The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	0	1108	6393895	integrase	Brevibacillus_phage(100.0%)	1	NA	NA
WP_110896006.1|169_1108_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	29.5	8.6e-28
>prophage 2
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	7207	9640	6393895		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_110896011.1|7207_9640_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.4	8.2e-14
>prophage 3
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	19672	20698	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110896018.1|19672_20698_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.0	1.1e-31
>prophage 4
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	35372	37189	6393895		Bacillus_phage(50.0%)	2	NA	NA
WP_110896029.1|35372_36089_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	58.0	9.1e-38
WP_110896030.1|36286_37189_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.3e-09
>prophage 5
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	53044	57113	6393895		Bacillus_virus(66.67%)	4	NA	NA
WP_110896042.1|53044_54685_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	40.5	5.0e-23
WP_110896043.1|54762_55284_+	hypothetical protein	NA	G3MBB4	Bacillus_virus	36.4	1.6e-23
WP_174812294.1|55400_56444_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_090920584.1|56855_57113_+	YolD-like family protein	NA	A0A0C5ABD9	Paenibacillus_phage	58.5	1.4e-17
>prophage 6
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	61642	63991	6393895		Catovirus(50.0%)	2	NA	NA
WP_110896050.1|61642_62671_-	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	28.6	5.5e-28
WP_110896051.1|63151_63991_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.8	8.4e-43
>prophage 7
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	77637	78183	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110896062.1|77637_78183_-	GNAT family N-acetyltransferase	NA	A0A1B0RXL7	Streptococcus_phage	37.6	7.4e-32
>prophage 8
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	88096	92086	6393895		Bacillus_phage(66.67%)	3	NA	NA
WP_110896071.1|88096_90058_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	37.1	3.5e-31
WP_110896072.1|90086_90755_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	54.5	3.7e-65
WP_110896073.1|90751_92086_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	41.3	2.3e-58
>prophage 9
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	104461	105751	6393895		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_110896213.1|104461_105751_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	31.9	5.3e-12
>prophage 10
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	109621	113230	6393895		Staphylococcus_phage(50.0%)	3	NA	NA
WP_110896086.1|109621_111235_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	35.5	2.0e-69
WP_110896087.1|111275_112520_+	aminopeptidase	NA	NA	NA	NA	NA
WP_110896215.1|112759_113230_-	GyrI-like domain-containing protein	NA	A0A1P8CX48	Bacillus_phage	40.1	6.8e-26
>prophage 11
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	117905	119462	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110896094.1|117905_119462_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	5.2e-54
>prophage 12
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	157205	159839	6393895		Enterobacteria_phage(50.0%)	2	NA	NA
WP_110896112.1|157205_158189_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	8.7e-23
WP_110896113.1|158363_159839_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	28.1	1.1e-26
>prophage 13
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	169601	172237	6393895		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_110896121.1|169601_170459_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.5	5.8e-07
WP_110896122.1|170458_172237_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.1	9.0e-10
>prophage 14
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	176612	181135	6393895		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_110896127.1|176612_177368_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	9.7e-14
WP_110896128.1|177838_178639_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_110896129.1|178726_181135_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.2	8.7e-08
>prophage 15
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	185180	191208	6393895		Klosneuvirus(66.67%)	4	NA	NA
WP_110896221.1|185180_186926_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	21.2	4.5e-14
WP_110896132.1|186922_188692_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.8	2.5e-12
WP_110896133.1|188894_189827_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_110896134.1|190281_191208_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A1V0SIN1	Klosneuvirus	22.2	1.0e-12
>prophage 16
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	207659	212975	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110896147.1|207659_212975_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.0	4.7e-22
>prophage 17
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	242107	243139	6393895		Megavirus(100.0%)	1	NA	NA
WP_110896168.1|242107_243139_+	alcohol dehydrogenase catalytic domain-containing protein	NA	K7Z7U2	Megavirus	23.5	5.0e-13
>prophage 18
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	248354	256181	6393895		Bacillus_phage(75.0%)	5	NA	NA
WP_110896175.1|248354_249032_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	60.0	5.0e-70
WP_110896176.1|249024_250395_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	39.9	2.1e-59
