The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	54622	89011	5622341	portal,tail,capsid,head,holin,terminase,plate,integrase	Enterobacteria_phage(90.0%)	48	53557:53616	89118:89241
53557:53616	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|54622_54763_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|54952_55213_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132840.1|55255_56365_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000005406.1|56522_57707_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.4e-224
WP_000290462.1|57706_58219_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651570.1|58274_58649_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	5.8e-36
WP_000333503.1|58657_58813_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853415.1|58799_61607_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.0	0.0e+00
WP_000979946.1|61619_62108_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954201.1|62264_62837_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000885642.1|62880_63459_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.4	5.5e-94
WP_042854226.1|63458_65729_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	1.3e-146
WP_000071720.1|65731_66262_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111953.1|66254_67151_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	1.6e-153
WP_001067548.1|67154_67484_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001435012.1|67501_68068_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	3.3e-99
WP_032162786.1|68079_68715_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920586.1|68707_69175_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780544.1|69312_69720_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	3.2e-64
WP_000072346.1|69716_70109_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
WP_000104350.1|70105_70429_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|70431_70632_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063094.1|70631_71126_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632362.1|71227_72028_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_001055104.1|72073_73126_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262654.1|73149_73986_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613800.1|74140_75892_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|75891_76938_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000711113.1|77468_77999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211256.1|78535_78847_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_000686553.1|78851_79811_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
WP_001288348.1|79887_82728_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000564228.1|82724_83114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372767.1|83110_83728_-	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000104296.1|83739_84039_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_000153700.1|84035_84302_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|84298_84502_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543032.1|84525_84936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021659.1|85029_85143_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000357028.1|85139_85382_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000159456.1|85393_85672_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000739029.1|85682_86033_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|86054_86258_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|86329_86467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|86556_86961_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|86976_87627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865207.1|87656_88004_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|88009_89011_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
89118:89241	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 2
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	118414	220529	5622341	portal,tail,transposase,capsid,tRNA,head,protease,holin,terminase	Enterobacteria_phage(43.08%)	109	NA	NA
WP_001025336.1|118414_120148_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001300190.1|120363_120930_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|120943_121690_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|122077_123178_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176771.1|123202_125632_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564746.1|125796_126768_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|126764_127508_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|127548_127944_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_042854221.1|127996_128767_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000362001.1|128748_130062_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_000073102.1|130117_130354_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_001030139.1|130362_130509_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000492057.1|130512_130755_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001091864.1|130786_131158_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000566775.1|131775_132168_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	2.3e-35
WP_000002325.1|132354_132570_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	60.6	5.5e-15
WP_032162797.1|133128_133329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042854230.1|133334_133799_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	74.4	6.3e-24
WP_032162798.1|134182_134887_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.8	8.3e-68
WP_000786996.1|135010_135274_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	52.9	1.8e-12
WP_032162799.1|135270_135978_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	83.8	3.3e-109
WP_072097753.1|136025_137003_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	62.8	2.7e-101
WP_032162801.1|136999_137233_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_032162802.1|137219_138113_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	44.7	3.8e-57
WP_032162803.1|138130_139021_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	64.1	3.0e-83
WP_032162804.1|139017_140418_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	9.2e-244
WP_001065348.1|140414_140672_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	6.2e-21
WP_032162806.1|140723_141713_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.8	2.3e-193
WP_021570435.1|141730_142096_+	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	1.3e-56
WP_024241392.1|142119_142542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021570437.1|142804_143674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|143942_144146_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000466957.1|145818_146250_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_106919093.1|146727_148578_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|148826_149982_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_024165672.1|150283_150499_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_032163095.1|151528_152062_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	1.5e-101
WP_032140280.1|152616_152703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|152924_153110_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|153637_153952_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|154033_154258_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001429103.1|154684_155191_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_024182572.1|155162_157091_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|157074_157281_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|157277_158870_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253979.1|158859_160365_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256824.1|160401_160749_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522591.1|160806_161835_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|161886_162270_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|162262_162616_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_050869331.1|162631_163165_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	2.6e-58
WP_000683079.1|163161_163557_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|163564_164317_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479108.1|164330_164762_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|164788_165202_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_047087948.1|165182_167744_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.8	0.0e+00
WP_000847345.1|167740_168070_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152532.1|168069_168768_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140735.1|168773_169517_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_071790928.1|169453_170086_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.7e-92
WP_032162954.1|170146_173626_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_032162956.1|173692_174292_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_175215471.1|174356_175625_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	95.5	6.1e-77
WP_001101700.1|175626_175896_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_032162748.1|176006_176588_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	54.3	1.1e-46
WP_012816780.1|176655_177291_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_032162749.1|177418_178477_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144084.1|178555_179206_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001132098.1|179389_179980_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|179966_180089_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217551.1|180225_180474_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_000891620.1|180827_181394_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|181703_183476_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001443602.1|183593_184046_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|184074_184815_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|184849_185371_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001386853.1|186045_186111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|186249_186861_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|186869_187880_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|188026_188812_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|188808_189564_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001184045.1|190589_191912_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|192031_193003_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|193133_194576_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|194703_195573_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301729.1|195910_197386_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
WP_001069467.1|197620_199432_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|199468_200110_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173511.1|200165_201344_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|201477_201768_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|201834_202191_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|202517_203177_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936936.1|203385_205446_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|205442_206105_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|206128_206785_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|206886_207117_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204700.1|207255_207630_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|207633_208506_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|208518_208860_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|209255_209912_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|209912_210104_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|210208_210445_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|210562_212002_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_032162750.1|212081_214715_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|214683_215967_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|216096_216594_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|216690_217389_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|217408_219457_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|219647_220529_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	407751	465880	5622341	portal,tail,capsid,tRNA,head,protease,terminase,integrase	uncultured_Caudovirales_phage(71.43%)	61	450886:450908	466596:466618
WP_001295400.1|407751_409026_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001307229.1|409084_409948_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_000765764.1|409991_410597_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|410702_412205_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|412815_413451_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|413450_414146_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920784.1|414149_414770_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|414773_415832_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915761.1|415832_418055_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|418047_418626_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|418625_419207_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|419283_419724_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|419809_420025_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|420297_420423_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_032162755.1|420665_421706_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|421740_422742_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459406.1|422845_424018_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|424027_425620_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|425794_426823_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|426934_427702_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969095.1|427930_428521_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000945924.1|428908_430720_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075865.1|430716_432090_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227014.1|432128_433394_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043354.1|433438_434947_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170701.1|435047_436223_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|436421_438068_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|438210_439614_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001295399.1|439610_440540_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732526.1|440615_441917_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	5.5e-17
