The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	332386	378088	4879059	capsid,transposase,integrase,tail	Shigella_phage(44.44%)	48	354613:354652	381894:381933
WP_001000409.1|332386_333922_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|333971_334319_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|334315_334699_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_001548946.1|334848_336870_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_174190331.1|336870_338331_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003029591.1|341873_342878_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003029589.1|342907_344308_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_000345204.1|344307_345678_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029587.1|345815_347333_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_003029584.1|347498_348422_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_077258089.1|348650_348821_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029582.1|349330_349639_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_003029581.1|349667_350324_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_008321072.1|350379_351000_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_008321066.1|351461_352226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321061.1|353106_354426_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
354613:354652	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCG	NA	NA	NA	NA
WP_060614984.1|355238_355397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614983.1|355408_356182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131727973.1|356345_356573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685487.1|356569_357028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685488.1|357086_357284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032937054.1|357294_357855_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060614981.1|359451_359700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309089.1|359718_359895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614980.1|359909_360650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614979.1|360643_361105_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077870821.1|361323_361593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685494.1|361585_361924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801630.1|362590_362806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685495.1|362802_363162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172426607.1|363187_364210_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_033801633.1|364329_364527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614977.1|364519_366364_+	cell envelope integrity protein TolA	NA	A0A1Q1N989	Escherichia_phage	32.4	1.5e-63
WP_060614976.1|366702_366981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685605.1|367011_368235_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000051887.1|368407_369571_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|369797_370103_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001020634.1|370499_371192_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|371289_371550_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_162521836.1|372868_373135_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.8	2.9e-42
WP_000497751.1|373143_373314_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_069067270.1|373297_374437_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	75.3	1.3e-190
WP_000090998.1|374436_374793_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_071549914.1|374977_375325_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	51.2	4.6e-11
WP_023568707.1|375396_375948_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.9e-86
WP_023568708.1|376382_377003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023568709.1|377008_377311_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_048228913.1|377413_378088_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.3	1.0e-78
381894:381933	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCG	NA	NA	NA	NA
>prophage 2
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	945985	1048410	4879059	lysis,head,protease,tail,terminase,capsid,integrase,plate,transposase,portal	Salmonella_phage(64.81%)	107	948713:948728	1020577:1020592
WP_000399648.1|945985_946966_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|947226_948492_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114278.1|948643_949459_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
948713:948728	attL	ATCATCGGTAGCGTAA	NA	NA	NA	NA
WP_000209304.1|949604_952037_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|952042_952942_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|953072_953735_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829244.1|953822_954572_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397384.1|954571_955807_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|956010_956976_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001296993.1|956962_958834_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090136.1|958853_960392_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|960409_961330_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|961332_962244_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|962421_964770_+	CHASE9 sensor domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|964777_966106_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|966152_967478_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|967690_968074_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|968184_969300_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|969296_969923_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|970169_971372_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|971418_972177_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|972234_972831_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|973115_974348_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|974388_974673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|974758_975574_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|975573_976782_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|976865_977402_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_016529337.1|977506_978559_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.0e-106
WP_060615102.1|978645_979635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077870828.1|979645_980584_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.6	6.1e-34
WP_000188448.1|980672_980894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460897.1|980926_981436_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001350183.1|981443_981677_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_060615101.1|981624_982083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961902.1|982276_982543_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	83.3	1.1e-15
WP_000996717.1|982660_983002_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244165.1|983069_983303_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752613.1|983302_983530_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_060615100.1|983526_984384_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	1.8e-157
WP_060615099.1|984380_986795_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_001154431.1|986947_987136_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|987146_987380_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|987572_987908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060615098.1|988414_989665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520382.1|989697_990732_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	1.7e-170
