1|2493111_2495421_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
WP_049219712.1|2495982_2496183_+	hypothetical protein	NA	Q77Z09	Phage_21	92.6	3.3e-22
>prophage 179
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2506399	2506612	3970204		Morganella_phage(100.0%)	1	NA	NA
WP_004244726.1|2506399_2506612_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
>prophage 180
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2512614	2514495	3970204		uncultured_marine_virus(50.0%)	2	NA	NA
WP_060559465.1|2512614_2513256_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	3.2e-50
WP_060559463.1|2513268_2514495_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	5.9e-61
>prophage 181
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2518512	2528438	3970204		Morganella_phage(60.0%)	15	NA	NA
WP_164484790.1|2518512_2518689_+	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	1.6e-07
WP_175212438.1|2519174_2519396_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_060559519.1|2519825_2520107_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_060559456.1|2520475_2520889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175212439.1|2520916_2521159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060559453.1|2521221_2521782_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	49.4	1.9e-19
WP_004242542.1|2522163_2522361_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_060559451.1|2522378_2523155_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_060559449.1|2523384_2523768_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_060559447.1|2523910_2524774_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|2524873_2525305_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_060559445.1|2525477_2526215_+	phosphatase	NA	NA	NA	NA	NA
WP_060559443.1|2526301_2526850_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_004242555.1|2527297_2527693_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_060559441.1|2528003_2528438_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.5	4.5e-24
>prophage 182
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2531451	2531793	3970204		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060559435.1|2531451_2531793_+	YebY family protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	32.7	2.6e-06
>prophage 183
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2537646	2539707	3970204		Moraxella_phage(100.0%)	1	NA	NA
WP_060559425.1|2537646_2539707_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.2	2.7e-82
>prophage 184
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2545154	2545721	3970204		Bacillus_phage(100.0%)	1	NA	NA
WP_060559418.1|2545154_2545721_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.2	2.3e-07
>prophage 185
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2550271	2551159	3970204		Klosneuvirus(100.0%)	1	NA	NA
WP_004251467.1|2550271_2551159_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.2	1.4e-08
>prophage 186
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2556855	2570344	3970204	tRNA	Tupanvirus(50.0%)	13	NA	NA
WP_107034338.1|2556855_2558784_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	8.0e-129
WP_012367833.1|2558787_2559327_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	2.8e-15
WP_004242608.1|2559421_2559619_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004242609.1|2559662_2560019_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|2560119_2560167_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_060559392.1|2560343_2561327_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	3.8e-34
WP_060559390.1|2561341_2563729_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004242612.1|2563733_2564030_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_060559388.1|2564337_2565351_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_060559386.1|2565352_2566102_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	29.1	8.7e-07
WP_060559384.1|2566236_2567382_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.2	1.5e-37
WP_004242618.1|2567381_2568362_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.1	5.6e-38
WP_060559382.1|2568361_2570344_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	1.3e-20
>prophage 187
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2573792	2575866	3970204		Bacillus_phage(50.0%)	3	NA	NA
WP_060559515.1|2573792_2574284_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	40.5	9.1e-13
WP_060559376.1|2574361_2575381_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_004242629.1|2575497_2575866_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	37.4	4.6e-09
>prophage 188
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2595941	2596889	3970204		Tupanvirus(100.0%)	1	NA	NA
WP_004242665.1|2595941_2596889_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	1.7e-44
>prophage 189
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2600018	2606817	3970204		Pseudomonas_phage(33.33%)	7	NA	NA
WP_060559347.1|2600018_2601101_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	5.1e-08
WP_060559345.1|2601100_2601949_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004242688.1|2601926_2602742_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004242689.1|2602799_2603654_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	7.5e-47
WP_004242691.1|2603661_2604591_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_060559344.1|2604669_2604948_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_060559342.1|2605116_2606817_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.7	4.0e-31
>prophage 190
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2619354	2621091	3970204	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_060559327.1|2619354_2621091_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	8.0e-88
>prophage 191
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2624730	2638562	3970204	tRNA	Tupanvirus(28.57%)	14	NA	NA
WP_060559319.1|2624730_2626293_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.7	9.3e-19
WP_004242717.1|2626629_2627604_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_060559317.1|2627606_2628356_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	29.5	4.3e-14
WP_004242719.1|2628540_2628939_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_060559315.1|2629206_2630991_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	38.4	7.1e-07
WP_004247981.1|2630994_2631429_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004242729.1|2631457_2632213_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004242730.1|2632337_2632859_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.0	5.3e-11