WP_110896177.1|250624_252088_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_110896227.1|252177_254280_+	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	23.7	1.1e-06
WP_110896178.1|254462_256181_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	4.4e-54
>prophage 19
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	259936	261451	6393895		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_110896182.1|259936_261451_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	2.2e-49
>prophage 20
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	282152	283037	6393895	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_174812295.1|282152_283037_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	9.5e-29
>prophage 21
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	289459	290173	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110899701.1|289459_290173_+	heme ABC exporter ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.0e-25
>prophage 22
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	294177	295737	6393895	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_174812085.1|294177_295737_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	35.9	1.8e-83
>prophage 23
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	298819	299860	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110897491.1|298819_299860_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.6	3.5e-70
>prophage 24
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	314385	315258	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110897500.1|314385_315258_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.5	8.2e-33
>prophage 25
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	318489	322275	6393895		Enterobacteria_phage(50.0%)	4	NA	NA
WP_110897503.1|318489_319473_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	9.6e-22
WP_110897504.1|319472_320351_+	ribokinase	NA	NA	NA	NA	NA
WP_110897505.1|320375_320777_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_110897506.1|320793_322275_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	2.7e-12
>prophage 26
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	329731	330460	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110897513.1|329731_330460_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.1e-34
>prophage 27
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	337917	339657	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110897518.1|337917_339657_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.0	9.4e-20
>prophage 28
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	382909	383752	6393895		Microcystis_phage(100.0%)	1	NA	NA
WP_110897547.1|382909_383752_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	30.6	8.5e-19
>prophage 29
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	392900	399700	6393895		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_110897555.1|392900_397361_+	carbohydrate binding domain-containing protein	NA	M1H1B5	Paramecium_bursaria_Chlorella_virus	32.3	7.7e-26
WP_110897556.1|397733_398105_+	response regulator	NA	NA	NA	NA	NA
WP_110897557.1|398097_398733_+	chemotaxis protein CheC	NA	NA	NA	NA	NA
WP_110897558.1|398725_399700_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.9	7.1e-25
>prophage 30
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	413879	417409	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110897635.1|413879_415631_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	22.8	1.4e-23
WP_110897636.1|415633_417409_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.4	1.2e-14
>prophage 31
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	437757	440517	6393895		Bacillus_phage(50.0%)	3	NA	NA
WP_110897590.1|437757_438468_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.7e-26
WP_110897591.1|438467_439709_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_110897592.1|439824_440517_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.7e-33
>prophage 32
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	444949	447087	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110897640.1|444949_445657_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	3.2e-35
WP_174812298.1|445653_447087_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	6.7e-24
>prophage 33
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	450959	451883	6393895		Pandoravirus(100.0%)	1	NA	NA
WP_110897601.1|450959_451883_+	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	33.3	3.4e-13
>prophage 34
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	456167	457466	6393895		Moraxella_phage(100.0%)	1	NA	NA
WP_110897604.1|456167_457466_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.4	7.1e-57
>prophage 35
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	469667	471422	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110897613.1|469667_471422_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.2	8.5e-21
>prophage 36
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	481707	482748	6393895		Mycoplasma_phage(100.0%)	1	NA	NA
WP_110897623.1|481707_482748_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.2	2.8e-27
>prophage 37
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	496392	497253	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110898737.1|496392_497253_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	37.8	1.9e-21
>prophage 38
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	502566	504366	6393895		Vaccinia_virus(100.0%)	1	NA	NA
WP_110898742.1|502566_504366_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	47.2	3.1e-151