WP_001098440.1|990731_992498_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216223.1|992640_993474_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.1e-122
WP_016237792.1|993490_994549_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059204.1|994552_995203_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_016237793.1|995298_995763_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000868175.1|995762_995966_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|995969_996185_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_016237794.1|996165_996678_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	2.0e-87
WP_000727853.1|996679_997057_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_016237795.1|997053_997482_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	9.3e-46
WP_001039935.1|997577_998009_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_023352536.1|998001_998448_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_000993775.1|998516_999095_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177597.1|999091_999451_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_060615096.1|999437_1000346_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	3.0e-142
WP_001086833.1|1000338_1000944_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_060615094.1|1002331_1002763_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.3	7.4e-19
WP_060615093.1|1002734_1003166_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	57.9	1.4e-38
WP_165843458.1|1003169_1003568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046146.1|1003682_1004855_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|1004864_1005380_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281007.1|1005434_1005737_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
WP_000763311.1|1005751_1005871_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_060615092.1|1005863_1008941_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000980397.1|1008937_1009423_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_060615091.1|1009419_1010520_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	6.5e-176
WP_000972391.1|1010610_1010829_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1011064_1012750_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1013019_1013397_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|1013426_1013684_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|1013843_1014131_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|1014897_1015800_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1015887_1016364_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|1016714_1017827_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996022.1|1017921_1019055_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_000105438.1|1019064_1020018_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061670.1|1020014_1020860_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
1020577:1020592	attR	TTACGCTACCGATGAT	NA	NA	NA	NA
WP_000389260.1|1020919_1021408_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|1021448_1022576_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|1022750_1023482_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1023773_1024442_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1024441_1025158_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1025164_1025896_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027195.1|1025913_1026642_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
WP_001270735.1|1026859_1027375_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160739.1|1027500_1027824_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|1027820_1028651_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001307082.1|1028647_1029661_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_175188300.1|1029759_1031190_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_000566372.1|1031200_1032202_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|1032238_1033957_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|1034089_1035058_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1035069_1036722_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1036865_1037765_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|1038221_1038917_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1039342_1041001_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1040997_1041954_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746460.1|1042104_1043220_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188193.1|1043216_1045163_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|1045235_1045460_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1045782_1046103_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1046133_1048410_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 3
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	1512500	1530799	4879059	holin,tRNA	Escherichia_phage(66.67%)	21	NA	NA
WP_000628065.1|1512500_1513733_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1513987_1514971_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1515448_1516822_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001153728.1|1516950_1517886_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000040852.1|1517937_1519173_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1519174_1519390_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1519468_1519678_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1519670_1519865_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_060615110.1|1519948_1520731_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	73.0	5.5e-105
WP_000105127.1|1520723_1523324_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_000632297.1|1523425_1523701_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1523775_1523946_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1523945_1524167_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1524608_1525097_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1525093_1525249_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233320.1|1525680_1526100_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1526179_1526434_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693853.1|1526430_1526856_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262393.1|1526927_1527998_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151151.1|1528038_1528461_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|1528801_1530799_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
>prophage 4
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	1541886	1548789	4879059	holin,tail	Enterobacteria_phage(57.14%)	7	NA	NA
WP_000839557.1|1541886_1542102_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	6.5e-32
WP_000885599.1|1544308_1544884_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_000086519.1|1544981_1545572_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000836772.1|1545888_1546122_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_120795384.1|1546190_1546304_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001082294.1|1547080_1547515_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|1547655_1548789_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 5
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	1734542	1762600	4879059	lysis,tail,terminase,integrase,transposase	Enterobacteria_phage(44.0%)	36	1750296:1750310	1768961:1768975
WP_000885571.1|1734542_1735124_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
WP_100069996.1|1735926_1737237_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	1.0e-252