WP_060559313.1|2632960_2633584_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_060559311.1|2633596_2634607_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	6.9e-07
WP_004247983.1|2634698_2635484_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_060559309.1|2635476_2636202_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	2.6e-16
WP_004242757.1|2636276_2637221_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_060559307.1|2637233_2638562_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	2.8e-16
>prophage 192
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2642608	2652461	3970204	tRNA	Cyanophage(33.33%)	9	NA	NA
WP_060559305.1|2642608_2644084_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.9	1.1e-82
WP_004242769.1|2644668_2645109_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004247986.1|2645110_2645443_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_060559303.1|2645733_2646594_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_049212408.1|2646623_2646968_-	RidA family protein	NA	NA	NA	NA	NA
WP_081045339.1|2647053_2648991_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.5	3.2e-85
WP_060559301.1|2649084_2649786_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004242776.1|2649876_2650470_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004242778.1|2650772_2652461_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	1.9e-33
>prophage 193
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2659413	2660064	3970204		Bacillus_virus(100.0%)	1	NA	NA
WP_060559295.1|2659413_2660064_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.0	1.7e-19
>prophage 194
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2663710	2666394	3970204		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_060559290.1|2663710_2665264_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.4e-06
WP_004247998.1|2665395_2666394_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	1.5e-62
>prophage 195
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2675387	2675642	3970204	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_060559272.1|2675387_2675642_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.7	1.0e-15
>prophage 196
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2680572	2684469	3970204		Catovirus(100.0%)	1	NA	NA
WP_157849526.1|2680572_2684469_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.4	2.3e-58
>prophage 197
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2698454	2701477	3970204		Escherichia_phage(100.0%)	2	NA	NA
WP_060559245.1|2698454_2700851_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.0	4.7e-147
WP_060559243.1|2700847_2701477_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.6	1.4e-63
>prophage 198
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2709997	2715133	3970204		Bacillus_virus(50.0%)	2	NA	NA
WP_060559226.1|2709997_2711563_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.4	1.5e-40
WP_060559222.1|2713030_2715133_+	hypothetical protein	NA	Q64EU7	Vibrio_phage	60.0	3.6e-10
>prophage 199
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2721647	2722640	3970204	integrase	Thermus_phage(100.0%)	1	2712138:2712153	2734951:2734966
2712138:2712153	attL	TTAATTGCATTATTAG	NA	NA	NA	NA
WP_060559211.1|2721647_2722640_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	29.0	9.7e-14
WP_060559211.1|2721647_2722640_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	29.0	9.7e-14
2734951:2734966	attR	CTAATAATGCAATTAA	NA	NA	NA	NA
>prophage 200
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2725779	2728536	3970204		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_060559505.1|2725779_2728536_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	8.4e-23
>prophage 201
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2733682	2743697	3970204		Escherichia_phage(66.67%)	8	NA	NA
WP_060559196.1|2733682_2735740_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.7	5.7e-32
WP_060559194.1|2735751_2737452_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_060559192.1|2737795_2738482_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060559190.1|2738481_2738943_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	35.3	5.3e-15
WP_060559188.1|2739010_2739622_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	7.3e-28
WP_060559186.1|2739761_2740622_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.9	3.7e-25
WP_004242892.1|2740623_2741241_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_060559184.1|2741252_2743697_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.5	1.9e-220
>prophage 202
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2756890	2759963	3970204		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_060559161.1|2756890_2757754_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.4	3.6e-20
WP_060559158.1|2757798_2758128_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060559156.1|2758220_2759963_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.0	2.0e-38
>prophage 203
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2770869	2776301	3970204		Mycobacterium_phage(50.0%)	4	NA	NA
WP_060559134.1|2770869_2772372_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.8	1.7e-33
WP_060559132.1|2772526_2773123_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060559130.1|2773556_2774567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242947.1|2774702_2776301_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	1.4e-57
>prophage 204
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2779502	2783107	3970204		Salmonella_phage(50.0%)	3	NA	NA
WP_060559117.1|2779502_2780687_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.4	4.0e-14
WP_060559115.1|2780816_2781608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060559113.1|2781700_2783107_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	23.3	4.4e-12
>prophage 205
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2830688	2832632	3970204		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_060559044.1|2830688_2832632_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	30.3	2.5e-05
>prophage 206
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2836617	2837217	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004243033.1|2836617_2837217_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	6.7e-42
>prophage 207
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2846277	2851507	3970204	protease	Salmonella_phage(33.33%)	4	NA	NA
WP_004243045.1|2846277_2846802_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	47.9	4.3e-37
WP_060559033.1|2846975_2849573_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.3	5.4e-88
WP_060559498.1|2849878_2850127_+	YciN family protein	NA	NA	NA	NA	NA