WP_001092519.1|441920_442640_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|442768_443104_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|443100_443823_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|443859_445242_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|445427_446372_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001342403.1|446895_448428_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|448438_449827_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
450886:450908	attL	CGGTGTAGTCACTGGTGTAGTCA	NA	NA	NA	NA
WP_000085272.1|450933_452163_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
WP_001443601.1|452527_452716_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	9.1e-14
WP_157909274.1|452765_453095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179576.1|453219_453525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226784.1|453714_453912_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001368658.1|453904_454369_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_042854119.1|454569_455004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204971.1|455005_455239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770138.1|455244_455544_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761829.1|455540_457295_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.3	2.1e-91
WP_000164428.1|457642_457894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294165.1|457890_458196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126697.1|458205_458616_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233301.1|458626_458899_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132077.1|459024_459249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137341.1|459540_460698_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_001475696.1|460753_461311_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_042854112.1|461312_462524_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	4.3e-189
WP_001020667.1|462520_462859_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.3e-29
WP_000137525.1|462855_463149_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	63.9	1.4e-32
WP_001145909.1|463148_463589_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.1	2.9e-55
WP_001196871.1|463572_463755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|463878_464235_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127874.1|464218_465880_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	5.7e-277
466596:466618	attR	CGGTGTAGTCACTGGTGTAGTCA	NA	NA	NA	NA
>prophage 4
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	480246	539430	5622341	tail,capsid,transposase,head,protease,holin,terminase	Stx2-converting_phage(32.2%)	71	NA	NA
WP_000041687.1|480246_482673_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001295396.1|482871_483177_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001443598.1|483284_483995_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|483997_484558_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|484592_484934_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|485068_485395_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|485600_486815_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|486826_487846_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_072095801.1|487903_488014_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|488033_489329_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|489348_489600_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000102128.1|489672_492135_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_000199475.1|492227_492416_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|492412_492601_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|493165_493375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|493375_494014_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|494025_494178_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362153.1|494443_494863_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|494963_495245_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|495228_495654_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|495676_496639_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_045906934.1|496645_497392_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	6.9e-113
WP_032163040.1|497413_498184_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	2.1e-80
WP_001118160.1|498199_498595_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001497097.1|498652_499009_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.3e-56
WP_001224661.1|499102_499276_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000753068.1|499277_499454_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	5.7e-26
WP_032163038.1|499450_500398_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.5	4.1e-179
WP_000350274.1|501022_501256_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000220601.1|501460_501760_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|501765_502023_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|502158_502431_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|502432_503479_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|503491_503851_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|503859_504390_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|504631_504829_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|504963_505677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|506126_506558_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_044711843.1|507035_508973_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	96.9	0.0e+00
WP_000143462.1|509108_509288_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|509328_509601_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284506.1|509677_509893_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087703.1|509897_510431_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	8.1e-100
WP_001056883.1|510705_511275_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|511274_511424_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|511651_511837_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|512362_512677_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|512758_512983_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001372000.1|513024_513390_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_000958380.1|513679_514243_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|514239_515901_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_024246490.1|515964_517902_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.9	0.0e+00
WP_001063099.1|517946_518168_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|520694_521021_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|521031_521382_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|521378_521825_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|521821_522166_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|522232_522949_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710954.1|522963_523338_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_122993730.1|523433_523643_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|523693_526936_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807927.1|526928_527270_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_064460438.1|527269_527968_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	96.1	1.1e-128
WP_000099160.1|528139_529678_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|529726_530074_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|530070_530475_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_064721023.1|531129_531762_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_064460440.1|532007_535484_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.4	0.0e+00
WP_001216290.1|535552_536176_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_024017371.1|537941_538514_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	48.7	2.7e-40
WP_024017370.1|538731_539430_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 5
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	685605	798446	5622341	portal,tail,transposase,tRNA,protease,holin,terminase	Escherichia_phage(41.67%)	108	NA	NA
WP_001372110.1|685605_686814_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
WP_001261013.1|687344_688013_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586733.1|688315_688909_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_032162924.1|688905_689898_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234058.1|690021_691002_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140884.1|690996_691533_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|691595_691820_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|691959_693615_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013786.1|693839_695183_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|695399_696323_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098524.1|696360_698001_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|698399_698549_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|698620_698794_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|699038_699569_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|699757_700759_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115948.1|700800_702240_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027931.1|702436_703237_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139570.1|703508_707411_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|707611_708217_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627367.1|708267_709584_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431858.1|709573_711331_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890913.1|711346_712243_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|712242_712848_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_175215472.1|713018_715325_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097794.1|715388_716249_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123462.1|716480_717071_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039882.1|717052_718003_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|718103_719417_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|719443_720649_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|720648_721071_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|721060_722488_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969779.1|722489_723278_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|723277_724045_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206364.1|724041_725112_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|725119_725617_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|725631_726378_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|726386_726674_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191074.1|726685_727615_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186465.1|727899_729945_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535475.1|730192_732466_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|732524_734024_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067524.1|734259_735165_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_162137202.1|735336_735666_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
WP_000698145.1|735670_735856_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900964.1|735852_738492_-	YdbH family protein	NA	NA	NA	NA	NA
WP_001298828.1|739800_740223_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|740219_740486_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628159.1|740759_744284_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|744649_745783_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|745923_746358_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_001143784.1|746938_747580_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|747661_748291_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|748363_748939_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|749051_749321_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_116974776.1|749322_750396_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	93.8	4.8e-51
WP_085948186.1|750461_751617_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001228289.1|751877_752477_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000194798.1|756836_757580_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_000847298.1|758291_758621_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532073.1|761306_761615_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_097457206.1|761641_762064_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	99.3	3.3e-72