WP_000421825.1|1737245_1737785_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001205129.1|1738140_1738296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|1738465_1738759_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1738849_1739032_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001348167.1|1739248_1739746_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_000839586.1|1739745_1739961_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
WP_001000409.1|1741455_1742991_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|1743040_1743388_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|1743384_1743768_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000780579.1|1744485_1745010_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.7e-46
WP_001204811.1|1745166_1745544_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	4.5e-52
WP_001265276.1|1745561_1746611_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_023147795.1|1746612_1746891_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980987.1|1746957_1747209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967407.1|1747425_1747638_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	4.0e-26
WP_000892866.1|1748323_1749019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373963.1|1749031_1749685_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000566848.1|1749999_1750899_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
1750296:1750310	attL	AACCAGTGAGCATAT	NA	NA	NA	NA
WP_001151251.1|1751151_1751574_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000054501.1|1751614_1752580_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_000705353.1|1752560_1753082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1753065_1753296_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|1753379_1753787_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1753953_1754109_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171933.1|1754268_1754487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1755054_1755243_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1755239_1755431_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048320.1|1755524_1757996_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1758068_1758320_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876993.1|1758354_1759635_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1759654_1759765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174190342.1|1759822_1760842_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.6	6.3e-16
WP_001295394.1|1760853_1762068_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1762273_1762600_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
1768961:1768975	attR	AACCAGTGAGCATAT	NA	NA	NA	NA
>prophage 6
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	2147102	2214647	4879059	head,holin,protease,tail,terminase,capsid,integrase,transposase,portal	Escherichia_phage(37.5%)	63	2152514:2152529	2230676:2230691
WP_001079062.1|2147102_2147633_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
WP_041498150.1|2149123_2149705_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.7e-101
WP_105313501.1|2149704_2153118_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
2152514:2152529	attL	CTGGCACTGGTAGCTG	NA	NA	NA	NA
WP_041498143.1|2153182_2153782_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.2e-105
WP_105313502.1|2153851_2157331_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_012311734.1|2157391_2158039_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_105313503.1|2157936_2158680_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	1.4e-142
WP_001152456.1|2158684_2159383_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_040079256.1|2159382_2159739_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_071549949.1|2159716_2162944_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.0	0.0e+00
WP_000978930.1|2162990_2163269_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_001441851.1|2163292_2163664_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	97.6	1.0e-61
WP_001441850.1|2163678_2164383_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.4	1.8e-115
WP_001441849.1|2164443_2164788_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	6.7e-55
WP_000968644.1|2164784_2165234_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2165230_2165569_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719065.1|2165577_2165895_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_000766109.1|2165971_2167189_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2167203_2167803_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|2167795_2169022_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000811487.1|2169011_2169173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|2169169_2170927_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2170926_2171409_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140099.1|2171556_2171907_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_016240599.1|2171914_2172115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114684.1|2172359_2172845_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001228685.1|2173085_2173271_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001274714.1|2173487_2174021_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_000193292.1|2174076_2174391_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_000839572.1|2174395_2174611_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_016240600.1|2175407_2176097_-	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	2.6e-58
WP_001217424.1|2176093_2176453_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_024195967.1|2176465_2177515_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_024175747.1|2177516_2177795_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|2178091_2178484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813260.1|2178627_2178783_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000150294.1|2179020_2179686_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_021546098.1|2179860_2180286_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_001475341.1|2180326_2181397_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000693850.1|2181468_2181894_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_060615121.1|2181890_2182106_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_069067232.1|2182155_2182872_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	1.7e-52
WP_000379589.1|2183144_2183300_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171942.1|2183459_2183678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2184245_2184434_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_021579309.1|2184430_2184622_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097409586.1|2184715_2187157_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	7.8e-113
WP_000096344.1|2187215_2187419_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_021546102.1|2187418_2188444_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001302302.1|2188679_2189477_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001347679.1|2189966_2197043_+	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_000378575.1|2198671_2199988_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2200089_2201544_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|2201886_2202603_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_123001122.1|2203231_2204875_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011020.1|2204992_2205943_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|2206044_2206962_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986347.1|2207420_2208356_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001166155.1|2208417_2209497_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|2209508_2210252_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973198.1|2210248_2210794_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_106120865.1|2211833_2213061_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.7e-175