>prophage 39
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	549603	550329	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110898778.1|549603_550329_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.2e-34
>prophage 40
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	576481	577228	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110898798.1|576481_577228_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	6.8e-20
>prophage 41
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	582464	583421	6393895	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_174812090.1|582464_583421_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	53.6	2.7e-93
>prophage 42
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	614295	615486	6393895		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_110896591.1|614295_615486_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	32.7	5.6e-48
>prophage 43
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	631781	641107	6393895		Staphylococcus_phage(33.33%)	9	NA	NA
WP_167433677.1|631781_632819_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	23.9	2.6e-09
WP_110896607.1|633103_633433_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.3	2.1e-13
WP_110896608.1|633429_634866_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	64.8	9.1e-154
WP_174812091.1|634868_635294_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	51.1	2.3e-33
WP_110896610.1|635295_635733_+	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_110896868.1|635966_636338_-	RDD family protein	NA	NA	NA	NA	NA
WP_110896611.1|636517_637480_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110896612.1|637541_639311_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	2.9e-45
WP_110896613.1|639307_641107_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	5.8e-33
>prophage 44
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	650923	652114	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110896869.1|650923_652114_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	40.4	1.2e-58
>prophage 45
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	657814	660456	6393895		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_110896622.1|657814_658570_-	glucose 1-dehydrogenase	NA	A0A167REC2	Powai_lake_megavirus	24.7	2.5e-09
WP_110896623.1|658728_660456_-	ubiquinone-dependent pyruvate dehydrogenase	NA	G8DDL3	Micromonas_pusilla_virus	24.7	1.2e-38
>prophage 46
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	673592	674474	6393895		Mollivirus(100.0%)	1	NA	NA
WP_110896633.1|673592_674474_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	22.9	3.1e-11
>prophage 47
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	679130	679838	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110896638.1|679130_679838_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	1.4e-19
>prophage 48
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	684117	685419	6393895		Geobacillus_virus(100.0%)	1	NA	NA
WP_110896641.1|684117_685419_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.3	7.0e-137
>prophage 49
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	701165	701984	6393895		Acidianus_two-tailed_virus(100.0%)	1	NA	NA
WP_110896655.1|701165_701984_+	radical SAM protein	NA	A0A1C9EG49	Acidianus_two-tailed_virus	29.0	8.0e-14
>prophage 50
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	705727	706750	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110896658.1|705727_706750_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	6.9e-23
>prophage 51
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	711896	712439	6393895		Acinetobacter_phage(100.0%)	1	NA	NA
WP_110896661.1|711896_712439_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.8	6.5e-20
>prophage 52
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	726373	729181	6393895		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_110896672.1|726373_729181_-	CHASE3 domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.5	1.8e-41
>prophage 53
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	757080	758007	6393895	integrase	Mycobacterium_phage(100.0%)	1	754004:754017	758585:758598
754004:754017	attL	GCTGATCTGGAGCT	NA	NA	NA	NA
WP_110896881.1|757080_758007_-|integrase	tyrosine-type recombinase/integrase	integrase	S5VW51	Mycobacterium_phage	26.6	3.2e-11
WP_110896881.1|757080_758007_-|integrase	tyrosine-type recombinase/integrase	integrase	S5VW51	Mycobacterium_phage	26.6	3.2e-11
758585:758598	attR	AGCTCCAGATCAGC	NA	NA	NA	NA
>prophage 54
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	772320	773016	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110896713.1|772320_773016_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	1.2e-29
>prophage 55
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	784268	786847	6393895	transposase	Bacillus_phage(33.33%)	3	NA	NA
WP_110896725.1|784268_784940_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V6E2	Bacillus_phage	43.0	4.7e-12
WP_110896726.1|785431_785920_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	1.1e-18
WP_110896727.1|786124_786847_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.9e-30
>prophage 56
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	793462	799159	6393895		Enterobacteria_phage(33.33%)	4	NA	NA
WP_110896731.1|793462_794689_+	glucose-1-phosphate adenylyltransferase	NA	I7I009	Enterobacteria_phage	27.8	1.7e-12
WP_110896732.1|796351_797050_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	1.9e-32