WP_000235090.1|762077_762830_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|762837_763236_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|763248_763872_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|763874_764156_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|764148_764475_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|764562_766587_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|766531_768034_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|768033_768246_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|768242_770366_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|770362_770839_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|771354_771540_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|771767_771914_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|771913_772483_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|772753_773287_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|773291_773507_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|773584_773830_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|773870_774050_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142970.1|774186_776133_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000640110.1|776834_777377_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|777373_777664_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|777663_778263_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000902698.1|778822_779035_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|779157_780279_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|780265_780916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|781070_781301_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|781297_781720_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|781735_782497_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|782519_783266_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_001356605.1|783272_784061_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|784138_784561_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|784557_784800_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|784896_785316_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|785622_785775_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|786186_787035_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|787081_787303_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245534.1|787296_787473_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000102194.1|787553_790223_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|790215_791025_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|791081_791276_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|791268_791457_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|791556_791772_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|791773_793009_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_001157382.1|793060_793996_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000123745.1|794124_795498_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|795527_795701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387395.1|795975_796959_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|797213_798446_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	874984	934053	5622341	portal,tail,protease,holin,terminase,integrase	Escherichia_phage(35.29%)	72	888763:888790	934190:934217
WP_000422045.1|874984_876034_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|876253_877012_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|877008_877599_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|877638_878511_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|878611_879232_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|879228_880110_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|880247_880292_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194591.1|880383_881946_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|881945_883541_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983908.1|883541_884903_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209519.1|884914_886108_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|886107_886914_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|887294_887474_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|887559_888060_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079494.1|888105_888612_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
888763:888790	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000251936.1|889101_889272_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000692020.1|889649_890240_-	protein kinase	NA	NA	NA	NA	NA
WP_001023417.1|891372_891642_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279019.1|891643_892957_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001230435.1|893021_893621_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_175215473.1|893688_897165_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_123178851.1|897405_898035_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
WP_000194802.1|897980_898724_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001302134.1|898734_899433_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000847298.1|899432_899762_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532073.1|902449_902758_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_001509068.1|902784_903072_-	hypothetical protein	NA	Q687F5	Enterobacteria_phage	97.9	4.7e-46
WP_175215474.1|903076_903208_-	hypothetical protein	NA	S5MQJ3	Escherichia_phage	100.0	8.0e-09
WP_000235090.1|903221_903974_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|903981_904380_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|904392_905016_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|905018_905300_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|905292_905619_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|905706_907731_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974568.1|907675_909178_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|909177_909390_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077628.1|909386_911510_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000373407.1|911506_911983_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|912457_912643_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|913161_913695_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001072901.1|914293_914509_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|914586_914832_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|914872_915052_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142977.1|915186_917133_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
WP_000483509.1|917727_918786_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|918936_919134_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|919360_920182_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|920178_920553_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265156.1|920565_921615_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_012779355.1|921616_921895_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001217394.1|921964_922222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|922442_922655_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|922843_922948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610377.1|923063_923426_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_000137941.1|923422_923794_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|923829_924042_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|924090_924447_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|924503_924899_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000537576.1|924914_925685_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_157837342.1|925719_926262_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020570.1|926173_927214_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|927185_927737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|927720_927948_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|928025_928433_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|928622_928778_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|928937_929156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|929159_929324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|929721_929910_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|929906_930095_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|930187_932632_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|932696_932945_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|932922_934053_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
934190:934217	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 7
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	1037315	1099822	5622341	tail,capsid,tRNA,head,holin,terminase,integrase	Stx2-converting_phage(28.89%)	63	1045606:1045620	1100247:1100261
WP_001297484.1|1037315_1038422_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1038457_1039099_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1039102_1040473_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1040640_1041312_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735406.1|1041311_1042772_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|1042847_1043969_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359439.1|1044114_1045344_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|1045593_1046730_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
1045606:1045620	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|1046713_1047577_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938111.1|1047939_1049301_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001368611.1|1049677_1053079_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	7.8e-220
WP_001301673.1|1053670_1056019_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|1056038_1056128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|1056234_1056504_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|1056505_1057819_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_064721023.1|1062262_1062895_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_000194790.1|1062840_1063584_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_001368648.1|1063594_1064293_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|1064292_1064634_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_050869705.1|1064626_1067869_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.3	0.0e+00
WP_001513217.1|1067916_1068126_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|1068221_1068596_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|1068601_1069318_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|1069384_1069729_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1069725_1070172_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|1070168_1070519_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1070528_1070855_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|1073381_1073603_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|1073647_1075585_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_042854280.1|1075648_1077310_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958355.1|1077306_1077870_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	78.0	1.4e-65
WP_000279816.1|1078162_1078528_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
WP_001341372.1|1078569_1078755_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000347013.1|1078884_1079025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|1079381_1079606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1079670_1079877_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|1080523_1081057_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|1081216_1081489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053897820.1|1081744_1081960_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000143050.1|1082241_1084092_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000762928.1|1085262_1086084_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904098.1|1086080_1086455_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_001265175.1|1086467_1087517_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001341388.1|1087518_1087797_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000884071.1|1087964_1088177_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001278450.1|1088365_1088470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627694.1|1088585_1089170_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001118159.1|1089226_1089622_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000450874.1|1089637_1090408_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_000788938.1|1090433_1091174_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|1091180_1092143_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|1092165_1092591_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|1092574_1092898_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|1093022_1093499_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001443692.1|1093817_1093973_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_001171966.1|1094132_1094351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358071.1|1094354_1094519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1094919_1095108_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1095104_1095296_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048412.1|1095388_1097860_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|1097921_1098191_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|1098159_1099278_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001113310.1|1099354_1099822_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
1100247:1100261	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	1269521	1512794	5622341	portal,tail,transposase,capsid,head,protease,holin,terminase,plate,integrase	Escherichia_phage(27.17%)	288	1390696:1390711	1503873:1503888
WP_001171554.1|1269521_1269902_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1269898_1270246_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998026.1|1270295_1271828_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	3.5e-297
WP_000136079.1|1272246_1272423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|1272584_1274945_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_001309734.1|1275146_1275581_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|1275577_1275928_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|1275958_1277572_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000282084.1|1277648_1278212_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|1279032_1280466_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|1280684_1280882_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|1281108_1281405_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282206.1|1282516_1284334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|1284520_1285723_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000611858.1|1286089_1287076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|1287072_1287564_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000409852.1|1288869_1290228_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287458.1|1290814_1293238_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|1293246_1295265_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|1295257_1296583_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|1296584_1296998_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001199172.1|1298454_1299726_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|1299731_1300859_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|1300916_1301747_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001323669.1|1301782_1302085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018486.1|1302289_1303798_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979513.1|1303956_1304166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299042.1|1304220_1308183_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|1308222_1308861_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|1309148_1310240_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001387701.1|1310239_1310932_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|1310943_1311330_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001299038.1|1311337_1312138_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001186.1|1312147_1312738_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|1312748_1313243_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001299028.1|1313263_1314592_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	6.3e-234