WP_060559030.1|2850460_2851507_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.9	1.7e-24
>prophage 208
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2858987	2861960	3970204		Acinetobacter_phage(100.0%)	3	NA	NA
WP_060559016.1|2858987_2859581_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.5	1.2e-30
WP_004243063.1|2859582_2860581_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	9.7e-54
WP_060559014.1|2860586_2861960_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	7.1e-39
>prophage 209
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2867199	2868978	3970204		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060559005.1|2867199_2868978_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.8	4.9e-16
>prophage 210
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2873912	2877971	3970204	tRNA	Salmonella_phage(50.0%)	5	NA	NA
WP_060558998.1|2873912_2874449_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.8	8.4e-20
WP_004251044.1|2874800_2875190_+	VOC family protein	NA	NA	NA	NA	NA
WP_060558997.1|2875274_2875577_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004243084.1|2876018_2876687_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_107034663.1|2877050_2877971_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
>prophage 211
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2895307	2901276	3970204	tRNA	Planktothrix_phage(66.67%)	6	NA	NA
WP_004243109.1|2895307_2896309_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.1	5.8e-06
WP_004243110.1|2896298_2897108_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_012367980.1|2897316_2898105_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_060558975.1|2898323_2898935_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_060558974.1|2899011_2899881_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004248155.1|2900001_2901276_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
>prophage 212
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2911560	2917060	3970204		Enterobacteria_phage(25.0%)	5	NA	NA
WP_060558960.1|2911560_2912586_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.1	2.8e-32
WP_004243142.1|2912595_2913498_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060558958.1|2913617_2914835_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.0	5.0e-12
WP_060558955.1|2915137_2916292_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.4	4.7e-84
WP_060558954.1|2916403_2917060_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.2	3.2e-21
>prophage 213
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2928660	2933864	3970204		environmental_halophage(33.33%)	5	NA	NA
WP_081045335.1|2928660_2929902_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.1	1.1e-86
WP_060558943.1|2929908_2931216_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_060558941.1|2931190_2931937_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.9	1.2e-08
WP_060558940.1|2931981_2933478_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004243167.1|2933495_2933864_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.7	1.5e-12
>prophage 214
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2940281	2944912	3970204		Hokovirus(50.0%)	3	NA	NA
WP_060558932.1|2940281_2942657_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.2	2.5e-177
WP_004243173.1|2942875_2943742_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_060558931.1|2943862_2944912_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.3	3.0e-82
>prophage 215
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2952714	2953509	3970204		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_060558911.1|2952714_2953509_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	5.2e-10
>prophage 216
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2961346	2962132	3970204		Cronobacter_phage(100.0%)	1	NA	NA
WP_060558898.1|2961346_2962132_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	66.0	5.8e-86
>prophage 217
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2966726	2968114	3970204		Morganella_phage(100.0%)	3	NA	NA
WP_004243203.1|2966726_2967164_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	2.7e-24
WP_004243204.1|2967230_2967569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243205.1|2967685_2968114_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.4e-22
>prophage 218
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2971660	2982589	3970204	holin	Rock_bream_iridovirus(25.0%)	8	NA	NA
WP_060558881.1|2971660_2972125_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.4	1.9e-20
WP_060558879.1|2972210_2973488_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_060558877.1|2973477_2974728_-	cytosine permease	NA	NA	NA	NA	NA
WP_060558874.1|2975104_2976772_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.5	7.3e-54
WP_004243216.1|2976817_2978293_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_060559492.1|2978317_2978920_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004248207.1|2979129_2981172_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.6	1.2e-21
WP_060558873.1|2981431_2982589_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	29.7	1.1e-16
>prophage 219
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	2989024	2992159	3970204		Morganella_phage(33.33%)	3	NA	NA
WP_072196817.1|2989024_2989360_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	46.7	6.0e-08
WP_060558855.1|2990165_2991173_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.5	1.1e-15
WP_004243228.1|2991169_2992159_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.8e-15
>prophage 220
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3006411	3007951	3970204		Planktothrix_phage(100.0%)	2	NA	NA
WP_060558838.1|3006411_3007248_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	8.2e-14
WP_060558836.1|3007237_3007951_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-23
>prophage 221
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3013036	3024209	3970204		Klebsiella_phage(20.0%)	10	NA	NA
WP_004243248.1|3013036_3013633_-	thymidine kinase	NA	A0A2K9V5L3	Klebsiella_phage	59.0	3.6e-56
WP_004243249.1|3014143_3014548_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_060558833.1|3014777_3015785_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.5	3.3e-33
WP_004243251.1|3016040_3016946_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	1.9e-64
WP_060558831.1|3017127_3018147_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_004243253.1|3018269_3018761_+	YchJ family protein	NA	NA	NA	NA	NA
WP_060558830.1|3018799_3019648_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	1.1e-13