WP_001373172.1|2213495_2214647_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
2230676:2230691	attR	CTGGCACTGGTAGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	2231113	2236853	4879059	transposase	Stx2-converting_phage(33.33%)	9	NA	NA
WP_000080200.1|2231113_2232727_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|2232757_2233108_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2233104_2233530_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000581504.1|2233851_2234307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|2234385_2234619_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|2234718_2235537_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849582.1|2235591_2236077_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001347688.1|2236092_2236569_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|2236631_2236853_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 8
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	2366982	2376424	4879059		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2366982_2368119_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|2368115_2370116_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2370240_2370702_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2370742_2371213_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2371259_2371979_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2371975_2373661_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2373882_2374614_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2374673_2374781_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2374761_2375493_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2375497_2376424_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 9
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	2583189	2660635	4879059	transposase,lysis,holin,protease,terminase,integrase,coat,portal,tRNA	Enterobacteria_phage(55.56%)	92	2580394:2580410	2632441:2632457
2580394:2580410	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283581.1|2583189_2584002_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2584001_2585015_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2585080_2586217_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2586315_2587311_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127778.1|2587307_2588486_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2588778_2589999_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683808.1|2590157_2592164_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000399648.1|2592334_2593315_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000559764.1|2593563_2593842_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2593875_2594424_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2594423_2595233_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043799.1|2595232_2596057_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|2596060_2597146_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001309606.1|2597180_2598113_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2598278_2598830_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2598951_2599824_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730293.1|2599810_2600335_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2600331_2600802_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2600798_2601347_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281620.1|2601321_2602074_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112827.1|2602093_2604736_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2604817_2605381_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2606055_2606541_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425059.1|2606743_2608888_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2608887_2610198_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2610377_2610662_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2611033_2612374_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937840.1|2612739_2613798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2613979_2614735_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2615028_2615961_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_136430556.1|2616272_2617430_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
WP_174190351.1|2622147_2623443_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	91.2	4.0e-185
WP_114569587.1|2623452_2624148_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	92.7	1.5e-85
WP_114569586.1|2624150_2624606_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.3e-85
WP_114569585.1|2624605_2625454_-	hypothetical protein	NA	Q716G6	Shigella_phage	94.3	1.9e-98
WP_114569584.1|2625453_2626872_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.2	7.8e-275
WP_073461871.1|2626872_2627373_-	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
WP_167784818.1|2627350_2627956_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.7	4.6e-59
WP_114569583.1|2627999_2629295_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	8.0e-242
WP_080028446.1|2629294_2630206_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	8.3e-161
WP_112014988.1|2630219_2632385_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_000417851.1|2632385_2633885_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
2632441:2632457	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_000729920.1|2633862_2634351_-	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_124038846.1|2634623_2635013_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	58.1	4.6e-36
WP_039720091.1|2635014_2635257_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.7	6.4e-36
WP_000342560.1|2635404_2635620_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
WP_024193020.1|2635966_2636485_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
WP_097414186.1|2636686_2637124_-|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	98.6	5.0e-71
WP_000229390.1|2637120_2637597_-	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_021499321.1|2637580_2637904_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	99.1	6.5e-52
WP_174190352.1|2638365_2638884_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.8	1.7e-94
WP_089648300.1|2638880_2639069_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.6e-26
WP_016248923.1|2639065_2639428_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	97.5	6.6e-61
WP_023146907.1|2639428_2639953_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_000002243.1|2639949_2640240_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001279421.1|2640239_2640509_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950962.1|2640501_2640678_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_138217220.1|2640677_2641037_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	99.2	2.4e-63
WP_078180628.1|2641039_2641216_-	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	3.6e-28
WP_174190353.1|2641212_2641740_-	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	98.9	1.4e-99
WP_000736913.1|2641736_2642177_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_174190354.1|2642250_2643627_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
WP_174190381.1|2643623_2644511_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.6	2.0e-143
WP_045903210.1|2644573_2644846_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	3.0e-42
WP_174190355.1|2644868_2645165_-	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	89.3	1.2e-33