WP_001273658.1|1314674_1314848_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|1315220_1315817_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|1315837_1316065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044280.1|1316102_1317344_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420617.1|1319153_1320074_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|1320073_1320379_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|1320471_1321071_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062104.1|1321067_1323614_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|1323613_1324786_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|1324915_1325608_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|1325580_1326609_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121564.1|1327080_1327734_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_042853950.1|1327746_1328445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|1328645_1329227_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|1329217_1329412_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|1329356_1329899_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|1330120_1330390_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000268934.1|1330391_1331705_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001230429.1|1331769_1332369_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_175215477.1|1332435_1335912_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_064721023.1|1336150_1336783_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_000194790.1|1336728_1337472_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_001368648.1|1337482_1338181_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|1338180_1338522_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_050869705.1|1338514_1341757_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.3	0.0e+00
WP_001513217.1|1341804_1342014_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|1342109_1342484_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|1342489_1343206_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|1343272_1343617_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_097754307.1|1343613_1343895_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	98.9	4.2e-47
WP_000356295.1|1344272_1344884_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001266279.1|1345040_1345307_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
WP_175215478.1|1345317_1347408_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.1	2.0e-165
WP_000129790.1|1347479_1348412_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257929.1|1348414_1348636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1348648_1348903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1348904_1349186_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1349182_1349455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|1349459_1349753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096695739.1|1349764_1350295_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	56.6	1.6e-47
WP_000323222.1|1350392_1350935_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564281.1|1350938_1351472_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000465562.1|1351471_1351987_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973021.1|1351990_1352542_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000595947.1|1352538_1352724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175215479.1|1352762_1353095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1353087_1353285_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|1353274_1353571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214364.1|1353567_1354077_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.4	1.1e-26
WP_000852377.1|1354146_1354572_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1354643_1355144_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1355178_1355607_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122253.1|1355590_1355809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|1355819_1356047_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270158.1|1356027_1356339_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279083.1|1356331_1356622_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|1356624_1357206_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057670.1|1357205_1358870_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000532592.1|1358869_1360459_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|1360442_1361774_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_032311117.1|1361895_1362369_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000850822.1|1362545_1363670_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|1363669_1364617_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002052.1|1364660_1365089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1365085_1365505_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1365501_1366062_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1366062_1366308_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1366304_1367807_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1367815_1368181_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1368195_1368672_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|1368798_1370874_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|1370860_1372210_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|1372193_1373318_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1373307_1373922_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1373914_1374352_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1374351_1375434_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1375424_1375985_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1375984_1376896_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1376930_1377452_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1377531_1377735_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1377956_1378517_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1378616_1380656_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1380802_1380985_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1381020_1381266_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1381304_1381769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1381883_1382084_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1382037_1382775_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001007905.1|1383069_1383420_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1383429_1383756_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_032257997.1|1386282_1386504_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	1.7e-35
WP_033809286.1|1388550_1390212_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|1390208_1390772_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
1390696:1390711	attL	GCGGCAATGGCTGACG	NA	NA	NA	NA
WP_000829190.1|1391060_1391426_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000095741.1|1391467_1391668_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000828068.1|1391799_1392126_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001109019.1|1392471_1393023_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|1393261_1393447_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|1393669_1393801_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000189387.1|1393895_1394051_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	98.0	3.3e-22
WP_085948186.1|1394112_1395269_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_042854551.1|1395330_1395858_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	99.4	6.8e-91
WP_000087733.1|1396131_1396665_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|1396669_1396885_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290221.1|1396961_1397234_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_000143458.1|1397274_1397454_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142998.1|1397589_1399527_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|1400026_1400296_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|1400305_1401253_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|1401759_1402194_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|1402186_1402381_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|1402377_1402983_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|1402982_1403705_-	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211425.1|1403779_1404514_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	9.4e-123
WP_001254256.1|1404788_1404971_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|1404967_1405495_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|1405491_1405938_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|1405894_1406131_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|1406141_1406357_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|1406489_1406768_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|1406838_1407129_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_042854040.1|1407125_1407827_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	7.6e-130
WP_000185454.1|1407823_1408762_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|1408794_1409091_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|1409229_1409457_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|1409535_1410243_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|1410303_1410645_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|1410712_1411174_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|1411167_1412214_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|1412216_1412381_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|1412869_1413253_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_042854041.1|1413311_1413782_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_175215480.1|1413932_1414292_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	99.0	3.1e-55
WP_162860178.1|1414297_1415510_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_001198863.1|1415687_1415852_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|1415820_1415964_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|1416039_1416336_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1416341_1417127_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186866.1|1417123_1417804_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|1417800_1417983_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|1417955_1418147_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077758510.1|1418157_1418439_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	98.9	9.3e-47
WP_000763378.1|1418537_1418759_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|1418755_1419163_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582235.1|1419164_1419920_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_000208003.1|1419930_1420713_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000376716.1|1420712_1420991_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|1421148_1421448_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|1421483_1421651_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001281197.1|1421679_1422024_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|1422141_1422360_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|1422337_1423411_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001399835.1|1423505_1426250_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_000829674.1|1426321_1427395_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1427443_1427617_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_012816753.1|1427606_1427837_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1427811_1428000_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1428010_1428223_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|1428508_1428721_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|1429162_1429468_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247608.1|1429574_1430219_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038077.1|1430215_1430962_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|1430961_1433058_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001300224.1|1433103_1434243_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|1434230_1434677_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208667.1|1434696_1436877_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000644323.1|1436996_1438295_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|1438370_1438463_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|1438475_1439612_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263563.1|1439623_1441168_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004915.1|1441301_1442159_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063983.1|1442155_1442554_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_137546741.1|1442550_1443138_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186415.1|1443134_1443842_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107389.1|1443860_1445654_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001295940.1|1445650_1446769_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_012817749.1|1447885_1448638_+	type III effector	NA	NA	NA	NA	NA
WP_175215469.1|1450088_1450202_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	100.0	1.3e-12
WP_175215470.1|1450191_1450353_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	100.0	4.0e-18
WP_001435161.1|1450417_1451041_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.9e-68