WP_060559490.1|3020033_3020897_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060558828.1|3021340_3022147_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_060558826.1|3022241_3024209_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.2	1.6e-39
>prophage 222
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3029486	3032307	3970204		Tupanvirus(50.0%)	3	NA	NA
WP_060558820.1|3029486_3030119_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.6	1.5e-23
WP_072196816.1|3030190_3030871_-	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_072196815.1|3030867_3032307_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	21.7	4.1e-13
>prophage 223
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3048430	3052960	3970204		uncultured_virus(50.0%)	3	NA	NA
WP_060558792.1|3048430_3048817_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	47.3	8.4e-14
WP_004243285.1|3050523_3051072_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_060558790.1|3051127_3052960_-	excinuclease ABC subunit UvrC	NA	U5J9C9	Bacillus_phage	34.8	2.4e-05
>prophage 224
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3062700	3068117	3970204		Xanthomonas_phage(25.0%)	7	NA	NA
WP_060558767.1|3062700_3063414_-	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	34.0	1.5e-19
WP_004248258.1|3063801_3064590_+	glucose 1-dehydrogenase	NA	H2EEJ0	Moumouvirus	25.9	1.7e-08
WP_004243303.1|3064688_3065243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558766.1|3065239_3065647_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_060558764.1|3066416_3066674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558762.1|3066781_3067474_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	47.4	1.1e-56
WP_060558760.1|3067493_3068117_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	1.2e-17
>prophage 225
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3072403	3078575	3970204		Caulobacter_phage(33.33%)	4	NA	NA
WP_060558752.1|3072403_3073456_-	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	23.9	5.5e-07
WP_060558749.1|3073888_3075466_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_060558747.1|3075550_3077017_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	6.1e-89
WP_060558745.1|3077186_3078575_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.5e-36
>prophage 226
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3095992	3096706	3970204		Cyanophage(100.0%)	1	NA	NA
WP_060558720.1|3095992_3096706_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	36.1	3.4e-37
>prophage 227
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3102982	3103342	3970204		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060558710.1|3102982_3103342_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.3	7.8e-14
>prophage 228
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3107958	3111910	3970204		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_060558706.1|3107958_3109260_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	9.6e-62
WP_060558704.1|3109368_3109995_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004248288.1|3110226_3111267_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	3.0e-74
WP_060558702.1|3111280_3111910_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.1	6.1e-30
>prophage 229
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3120821	3122288	3970204		Acinetobacter_phage(100.0%)	1	NA	NA
WP_060558693.1|3120821_3122288_-	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	30.0	2.2e-54
>prophage 230
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3130295	3133944	3970204	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_060558685.1|3130295_3131672_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	31.6	2.4e-34
WP_060558683.1|3131737_3132445_+	two-component system response regulator BaeR	NA	NA	NA	NA	NA
WP_060558680.1|3132564_3133944_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.9	3.0e-178
>prophage 231
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3144640	3151004	3970204		Rhizobium_phage(33.33%)	6	NA	NA
WP_060558659.1|3144640_3145525_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.8	7.3e-13
WP_060558657.1|3145655_3147134_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_060558655.1|3148479_3148704_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	72.1	5.2e-16
WP_004248304.1|3148821_3149217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243469.1|3149314_3149497_-	YoaH family protein	NA	NA	NA	NA	NA
WP_060558653.1|3149609_3151004_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	39.2	1.0e-37
>prophage 232
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3155978	3157914	3970204		Morganella_phage(100.0%)	3	NA	NA
WP_060558641.1|3155978_3156422_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	5.5e-09
WP_060558638.1|3156530_3157349_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060558637.1|3157479_3157914_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	47.2	2.6e-27
>prophage 233
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3191288	3192275	3970204		Clostridium_phage(100.0%)	1	NA	NA
WP_004243530.1|3191288_3192275_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	39.1	3.6e-16
>prophage 234
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3206501	3212305	3970204		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_004243551.1|3206501_3206891_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	3.5e-07
WP_004243552.1|3206950_3208003_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	1.2e-06
WP_173020887.1|3207995_3208862_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_060558572.1|3208892_3210539_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.2	5.0e-07
WP_060558571.1|3210598_3212305_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	6.8e-15
>prophage 235
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3221750	3223317	3970204		Bacillus_virus(50.0%)	3	NA	NA
WP_060558556.1|3221750_3222449_-	MgtC family protein	NA	G3MA03	Bacillus_virus	47.0	3.3e-16
WP_004243572.1|3222801_3222996_-	protein DsrB	NA	NA	NA	NA	NA
WP_004243573.1|3223104_3223317_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
>prophage 236
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3228545	3231626	3970204		Escherichia_phage(100.0%)	1	NA	NA
WP_060558548.1|3228545_3231626_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.6	8.5e-08
>prophage 237
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3235998	3243209	3970204		Morganella_phage(20.0%)	7	NA	NA
WP_004243585.1|3235998_3236940_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	45.2	9.4e-67
WP_004243586.1|3237224_3238433_+	multidrug efflux MFS transporter MdtG	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	4.5e-05