WP_000620665.1|2645273_2645468_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|2645574_2646291_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_032283438.1|2646309_2646678_+	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	98.4	8.5e-56
WP_000219336.1|2647047_2647353_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.8	1.3e-25
WP_000213975.1|2647753_2647954_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_097471936.1|2648013_2648379_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	8.1e-59
WP_174190356.1|2648567_2648879_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	95.1	3.9e-54
WP_000005785.1|2648914_2649883_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_000638547.1|2649907_2650039_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2650023_2650176_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_016248933.1|2650251_2650422_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	98.2	1.5e-23
WP_021499331.1|2650432_2651038_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	9.2e-108
WP_000951325.1|2651037_2651421_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_174190357.1|2651444_2651741_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	8.6e-51
WP_174190358.1|2651751_2651898_+	DUF2737 family protein	NA	K7P716	Enterobacteria_phage	87.0	1.6e-18
WP_174190359.1|2651894_2652344_+	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	83.2	3.7e-61
WP_174190360.1|2652340_2652838_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	89.0	8.8e-48
WP_096985882.1|2652837_2653329_+	hypothetical protein	NA	G9L661	Escherichia_phage	98.2	3.9e-88
WP_000212569.1|2653330_2653567_+	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	100.0	3.0e-38
WP_174190361.1|2654401_2654704_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	96.0	4.7e-52
WP_000002117.1|2654696_2654978_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	96.7	1.1e-47
WP_174190362.1|2655361_2655529_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.8e-26
WP_024239659.1|2655555_2655900_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	1.7e-58
WP_001163428.1|2656022_2656223_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001593563.1|2656752_2658000_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2658071_2658986_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2659201_2660635_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 10
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	3007561	3014701	4879059		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3007561_3010123_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|3010228_3010885_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|3010935_3011703_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3011898_3012807_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3012803_3014066_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3014062_3014701_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NZ_CP054940	Escherichia coli strain MS6192 chromosome, complete genome	4879059	4801599	4844923	4879059	lysis,tail,terminase,integrase,transposase,portal	Enterobacteria_phage(46.81%)	48	4794141:4794156	4819085:4819100
4794141:4794156	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_060615063.1|4801599_4802823_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	3.7e-233
WP_001419254.1|4803085_4804786_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001377405.1|4805218_4805839_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001242749.1|4805838_4806201_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001401560.1|4806191_4806728_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_001311077.1|4807527_4808220_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|4808317_4808578_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|4808570_4809122_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087308.1|4809118_4810270_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.0	2.8e-214
WP_000620697.1|4810266_4810491_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.3e-38
WP_000061519.1|4810487_4811306_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_015674830.1|4811302_4811797_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.6e-84
WP_001442792.1|4811796_4812450_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|4812446_4812773_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|4812769_4813159_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061378.1|4813178_4813988_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_023352842.1|4813995_4814985_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_080086273.1|4814999_4815380_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_000357056.1|4815394_4816414_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_000917724.1|4816733_4816937_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|4817087_4818140_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|4818207_4818423_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|4818422_4818920_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|4818916_4819384_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
4819085:4819100	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
WP_001139675.1|4819371_4819524_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001205130.1|4819665_4819842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373426.1|4820199_4820694_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_174190375.1|4820693_4822796_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|4822792_4823005_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072652320.1|4822932_4824480_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.2e-283
WP_001201739.1|4826074_4826458_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|4826454_4826802_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|4826851_4828387_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_001459761.1|4829016_4829340_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	4.2e-51
WP_001283153.1|4829332_4829608_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|4829619_4830198_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079415.1|4830194_4830596_+|tail	phage tail protein U	tail	A5LH34	Enterobacteria_phage	98.5	1.2e-71
WP_001401822.1|4830606_4831350_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.8	1.9e-131
WP_001370402.1|4831410_4831797_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|4831805_4832135_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_060614965.1|4832106_4835163_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.4	0.0e+00
WP_000447253.1|4835162_4835492_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|4835501_4836200_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_174190376.1|4836204_4836948_+	Mov34/MPN/PAD-1 family protein	NA	K7PLW1	Enterobacteria_phage	99.2	2.8e-151
WP_000741576.1|4836845_4837493_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_174190377.1|4837553_4841033_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_032192258.1|4841100_4841700_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.0e-106
WP_174190378.1|4841764_4844923_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	60.2	5.9e-81
>prophage 1
NZ_CP054941	Escherichia coli strain MS6192 plasmid pMS6192A-NDM, complete sequence	142890	17016	71403	142890	protease,transposase	Escherichia_phage(27.27%)	58	NA	NA
WP_152924612.1|17016_18245_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_000053332.1|19251_20262_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
WP_000253905.1|20357_22484_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083369.1|22546_23824_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813680.1|23823_25254_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