WP_175215481.1|1451109_1454586_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.3	0.0e+00
WP_064758458.1|1454834_1455467_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.1	2.7e-102
WP_000140693.1|1455412_1456156_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	2.0e-144
WP_001357740.1|1456160_1456859_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|1456858_1457188_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106919101.1|1457184_1459740_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.8	0.0e+00
WP_000533411.1|1459720_1460134_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|1460160_1460592_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|1460605_1461358_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|1461365_1461761_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|1461757_1462291_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|1462305_1462659_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|1462651_1463035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|1463086_1464115_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|1464172_1464520_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|1464556_1466062_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|1466051_1467644_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|1467640_1467847_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300274.1|1467830_1469759_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_000235436.1|1469730_1470240_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|1470637_1470862_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1470943_1471258_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1471786_1471972_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1472193_1472307_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1472527_1473061_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1473220_1473493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|1473748_1473964_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000874348.1|1474403_1476254_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|1477021_1477735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|1477872_1478070_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|1478356_1479175_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|1479326_1479698_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|1479687_1480059_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|1480071_1481121_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|1481122_1481401_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|1481568_1481724_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001178384.1|1481795_1482869_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_000955173.1|1482926_1483064_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|1483429_1484203_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1484554_1484968_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|1484983_1485754_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788749.1|1485835_1486522_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	9.8e-106
WP_001205820.1|1486528_1487644_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|1487722_1488178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1488384_1488810_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1488793_1489066_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1489174_1489576_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1489603_1489795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1489794_1490082_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|1490358_1490514_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394513.1|1490655_1491045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1491231_1491417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1491502_1492659_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000413705.1|1493257_1493446_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1493442_1493634_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_078322803.1|1493727_1496199_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_000273151.1|1496266_1496509_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1496486_1497506_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375136.1|1497913_1498573_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_000904444.1|1498663_1498993_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048255.1|1498989_1499268_-	acylphosphatase	NA	NA	NA	NA	NA
WP_001295356.1|1500611_1500929_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|1500973_1501387_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|1501559_1502222_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|1502317_1502776_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420533.1|1502807_1504862_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
1503873:1503888	attR	CGTCAGCCATTGCCGC	NA	NA	NA	NA
WP_001261231.1|1504984_1505431_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875044.1|1505440_1507603_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000839153.1|1507565_1508195_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|1508413_1508923_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750416.1|1509279_1510320_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|1510395_1510848_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156526.1|1511033_1512794_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	1540513	1611811	5622341	transposase,capsid,tRNA,head,protease,terminase	Bacillus_phage(20.0%)	54	NA	NA
WP_000117880.1|1540513_1541914_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_000977920.1|1542515_1543604_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|1543788_1544979_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_000399648.1|1545257_1546238_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001109487.1|1546479_1547127_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1547153_1547702_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|1547882_1549730_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572619.1|1549990_1554451_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001299046.1|1554450_1555155_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288853.1|1555135_1556458_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_042853868.1|1556454_1557240_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|1557375_1558155_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436915.1|1558131_1559025_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011600.1|1559178_1559925_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|1559921_1560104_-	protein YcaR	NA	NA	NA	NA	NA
WP_000570563.1|1561424_1562411_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551263.1|1562407_1564156_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	1.9e-57
WP_000705676.1|1564192_1566457_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1566663_1566948_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|1567107_1568781_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|1568891_1569575_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|1569747_1570512_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|1570681_1571965_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|1572035_1573124_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|1573322_1574015_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001297197.1|1574144_1575905_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|1576310_1577168_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|1577222_1579505_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1579696_1580437_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001190376.1|1580518_1581109_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242676.1|1581208_1582117_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|1582117_1583548_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|1583757_1584906_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|1585220_1585847_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|1585882_1586746_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|1586747_1587365_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850305.1|1587375_1589820_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000886683.1|1590058_1591351_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|1591441_1592785_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1592795_1593407_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077016.1|1593561_1597629_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1597763_1598258_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1598802_1599768_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|1599890_1601657_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|1601657_1603379_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241686.1|1603420_1604125_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1604409_1604628_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1605312_1607589_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1607619_1607940_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_024187550.1|1608726_1609011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835287.1|1609280_1609823_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.5	3.2e-35
WP_001179421.1|1610024_1610408_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190777.1|1610419_1610761_-|head	head decoration protein	head	NA	NA	NA	NA
WP_032162867.1|1610770_1611811_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.6	4.4e-65
>prophage 10
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	1684093	1789852	5622341	portal,tail,capsid,transposase,lysis,head,protease,holin,terminase,integrase	Enterobacteria_phage(40.28%)	116	1710375:1710410	1791286:1791321
WP_000399648.1|1684093_1685074_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|1685352_1686945_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|1687163_1688084_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056441.1|1688142_1689261_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|1689257_1689725_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|1689910_1690039_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001295296.1|1691941_1692457_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1692509_1692575_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|1692809_1693697_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1693995_1694499_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1694902_1695649_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1695787_1696447_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1696443_1697166_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267255.1|1697282_1699508_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|1699504_1700431_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|1700706_1700967_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_042854003.1|1701230_1703513_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990176.1|1703554_1704232_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|1704305_1704572_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1704836_1705097_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|1705325_1706411_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|1706551_1707514_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|1707541_1709692_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|1709811_1710294_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
1710375:1710410	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
WP_000007102.1|1710525_1711890_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|1712118_1712790_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|1712792_1713788_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996099.1|1713780_1715517_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|1715509_1716643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|1716653_1717760_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|1717721_1718132_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|1718264_1719026_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|1719022_1720264_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045448.1|1720263_1721220_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088647.1|1721255_1721969_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|1722038_1722686_-	Bax inhibitor-1 family protein	NA	NA	NA	NA	NA
WP_000373624.1|1722887_1723592_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|1723728_1724181_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|1724182_1724428_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|1724420_1724906_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|1724908_1725421_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|1725442_1726432_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|1726828_1727737_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|1727928_1729950_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|1730528_1731206_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246781.1|1731198_1731954_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118827.1|1731940_1733095_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|1733091_1734132_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001399730.1|1734218_1735508_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767413.1|1735566_1736043_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001102750.1|1736721_1737960_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_001131649.1|1738296_1738872_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_000652078.1|1739423_1740248_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	5.8e-153
WP_000950986.1|1740471_1741353_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	2.3e-147
WP_096150060.1|1741516_1741648_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_175215482.1|1741995_1742976_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.8	4.5e-88
WP_162860177.1|1746348_1747561_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.3	9.3e-168
WP_000090913.1|1750243_1750846_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_001152563.1|1751535_1752234_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	87.9	2.1e-119
WP_032163057.1|1752233_1752563_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000082381.1|1752559_1755139_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.4	0.0e+00