WP_060558541.1|3238853_3240389_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.5	6.5e-158
WP_060558539.1|3240570_3241350_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_060558537.1|3241450_3241873_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.7	9.5e-11
WP_060558535.1|3242102_3242420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558533.1|3242570_3243209_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	36.8	6.0e-17
>prophage 238
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3253851	3273757	3970204	plate,holin,lysis	Escherichia_phage(26.67%)	22	NA	NA
WP_114078355.1|3253851_3256290_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.6	1.0e-261
WP_004243609.1|3256301_3256919_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_060558511.1|3256922_3257699_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.4	1.1e-41
WP_060558509.1|3257815_3258358_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	3.2e-19
WP_017628013.1|3258923_3259103_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_060558505.1|3260538_3261195_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.4	1.3e-35
WP_175212387.1|3261191_3262379_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.4	1.9e-72
WP_060558501.1|3262371_3262716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558493.1|3262712_3263405_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	2.7e-34
WP_060558491.1|3263407_3264220_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.6	3.1e-42
WP_060558490.1|3264188_3264509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558488.1|3264521_3265010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558486.1|3265012_3267316_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	24.9	1.0e-18
WP_060558484.1|3267398_3267857_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.1e-25
WP_060554762.1|3267916_3268369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558476.1|3268379_3269867_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	1.4e-77
WP_004248364.1|3269875_3270388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558474.1|3270424_3270874_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_060558473.1|3270870_3271275_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	48.6	1.7e-25
WP_060558471.1|3271277_3271577_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	5.0e-22
WP_060558469.1|3271958_3272774_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.7e-54
WP_060558467.1|3273019_3273757_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	45.2	9.0e-57
>prophage 239
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3279584	3294393	3970204		Pseudomonas_phage(33.33%)	10	NA	NA
WP_072196805.1|3279584_3282413_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.2	5.8e-35
WP_060558077.1|3282613_3285247_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	4.2e-104
WP_004243650.1|3285431_3286169_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004243653.1|3286530_3288822_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.1	2.4e-305
WP_004248376.1|3288833_3289964_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	3.4e-172
WP_170833829.1|3290003_3290267_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	60.6	8.5e-18
WP_004243656.1|3290374_3290608_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_060558075.1|3290797_3292009_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_060558074.1|3292113_3292656_-	porin	NA	NA	NA	NA	NA
WP_004248382.1|3292938_3294393_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.5	6.5e-99
>prophage 240
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3325373	3327203	3970204		Oenococcus_phage(100.0%)	1	NA	NA
WP_060558051.1|3325373_3327203_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	32.6	1.9e-15
>prophage 241
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3344256	3345774	3970204		Mollivirus(100.0%)	1	NA	NA
WP_060558034.1|3344256_3345774_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.4	8.8e-91
>prophage 242
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3352323	3353451	3970204		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_060558022.1|3352323_3353451_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.9	2.6e-23
>prophage 243
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3363344	3364430	3970204		Pandoravirus(100.0%)	1	NA	NA
WP_049236635.1|3363344_3364430_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.2	8.2e-91
>prophage 244
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3383324	3383627	3970204		Morganella_phage(100.0%)	1	NA	NA
WP_060558102.1|3383324_3383627_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	32.1	7.8e-07
>prophage 245
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3391843	3406353	3970204		Streptococcus_phage(33.33%)	13	NA	NA
WP_060557982.1|3391843_3393871_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.9	2.4e-144
WP_060557981.1|3394046_3395096_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_060557980.1|3395318_3396089_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004248422.1|3396238_3397192_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	1.4e-73
WP_004243798.1|3397522_3397780_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_060557978.1|3397922_3399650_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.4	1.9e-17
WP_060557977.1|3399699_3400209_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060557975.1|3400299_3401181_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.5	3.4e-58
WP_060557973.1|3401390_3402479_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	37.2	4.8e-30
WP_004243804.1|3402498_3403341_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004243805.1|3403340_3404174_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_060557972.1|3404173_3405193_-	thiosulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_004243807.1|3405456_3406353_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	32.9	5.5e-24
>prophage 246
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3412931	3414215	3970204	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_060557962.1|3412931_3414215_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.3	3.2e-25
>prophage 247
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3418384	3418810	3970204		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_004243827.1|3418384_3418810_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	36.8	2.1e-18
>prophage 248
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3427221	3433818	3970204		Mycoplasma_phage(20.0%)	8	NA	NA
WP_004243837.1|3427221_3428517_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.6	2.5e-38