WP_001037799.1|25448_26843_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000912556.1|27958_28582_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_001302184.1|30015_30174_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000275854.1|30841_31048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107242.1|31072_31360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234465.1|31478_32300_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	1.7e-43
WP_000949660.1|32595_33168_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001063020.1|33537_33921_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000332520.1|34111_34759_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001352842.1|34894_35110_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000340282.1|35152_35518_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|35532_35844_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399790.1|35865_36432_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_001553834.1|36989_37127_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000741714.1|37148_37310_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038342.1|37302_37554_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_000809832.1|37550_38066_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278692.1|38200_38422_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
WP_001064264.1|38581_41209_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000099690.1|41205_41592_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203720.1|41588_42221_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000205701.1|43535_44282_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.0	9.3e-09
WP_000139363.1|44336_44897_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|45029_45242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968309.1|46345_46528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387399.1|46714_46921_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|47204_47462_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|47697_47772_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|49531_50752_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|50762_51674_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154544.1|51758_52763_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|52810_54214_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|54294_54774_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080217.1|55130_55352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|55382_55733_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|55729_56092_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032147503.1|56926_57505_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|57917_58271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|58742_59765_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|60169_60427_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|60662_60737_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130948.1|60729_61587_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001333237.1|62287_62428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616807.1|62525_63179_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|63271_63529_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|63461_63863_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|65143_65848_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|65991_66546_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|66676_67507_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|68138_68843_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|68949_69810_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|69822_70365_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067834.1|70698_71403_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP054941	Escherichia coli strain MS6192 plasmid pMS6192A-NDM, complete sequence	142890	75140	130953	142890	integrase,transposase	Escherichia_phage(33.33%)	52	93205:93219	124754:124768
WP_000050481.1|75140_76682_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|77086_77926_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|77919_78267_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|78430_79222_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|79227_79518_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|79629_80127_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|80271_81285_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|81487_81838_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|81963_82524_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|82526_85493_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|85559_85937_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000449408.1|87222_87381_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000949452.1|87370_87877_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|88059_88875_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|89221_91108_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|91148_91676_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|91779_93159_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|93161_94445_+	ABC transporter permease	NA	NA	NA	NA	NA
93205:93219	attL	GCCGCAAAGTGCTGG	NA	NA	NA	NA
WP_000729220.1|94434_95565_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|95569_96265_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267177.1|96251_96737_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|96761_97247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|97956_98661_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000476108.1|100580_101891_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000950177.1|101883_102957_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000922702.1|102962_103787_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_001271561.1|103797_104685_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000338039.1|104674_105553_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000796505.1|106097_106292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077068.1|106524_107415_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000710783.1|107439_107820_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001022265.1|107852_108818_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000562172.1|108863_109616_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387467.1|110220_110505_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421272.1|110504_110780_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105060.1|110885_111179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|111374_112544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042065278.1|113686_113869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|113989_114730_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361612.1|115014_115992_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_175188304.1|117112_117508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081352.1|119145_120078_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|120064_121468_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|121675_122692_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|122919_123237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|123523_123883_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|123910_124090_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|124094_124475_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|124474_124696_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|124878_126435_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
124754:124768	attR	CCAGCACTTTGCGGC	NA	NA	NA	NA
WP_001553855.1|126431_127715_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.9e-10
WP_001553854.1|127836_130953_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