WP_000533411.1|1755119_1755533_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|1755559_1755991_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|1756004_1756757_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|1756764_1757160_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|1757156_1757690_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|1757704_1758058_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|1758050_1758434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|1758485_1759514_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|1759571_1759919_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|1759955_1761461_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|1761450_1763043_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|1763039_1763246_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300274.1|1763229_1765158_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_000235436.1|1765129_1765639_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|1766033_1766228_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881322.1|1766415_1767033_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	86.4	3.8e-93
WP_000092314.1|1767182_1767620_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	9.4e-70
WP_000075135.1|1767616_1768114_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|1768113_1768329_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_064460395.1|1768767_1770618_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000499454.1|1770916_1771075_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1771160_1771904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|1772088_1772778_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|1772792_1772915_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1773253_1774213_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|1774424_1775090_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108038.1|1775086_1775698_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|1775690_1775861_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|1775857_1776040_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153263.1|1776036_1776564_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	8.0e-100
WP_000736898.1|1776560_1777001_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145931.1|1777074_1777365_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788866.1|1777361_1778063_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_000185509.1|1778059_1778959_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	2.5e-170
WP_000251073.1|1778991_1779285_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001194218.1|1779404_1779620_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028394.1|1779723_1780356_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	4.6e-118
WP_000618038.1|1780352_1780757_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	7.3e-69
WP_000332935.1|1780976_1781432_+	Antitermination protein N	NA	J3JZZ6	Escherichia_phage	92.2	6.3e-61
WP_001299183.1|1781440_1782310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065374.1|1782498_1782867_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|1782939_1783104_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|1783072_1783216_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_162860177.1|1783260_1784474_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.3	9.3e-168
WP_000995449.1|1784603_1784900_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|1784905_1785691_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186788.1|1785687_1786368_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.8e-131
WP_000682297.1|1786364_1786547_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	96.7	2.4e-27
WP_000548537.1|1786519_1786711_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|1786721_1787003_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|1787101_1787323_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120063.1|1787533_1788136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|1788378_1788546_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|1788585_1788804_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|1788781_1789852_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
1791286:1791321	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
>prophage 11
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	2003087	2070834	5622341	portal,tail,capsid,transposase,lysis,tRNA,head,protease,terminase,integrase	Enterobacteria_phage(57.41%)	70	2011568:2011614	2060628:2060674
WP_000394594.1|2003087_2004224_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383945.1|2004492_2006730_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|2006716_2009689_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2009689_2010580_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|2010762_2011524_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2011568:2011614	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2012036_2012990_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|2013176_2014661_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239874.1|2015206_2015875_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|2016240_2016354_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|2016422_2016656_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|2016974_2017565_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|2017662_2018238_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_000279113.1|2018237_2021153_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_001230323.1|2021217_2021817_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_106919104.1|2021883_2025282_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001309913.1|2025342_2025990_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|2025887_2026631_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|2026636_2027335_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|2027334_2027664_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000459457.1|2030133_2030568_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|2030549_2030972_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|2030987_2031728_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|2031735_2032131_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|2032127_2032706_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|2032717_2033071_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|2033082_2033481_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|2033522_2034548_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|2034603_2034936_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123319.1|2034945_2036265_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297098.1|2036245_2037847_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|2037843_2038050_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|2038046_2039972_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|2039946_2040492_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001298906.1|2040880_2041075_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|2041239_2041446_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|2041731_2042142_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|2042432_2042726_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|2042816_2042999_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|2043215_2043713_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|2043712_2043928_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|2044516_2045614_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000332834.1|2045803_2046187_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	3.4e-55
WP_001360050.1|2046204_2047194_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|2047201_2048011_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_175215483.1|2048030_2048420_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	6.0e-68
WP_000210187.1|2048416_2048743_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|2048739_2049393_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|2049392_2049887_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|2049883_2050825_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|2050814_2050994_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|2051169_2051721_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|2051713_2051974_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|2052071_2052764_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|2053083_2053599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|2054069_2054432_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_162860176.1|2054788_2056001_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	2.2e-169
WP_000008165.1|2056762_2057299_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|2057289_2057652_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|2057651_2057957_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_085948186.1|2058279_2059435_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_175215484.1|2059447_2060614_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.5	3.3e-194
WP_000805428.1|2060948_2061581_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2060628:2060674	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|2061583_2062099_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|2062109_2063117_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|2065768_2066461_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2066680_2067223_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|2067703_2068570_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2068571_2068784_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|2068891_2069413_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|2069448_2070834_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 12
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	2916190	2923603	5622341	transposase	Stx2-converting_phage(33.33%)	8	NA	NA
WP_000684859.1|2916190_2917147_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175452.1|2917147_2917915_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	1.4e-12
WP_001356111.1|2918450_2918738_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_001368706.1|2918709_2919765_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_102384962.1|2919863_2921092_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000080172.1|2921177_2922791_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|2922821_2923172_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|2923168_2923603_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
>prophage 13
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	3460373	3521425	5622341	tail,transposase,tRNA,head,protease,plate	Shigella_phage(47.62%)	76	NA	NA
WP_001282348.1|3460373_3461738_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000378258.1|3461843_3463490_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_001307474.1|3463492_3463750_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3463713_3464073_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3464089_3464230_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3464459_3464540_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|3464836_3466240_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3466244_3467345_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060118.1|3467344_3468418_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3468446_3470861_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_001317389.1|3471091_3471499_+	YidB family protein	NA	NA	NA	NA	NA
WP_000985549.1|3471613_3472426_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_000772934.1|3472471_3473128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000174305.1|3473405_3474095_+	D-galactonate utilization transcriptional regulator DgoR	NA	NA	NA	NA	NA
WP_000127105.1|3474091_3474970_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_137546766.1|3474953_3475571_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_000705001.1|3475567_3476716_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
WP_000253475.1|3476790_3478116_+	MFS transporter	NA	NA	NA	NA	NA
WP_001298958.1|3478112_3479177_-	colicin M resistance protein	NA	NA	NA	NA	NA
WP_000528251.1|3479549_3480287_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|3480240_3480441_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|3480555_3481020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|3481058_3481304_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|3481339_3481522_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|3481668_3483708_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|3483807_3484368_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|3484589_3484793_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|3484872_3485394_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|3485428_3486340_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|3486339_3486900_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|3486890_3487973_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|3487972_3488410_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3488402_3489017_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3489006_3490131_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|3490114_3491464_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|3491450_3493526_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|3493652_3494129_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|3494143_3494509_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|3494517_3496020_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|3496016_3496262_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3496262_3496823_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3496819_3497239_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002052.1|3497235_3497664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|3497707_3498655_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|3498654_3499779_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_032311117.1|3499955_3500429_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000046901.1|3500550_3501882_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|3501865_3503455_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_175215490.1|3503454_3505116_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000270159.1|3505991_3506300_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|3506280_3506508_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3506517_3506736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3506719_3507148_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3507182_3507683_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|3507754_3508180_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_175215491.1|3508250_3508748_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.4	5.5e-26