WP_004243841.1|3428797_3428992_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004243842.1|3429007_3429343_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_060557950.1|3429345_3431196_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.4	5.5e-103
WP_004243844.1|3431208_3431730_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004243846.1|3431778_3432102_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	6.3e-23
WP_004243847.1|3432192_3432579_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	5.4e-53
WP_004243849.1|3432603_3433818_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	9.4e-35
>prophage 249
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3439647	3440901	3970204		Aeromonas_phage(100.0%)	1	NA	NA
WP_004243862.1|3439647_3440901_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	9.2e-102
>prophage 250
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3443931	3454008	3970204		Bacillus_phage(50.0%)	5	NA	NA
WP_060557933.1|3443931_3445548_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	6.1e-98
WP_004243867.1|3445622_3446960_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	2.6e-09
WP_114078348.1|3446971_3447898_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_060557930.1|3447981_3449430_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	4.1e-13
WP_060557928.1|3450117_3454008_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	1.3e-130
>prophage 251
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3462251	3470831	3970204	tRNA	Pandoravirus(25.0%)	10	NA	NA
WP_060557918.1|3462251_3462782_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	8.0e-07
WP_060557916.1|3462886_3463522_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004243886.1|3464043_3464304_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004243887.1|3464333_3464714_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_060556533.1|3464713_3465445_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_060556532.1|3465514_3466255_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243892.1|3466267_3467176_-	GTPase Era	NA	NA	NA	NA	NA
WP_004248457.1|3467172_3467853_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004248458.1|3468048_3469020_-	signal peptidase I	NA	NA	NA	NA	NA
WP_060556531.1|3469034_3470831_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
>prophage 252
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3475218	3478124	3970204		Klosneuvirus(33.33%)	3	NA	NA
WP_060556528.1|3475218_3476574_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	31.4	3.1e-47
WP_060556527.1|3476725_3477109_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	3.4e-31
WP_060556525.1|3477443_3478124_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	46.8	6.4e-57
>prophage 253
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3483060	3483543	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060556523.1|3483060_3483543_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.7	5.6e-31
>prophage 254
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3486959	3491745	3970204		Mycobacterium_phage(50.0%)	2	NA	NA
WP_060556520.1|3486959_3488396_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	31.7	6.7e-48
WP_060556519.1|3488466_3491745_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.5	3.3e-58
>prophage 255
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3501619	3503143	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_114502413.1|3501619_3503143_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.5	2.8e-84
>prophage 256
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3506975	3514446	3970204		Liberibacter_phage(33.33%)	6	NA	NA
WP_114502416.1|3506975_3510257_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.5	1.8e-64
WP_107111807.1|3510495_3510567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114502417.1|3511726_3512461_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_114502418.1|3512486_3513083_+	pancortin-3	NA	NA	NA	NA	NA
WP_114502419.1|3513082_3514195_+	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	40.9	2.9e-43
WP_033929743.1|3514233_3514446_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.3	8.7e-05
>prophage 257
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3522458	3533210	3970204		Moraxella_phage(100.0%)	1	NA	NA
WP_175212390.1|3522458_3533210_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	32.5	4.3e-46
>prophage 258
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3551252	3551831	3970204		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_060558392.1|3551252_3551831_-	histidine phosphatase family protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	1.1e-30
>prophage 259
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3565877	3569789	3970204		Acinetobacter_phage(50.0%)	2	NA	NA
WP_107034104.1|3565877_3567917_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	30.9	8.1e-15
WP_060558370.1|3568154_3569789_-	sodium/sugar symporter	NA	A0A240F3J2	Aeromonas_phage	38.8	9.8e-88
>prophage 260
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3574803	3577210	3970204		Tupanvirus(50.0%)	2	NA	NA
WP_060558365.1|3574803_3575820_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	2.6e-86
WP_060558363.1|3576250_3577210_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	25.9	1.4e-17
>prophage 261
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3580699	3580945	3970204		Salmonella_phage(100.0%)	1	NA	NA
WP_012368173.1|3580699_3580945_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
>prophage 262
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3589072	3597663	3970204	tRNA	Lactobacillus_phage(20.0%)	8	NA	NA
WP_060558348.1|3589072_3589621_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.8	1.3e-15
WP_060558346.1|3590113_3590323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|3590635_3590845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244024.1|3591444_3592959_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_096043105.1|3592967_3594066_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_060558343.1|3594237_3595971_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.6e-64
WP_060558340.1|3595980_3596688_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_060558338.1|3596721_3597663_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
>prophage 263
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3601346	3604223	3970204		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_060558331.1|3601346_3604223_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	9.3e-267
>prophage 264
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3612342	3620234	3970204		Organic_Lake_phycodnavirus(33.33%)	5	NA	NA