WP_000378480.1|3508757_3509054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|3509043_3509241_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|3509233_3509566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|3509581_3509932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|3509946_3510258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175215492.1|3510254_3510728_-	AsnC family protein	NA	NA	NA	NA	NA
WP_000465562.1|3510810_3511326_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000564281.1|3511325_3511859_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000323222.1|3511862_3512405_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000049304.1|3513045_3513339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3513343_3513616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3513612_3513894_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3513895_3514150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3514387_3515320_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_175215487.1|3515512_3517483_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	3.7e-166
WP_001310454.1|3517484_3517733_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|3517900_3518485_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_000620888.1|3519833_3520166_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_001243437.1|3520471_3520885_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3520996_3521425_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 14
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	4347462	4385841	5622341	transposase	Enterobacteria_phage(83.33%)	30	NA	NA
WP_162860179.1|4347462_4348675_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.6	1.3e-164
WP_162860178.1|4351090_4352303_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_000820468.1|4352847_4355967_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069684.1|4356294_4357167_-	GTPase family protein	NA	NA	NA	NA	NA
WP_162860181.1|4357293_4358507_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	5.1e-166
WP_001297234.1|4359703_4361188_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000804452.1|4361509_4362112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323667.1|4362198_4362477_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071529669.1|4363156_4363306_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221499.1|4364125_4364695_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271016.1|4364953_4365355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221627.1|4365342_4365777_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001043702.1|4367164_4368406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134749.1|4368546_4368687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170153.1|4369036_4370230_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_000781202.1|4370244_4370889_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000196044.1|4370897_4371599_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000131689.1|4371614_4372643_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000194235.1|4372654_4374013_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000024636.1|4374139_4375048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000950651.1|4376550_4376943_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001378234.1|4376949_4378980_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.5	6.0e-34
WP_000611256.1|4378976_4379195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336097.1|4379239_4379599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042854340.1|4379571_4379997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162860179.1|4380022_4381235_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.6	1.3e-164
WP_000009491.1|4381396_4381900_+	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_000173339.1|4382395_4382566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177055.1|4383881_4384139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162860180.1|4384627_4385841_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	3.2e-168
>prophage 15
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	4708022	4715162	5622341		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4708022_4708661_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590407.1|4708657_4709920_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|4709916_4710825_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4711020_4711788_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|4711838_4712495_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|4712600_4715162_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 16
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	4790818	4850850	5622341	portal,tail,transposase,capsid,lysis,tRNA,head,protease,holin,terminase,plate,integrase	Shigella_phage(35.09%)	76	4779665:4779679	4804630:4804644
4779665:4779679	attL	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_162860176.1|4790818_4792032_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	2.2e-169
WP_000448925.1|4792547_4792964_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001443684.1|4793002_4794232_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	9.9e-234
WP_001368821.1|4794519_4795131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039225.1|4795184_4795598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211299.1|4795590_4796442_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	35.9	1.8e-32
WP_000531803.1|4796692_4797868_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.1	1.7e-145
WP_001331174.1|4797828_4798035_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|4798094_4798310_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001242757.1|4798306_4798669_-	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	1.5e-65
WP_000008249.1|4798659_4799196_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_000081268.1|4799324_4800149_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	3.0e-149
WP_000135680.1|4800213_4800576_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|4801176_4801473_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000450735.1|4801658_4802285_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|4802382_4802583_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|4802620_4803172_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|4803347_4803527_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104952.1|4803516_4804458_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.0	2.1e-143
WP_001368817.1|4804454_4804949_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	3.6e-86
4804630:4804644	attR	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_000066918.1|4804948_4805602_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_000210173.1|4805598_4805925_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000767111.1|4805921_4806311_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_001061415.1|4806330_4807128_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	4.9e-149
WP_162860181.1|4807967_4809181_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	5.1e-166
WP_001205470.1|4809455_4809812_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|4809791_4811006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|4811008_4812184_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001120496.1|4812475_4812802_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001197770.1|4812805_4813282_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	1.5e-84
WP_001368703.1|4813278_4813716_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	4.2e-70
WP_000099430.1|4814145_4814397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135093.1|4814609_4814960_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	7.5e-62
WP_000929185.1|4815085_4815580_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	3.3e-87
WP_122993517.1|4815813_4817310_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	2.8e-299
WP_000605604.1|4817321_4817504_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466246.1|4817503_4818745_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_001193631.1|4818722_4819373_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257507.1|4819387_4820593_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601365.1|4820642_4820843_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927710.1|4820845_4821169_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_000702402.1|4821165_4821576_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000213500.1|4821550_4822057_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	6.5e-91
WP_000779281.1|4822053_4822614_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	5.2e-105
WP_000497748.1|4822622_4822793_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000155690.1|4822776_4824273_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	6.5e-272
WP_000090995.1|4824272_4824629_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	98.3	5.9e-62
WP_000661054.1|4824628_4824898_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_042854271.1|4827007_4828336_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	5.5e-246
WP_000999510.1|4828332_4829412_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_001259120.1|4829411_4829960_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	1.5e-96
WP_000424737.1|4829959_4830385_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_000785312.1|4830371_4831430_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	8.6e-202
WP_000383559.1|4831420_4832005_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_050869294.1|4832008_4832755_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	82.8	3.1e-81
WP_000805534.1|4832754_4833348_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	1.1e-60
WP_042854268.1|4833319_4833739_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	56.5	1.0e-36
WP_077626228.1|4833742_4834144_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	5.9e-10
WP_000905003.1|4834170_4834725_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	2.8e-87
WP_000355481.1|4834782_4835556_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.9e-36
WP_072095179.1|4835992_4837396_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_072097749.1|4837430_4838645_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.0e-33
WP_000162574.1|4839450_4839933_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4840064_4840541_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4840530_4840821_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4840882_4841224_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4841372_4843034_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4843119_4843998_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|4844120_4844711_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287917.1|4844745_4845351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723175.1|4845473_4846760_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|4846780_4847572_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4847738_4849100_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4849236_4849485_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4849503_4850052_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4850082_4850850_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	5369557	5432787	5622341	portal,tail,capsid,transposase,tRNA,head,holin,terminase,plate,integrase	Cronobacter_phage(54.55%)	65	5396808:5396829	5431255:5431276
WP_001295427.1|5369557_5371591_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005457.1|5371722_5372832_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|5373094_5373376_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|5373668_5374211_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|5374291_5374966_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945416.1|5374981_5377462_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|5377475_5378510_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|5378591_5378930_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|5379148_5379973_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|5380093_5380366_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|5380588_5381377_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|5381373_5382174_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001368724.1|5382238_5383057_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	4.5e-25
WP_000434035.1|5383108_5383855_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011951.1|5383828_5384794_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|5384790_5385795_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858482.1|5385791_5387069_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|5387325_5388378_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289787.1|5388687_5389530_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|5389570_5390833_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|5390842_5391295_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823285.1|5391325_5391610_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|5391613_5392969_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|5393016_5394057_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|5394156_5394936_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|5395017_5395917_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|5396331_5396649_+	hypothetical protein	NA	NA	NA	NA	NA
5396808:5396829	attL	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
WP_000152889.1|5396913_5397921_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	86.3	1.8e-169
WP_000106734.1|5398066_5398366_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	71.7	3.0e-35
WP_000043870.1|5398489_5398765_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	2.3e-42
WP_162860176.1|5398897_5400111_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	2.2e-169
WP_078322794.1|5400208_5400448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671519.1|5400452_5400932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366435.1|5401070_5401292_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	1.7e-11