WP_060558318.1|3612342_3614415_+	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.5	1.9e-19
WP_060558316.1|3614417_3615782_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_060558314.1|3615795_3617916_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.9	5.3e-41
WP_060558311.1|3618072_3618825_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004248535.1|3618983_3620234_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.3e-103
>prophage 265
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3629587	3631015	3970204		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004244077.1|3629587_3631015_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	3.2e-42
>prophage 266
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3642603	3642999	3970204		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017627934.1|3642603_3642999_-	8-oxo-dGTP diphosphatase MutT	NA	H6X3M3	Enterobacteria_phage	32.0	3.3e-05
>prophage 267
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3673401	3679126	3970204		Catovirus(50.0%)	3	NA	NA
WP_060558257.1|3673401_3675210_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.6	3.9e-45
WP_060558250.1|3675739_3676684_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_060558249.1|3677566_3679126_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.3	3.3e-08
>prophage 268
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3685567	3686243	3970204		Brucella_phage(50.0%)	2	NA	NA
WP_004244143.1|3685567_3685912_-	DNA-binding protein	NA	A0A141GEX5	Brucella_phage	38.8	3.7e-05
WP_175212392.1|3685901_3686243_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	36.7	7.2e-09
>prophage 269
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3691152	3692307	3970204		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060558236.1|3691152_3692307_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.2	7.6e-127
>prophage 270
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3740557	3741313	3970204		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_060556917.1|3740557_3741313_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	3.6e-16
>prophage 271
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3750036	3751272	3970204		Erwinia_phage(100.0%)	1	NA	NA
WP_060556924.1|3750036_3751272_+	anaerobic sulfatase maturase	NA	A0A1B2IB49	Erwinia_phage	26.9	6.0e-05
>prophage 272
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3760724	3764373	3970204		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_060556938.1|3760724_3762014_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.2	1.6e-173
WP_060556932.1|3762088_3762424_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	8.1e-21
WP_060556933.1|3762883_3763594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556934.1|3763746_3764373_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	8.3e-11
>prophage 273
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3768181	3806452	3970204	tail,holin,capsid,terminase	Salmonella_phage(21.43%)	53	NA	NA
WP_060556896.1|3768181_3768400_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.9	2.6e-28
WP_060556897.1|3768506_3768869_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	60.7	2.9e-32
WP_060556898.1|3768868_3769786_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	85.1	6.2e-148
WP_060556899.1|3769785_3771240_+	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_124725225.1|3771296_3772067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124725226.1|3772078_3773323_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	54.8	1.5e-43
WP_060556902.1|3773380_3775849_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	51.8	1.2e-251
WP_060556903.1|3775835_3776228_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	57.9	1.4e-43
WP_060556904.1|3776224_3776695_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	2.6e-41
WP_060556905.1|3776694_3777171_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	9.6e-60
WP_155195932.1|3777174_3780351_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	39.9	1.4e-82
WP_060556273.1|3780418_3781141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155195948.1|3781263_3782016_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	42.8	6.4e-42
WP_155195934.1|3782774_3782945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767708.1|3783042_3783366_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_060556627.1|3783438_3784131_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	1.2e-90
WP_060556626.1|3784180_3784936_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	68.5	1.8e-92
WP_060556625.1|3785009_3785378_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_049257616.1|3785374_3785743_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.9	1.2e-41
WP_060556624.1|3785744_3786083_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	53.4	3.2e-25
WP_060556623.1|3786082_3786481_-	hypothetical protein	NA	I6S619	Salmonella_phage	76.5	2.5e-53
WP_060556622.1|3786537_3786711_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	50.0	1.2e-07
WP_060556621.1|3786720_3787815_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.5e-145
WP_060556620.1|3787827_3788277_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.8	2.2e-45
WP_060556619.1|3788276_3789551_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	9.5e-155
WP_060556618.1|3789554_3790484_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.0	1.0e-89
WP_060556617.1|3790434_3791790_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	63.7	5.0e-162
WP_060556616.1|3791789_3793040_-|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	78.4	1.0e-201
WP_060556615.1|3793023_3793449_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_124725282.1|3793465_3793651_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	75.4	1.5e-21
WP_036905461.1|3793681_3794041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905457.1|3794021_3794804_-	KilA-N domain-containing protein	NA	K7PH51	Enterobacterial_phage	43.4	4.2e-52
WP_081045303.1|3795242_3795497_-	peptidase	NA	NA	NA	NA	NA
WP_060556604.1|3795384_3795786_-	hypothetical protein	NA	A0A1P8DTG0	Proteus_phage	43.9	1.1e-08
WP_060556605.1|3795782_3796187_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	1.2e-26
WP_036970165.1|3796179_3796467_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3796463_3796853_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_060556606.1|3796987_3797755_-	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	34.3	1.5e-17
WP_060556907.1|3798231_3799071_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	45.6	5.3e-61
WP_060556908.1|3799067_3799268_-	NinH	NA	A5VW84	Enterobacteria_phage	50.0	1.6e-08