WP_000361779.1|5401313_5401697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621309.1|5401767_5402658_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	59.7	9.1e-96
WP_000180138.1|5402654_5405267_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	38.5	5.7e-130
WP_001443649.1|5405631_5408424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000247826.1|5408686_5408962_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	56.0	4.9e-24
WP_000163094.1|5409009_5410071_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.0	4.0e-122
WP_001151936.1|5410067_5411879_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.4	1.3e-184
WP_001298853.1|5412055_5413117_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	44.8	1.3e-32
WP_001177621.1|5413145_5414168_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.4	5.0e-98
WP_001251931.1|5414170_5414872_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.1	3.4e-69
WP_000016519.1|5414974_5415448_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.3	1.6e-30
WP_000080428.1|5415444_5415921_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042854138.1|5415956_5416613_+	phage protein	NA	F1BUL6	Cronobacter_phage	59.4	2.9e-67
WP_000220190.1|5416615_5417758_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	60.8	6.2e-129
WP_000140064.1|5417761_5418217_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	51.7	7.5e-38
WP_000980879.1|5418221_5418533_+|holin	holin	holin	NA	NA	NA	NA
WP_000777034.1|5418519_5418858_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	84.2	5.2e-44
WP_001245144.1|5418857_5419241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045611.1|5419343_5419613_+|tail	putative phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_001255513.1|5419663_5419801_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	59.1	2.4e-08
WP_000018644.1|5419802_5421917_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.5	2.4e-142
WP_000102748.1|5421913_5422249_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	60.6	4.3e-30
WP_000136916.1|5422241_5423426_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	69.2	2.0e-154
WP_000134372.1|5423418_5424012_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	62.2	3.0e-71
WP_000076019.1|5424023_5425988_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	67.2	1.3e-126
WP_077627876.1|5426209_5426575_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.2	3.2e-31
WP_000267977.1|5426564_5427293_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	39.9	2.2e-39
WP_000083769.1|5427264_5427807_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	4.2e-43
WP_000802615.1|5427814_5429539_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	62.1	1.6e-173
WP_000780870.1|5430123_5431089_-	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_000476011.1|5431425_5432787_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
5431255:5431276	attR	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
>prophage 18
NZ_CP050498	Escherichia coli strain RM13322 chromosome, complete genome	5622341	5572503	5615642	5622341	portal,tail,transposase,capsid,head,holin,terminase,integrase	Escherichia_phage(33.33%)	58	5572857:5572875	5608715:5608733
WP_162860178.1|5572503_5573717_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
5572857:5572875	attL	GCTCCAGTGCATCCAGCAC	NA	NA	NA	NA
WP_001300307.1|5574404_5575202_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533625.1|5575437_5576463_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096346.1|5576462_5576666_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048403.1|5576724_5579196_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_001090200.1|5579288_5579480_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5579476_5579665_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_085948186.1|5579770_5580926_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001133037.1|5581502_5581712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|5581712_5582351_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|5582362_5582515_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_024173647.1|5582807_5583146_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	1.5e-06
WP_000747951.1|5583537_5583780_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693883.1|5583763_5584189_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|5584260_5585343_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|5585349_5586096_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|5586117_5586834_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|5586866_5587148_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|5587144_5587372_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|5587364_5587676_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|5587803_5588022_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|5588023_5588581_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|5588814_5589027_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|5589146_5589491_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|5589612_5589885_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|5589886_5590936_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|5590948_5591308_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|5591316_5591871_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|5592095_5592293_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|5592428_5593142_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001368722.1|5593592_5594024_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_106919090.1|5594502_5596353_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_024165672.1|5596645_5596861_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|5596865_5597210_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992157.1|5597260_5597794_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_001303555.1|5597949_5598132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|5598144_5598276_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|5598503_5598689_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|5599216_5599531_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|5599612_5599837_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|5600231_5600741_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|5600712_5602641_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259008.1|5602624_5602831_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	1.8e-10
WP_106919091.1|5602827_5604420_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000256809.1|5605937_5606285_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|5606342_5607371_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|5607422_5607797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|5607789_5608143_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000975041.1|5608157_5608691_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_000683066.1|5608687_5609083_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
5608715:5608733	attR	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
WP_000106786.1|5609090_5609843_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000479106.1|5609856_5610288_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	2.1e-42
WP_000533415.1|5610314_5610728_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000082502.1|5610708_5613288_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847304.1|5613284_5613614_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001357740.1|5613613_5614312_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194790.1|5614317_5615061_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_175215493.1|5615006_5615642_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.0e-105
>prophage 1
NZ_CP050499	Escherichia coli strain RM13322 plasmid pRM13322, complete sequence	76269	351	75783	76269	tail,portal,integrase	Salmonella_phage(94.2%)	75	48708:48727	58422:58441
WP_000255469.1|351_555_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_001273881.1|603_1254_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
WP_171821072.1|1537_1846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208379.1|1849_2374_-	hypothetical protein	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
WP_024171469.1|2378_2801_-	hypothetical protein	NA	J9Q806	Salmonella_phage	77.1	4.8e-55
WP_001291060.1|2869_3148_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
WP_001717190.1|3150_4710_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	3.7e-278
WP_000382660.1|4792_5473_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_000161986.1|5472_6141_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000049676.1|6137_6803_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000129633.1|6799_7690_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_000176292.1|7699_7966_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000215413.1|8161_8794_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_021512329.1|8793_10050_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	96.7	5.7e-245
WP_033803023.1|10076_11651_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	1.3e-286
WP_033803024.1|11672_12560_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.3e-131
WP_032328869.1|12585_13461_+	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	9.4e-154
WP_001717194.1|13534_14455_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.2	4.1e-131
WP_000801186.1|14499_14934_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_033803027.1|14933_15767_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	91.7	1.8e-141
WP_001027663.1|15846_16191_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|16181_16655_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_021512326.1|16656_17040_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	2.3e-56
WP_001717196.1|17114_17861_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	92.7	8.1e-122
WP_000163861.1|17916_18234_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000952686.1|18359_18584_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_175215494.1|18591_23163_+	tape measure protein	NA	J9Q712	Salmonella_phage	85.5	0.0e+00
WP_000442113.1|23205_23541_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_000511445.1|23623_24322_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_001405045.1|24314_25112_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_001293196.1|25099_25690_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.4	8.4e-106
WP_175215495.1|25707_30432_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.9	0.0e+00
WP_047659418.1|32594_34682_+|tail	tail fiber domain-containing protein	tail	Q71TP5	Escherichia_phage	68.6	3.8e-60
WP_085458162.1|34742_34997_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	1.4e-28
WP_175215496.1|34996_35605_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.8	7.6e-78
WP_001717323.1|35927_36251_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_000856758.1|36264_36957_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_047659388.1|36958_37210_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	77.1	2.8e-26
WP_000931258.1|37538_37922_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	47.1	8.4e-14
WP_000035507.1|37906_38659_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	30.3	8.4e-18
WP_000161228.1|38835_39504_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160394000.1|39509_39863_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.9	3.2e-44
WP_085458164.1|39914_40667_+	hypothetical protein	NA	J9Q719	Salmonella_phage	36.5	3.9e-07
WP_085458165.1|40659_41082_+	hypothetical protein	NA	J9Q6F2	Salmonella_phage	39.0	2.1e-18
WP_085458166.1|41262_42003_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	4.1e-126
WP_000137333.1|42046_43387_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_085458169.1|43534_44650_+	DNA primase	NA	J9Q720	Salmonella_phage	90.8	3.3e-204
WP_001718051.1|44641_45679_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085458167.1|45860_46643_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	44.9	1.9e-60
WP_061158078.1|46923_47181_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	57.8	3.9e-15
WP_047659377.1|47177_48500_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	5.8e-240
WP_175215497.1|48496_48712_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	71.4	5.7e-20
48708:48727	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_061158076.1|48857_49148_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	77.1	3.4e-36
WP_097335510.1|50574_51873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021533199.1|52051_52297_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	46.2	2.0e-13
WP_048959201.1|52508_53612_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_001282576.1|53606_53993_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001098353.1|54244_54457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175215498.1|54555_56664_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.8	2.2e-228
WP_001717302.1|56759_57995_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	81.3	2.3e-198
WP_175215499.1|58175_61694_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.8	0.0e+00
58422:58441	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_052923435.1|61867_62851_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_052908857.1|62994_63426_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	1.5e-64
WP_001717300.1|63543_64572_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_052908858.1|64632_65577_+	exonuclease	NA	J9Q7S6	Salmonella_phage	88.5	3.5e-162
WP_000920224.1|65576_65843_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_021533191.1|67011_67212_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_000715581.1|67215_68046_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_052908859.1|68137_68563_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	5.9e-61
WP_001265407.1|68618_68894_+	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_000644408.1|69109_69445_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_024180339.1|70236_71451_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.1e-75
WP_175215500.1|71652_72297_+	hypothetical protein	NA	J9Q739	Salmonella_phage	84.4	1.0e-104
WP_052908861.1|72551_73637_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.3	2.0e-185
WP_052908863.1|73866_75783_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.9	6.5e-248