WP_060556909.1|3799257_3799851_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	92.9	2.0e-94
WP_060556914.1|3799962_3800187_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_155195940.1|3800192_3800639_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	57.3	6.3e-37
WP_131728024.1|3801049_3801277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556611.1|3801273_3801498_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_152964332.1|3801548_3801716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556819.1|3801735_3802647_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	2.2e-97
WP_060556820.1|3802657_3803344_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	87.7	4.7e-108
WP_060556821.1|3803340_3804279_-	replication protein	NA	A0A1P8DTG2	Proteus_phage	53.2	9.3e-83
WP_060556822.1|3804275_3804971_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	71.3	1.2e-82
WP_060556823.1|3804992_3805325_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	97.3	5.1e-52
WP_036895075.1|3805460_3805646_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_060556824.1|3805741_3806452_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	61.7	7.3e-80
>prophage 274
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3809913	3820174	3970204	tRNA,integrase	Salmonella_phage(22.22%)	15	3809264:3809279	3825691:3825706
3809264:3809279	attL	CGCATTGAAACAGAAT	NA	NA	NA	NA
WP_060558095.1|3809913_3810591_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.8	3.6e-20
WP_060558093.1|3810583_3811201_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.8	1.7e-72
WP_060558092.1|3811200_3811731_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	61.4	2.5e-56
WP_049210558.1|3811781_3812000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|3812030_3812318_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_060558088.1|3812317_3812587_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	40.9	9.0e-07
WP_049211072.1|3812579_3812825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558087.1|3812983_3813349_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_060558086.1|3813352_3813580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558085.1|3813566_3814169_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	52.0	1.5e-54
WP_060558083.1|3814604_3815762_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	5.2e-176
WP_060554830.1|3816051_3816924_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
WP_060556405.1|3816927_3817140_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004248638.1|3817776_3818718_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|3818782_3820174_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
3825691:3825706	attR	CGCATTGAAACAGAAT	NA	NA	NA	NA
>prophage 275
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3828536	3836545	3970204	protease	Bacillus_phage(33.33%)	8	NA	NA
WP_060556413.1|3828536_3829223_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	5.5e-08
WP_060556414.1|3829193_3829823_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_060556415.1|3829873_3830659_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.4	2.2e-05
WP_060556416.1|3830744_3831602_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004244263.1|3831641_3832565_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_060556417.1|3832567_3833089_+	NfeD family protein	NA	NA	NA	NA	NA
WP_004244266.1|3833054_3833456_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060556418.1|3833590_3836545_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.4	1.0e-114
>prophage 276
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3848792	3850676	3970204		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_060556428.1|3848792_3850676_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	1.8e-109
>prophage 277
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3876562	3876856	3970204		Morganella_phage(100.0%)	1	NA	NA
WP_060556480.1|3876562_3876856_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	42.6	6.4e-06
>prophage 278
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3896836	3912049	3970204	tRNA	uncultured_Mediterranean_phage(25.0%)	14	NA	NA
WP_017627877.1|3896836_3899401_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	2.8e-28
WP_004244343.1|3899466_3900456_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_060556464.1|3901130_3902252_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244345.1|3902405_3903032_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_060556465.1|3903025_3903790_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	7.1e-65
WP_060556466.1|3903767_3904820_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_060556467.1|3904819_3905302_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_060556468.1|3905303_3906050_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_026090399.1|3906089_3906380_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_175212396.1|3906670_3907285_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	40.0	1.6e-27
WP_155195946.1|3907284_3908742_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.1	3.5e-36
WP_004244356.1|3908753_3909662_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_060556472.1|3909673_3911095_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_060556473.1|3911317_3912049_-	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	27.5	3.4e-08
>prophage 279
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3916315	3916987	3970204		Vibrio_phage(100.0%)	1	NA	NA
WP_060556475.1|3916315_3916987_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A088FAQ4	Vibrio_phage	28.0	1.0e-14
>prophage 280
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3929277	3930309	3970204		Planktothrix_phage(100.0%)	1	NA	NA
WP_060557698.1|3929277_3930309_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.5	1.5e-36
>prophage 281
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3937854	3943956	3970204		Mollivirus(33.33%)	4	NA	NA
WP_060557692.1|3937854_3938598_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.5	6.2e-13
WP_004245456.1|3938888_3939848_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_060557691.1|3939860_3943343_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.2	2.0e-202
WP_060557690.1|3943365_3943956_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	43.7	3.1e-31
>prophage 282
NZ_CP053682	Proteus mirabilis strain MPE0156 chromosome, complete genome	3970204	3951939	3953563	3970204		Tupanvirus(50.0%)	2	NA	NA
WP_004245467.1|3951939_3952803_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	32.4	2.2e-06
WP_036918955.1|3952804_3953563_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	39.3	3.6e-24