WP_174812096.1|797042_798371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896734.1|798433_799159_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.2	6.0e-21
>prophage 57
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	802527	804831	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110896737.1|802527_804831_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	27.5	2.6e-41
>prophage 58
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	807871	809248	6393895		Bacillus_phage(50.0%)	2	NA	NA
WP_110896739.1|807871_808360_-	dihydrofolate reductase	NA	A0A218KC58	Bacillus_phage	41.6	5.1e-32
WP_110896740.1|808453_809248_-	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	72.7	3.1e-119
>prophage 59
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	817971	820516	6393895		Bacillus_phage(50.0%)	3	NA	NA
WP_110896748.1|817971_818472_+	C40 family peptidase	NA	F8WPZ7	Bacillus_phage	32.3	1.4e-05
WP_167433684.1|818548_819247_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_110896750.1|819466_820516_-	ThiF family adenylyltransferase	NA	A0A1V0SAV8	Catovirus	28.8	9.0e-10
>prophage 60
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	823947	825501	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110896755.1|823947_825501_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.6	1.5e-53
>prophage 61
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	834644	846158	6393895		Niemeyer_virus(25.0%)	10	NA	NA
WP_110896765.1|834644_836129_-	serine/threonine protein kinase	NA	A0A0U2U263	Niemeyer_virus	29.8	2.4e-16
WP_110896766.1|836314_837364_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_110896767.1|837370_838150_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.2	6.7e-10
WP_110896768.1|838146_838464_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_110896769.1|838460_838802_-	cell division protein FtsJ	NA	NA	NA	NA	NA
WP_110896770.1|838821_839670_-	deoxyribonuclease IV	NA	NA	NA	NA	NA
WP_110896771.1|839659_840481_-	Fpg/Nei family DNA glycosylase	NA	G3MA33	Bacillus_virus	26.2	7.8e-17
WP_110896772.1|840488_841298_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_110896773.1|841691_842642_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_110896774.1|842717_846158_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	53.3	3.5e-10
>prophage 62
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	850690	851317	6393895		Phage_Wrath(100.0%)	1	NA	NA
WP_056689962.1|850690_851317_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	60.9	3.3e-15
>prophage 63
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	859581	861501	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110896788.1|859581_861501_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	26.2	2.7e-44
>prophage 64
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	865822	871334	6393895		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_110896886.1|865822_866545_-	bacterial surface protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	37.8	3.8e-15
WP_110896790.1|866803_867478_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	53.2	8.6e-38
WP_167433698.1|867688_868447_+	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	36.7	8.5e-18
WP_110896792.1|868559_868757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110896793.1|869464_869623_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_167433687.1|869745_869898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146236157.1|869894_871334_-	XRE family transcriptional regulator	NA	S5MC02	Brevibacillus_phage	25.0	1.4e-16
>prophage 65
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	880764	889147	6393895		Pseudomonas_phage(25.0%)	7	NA	NA
WP_110896797.1|880764_882156_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.8	4.5e-25
WP_110896798.1|882622_883990_-	VWA domain-containing protein	NA	A7KV72	Bacillus_phage	23.9	3.6e-35
WP_110896799.1|883993_885088_-	AAA family ATPase	NA	A0A2H4PB07	Aphanizomenon_phage	32.8	4.6e-41
WP_110896800.1|885182_886079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896801.1|886159_886711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174812099.1|886942_887392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896803.1|887974_889147_-	copper amine oxidase	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	26.7	7.0e-11
>prophage 66
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	893985	894435	6393895		Paenibacillus_phage(100.0%)	1	NA	NA
WP_110896810.1|893985_894435_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	80.8	1.7e-42
>prophage 67
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	924243	925953	6393895		Pontimonas_phage(100.0%)	1	NA	NA
WP_110896839.1|924243_925953_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	45.6	4.6e-19
>prophage 68
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	933401	933713	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110896847.1|933401_933713_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	42.4	3.8e-09
>prophage 69
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	937758	941977	6393895		Brevibacillus_phage(50.0%)	5	NA	NA
WP_110896854.1|937758_940002_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.8	1.0e-71
WP_167433695.1|940001_940817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896856.1|940854_941127_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	58.1	4.0e-26
WP_110896857.1|941119_941335_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AMZ9	Paenibacillus_phage	40.6	2.9e-08
WP_110896858.1|941563_941977_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AEK1	Paenibacillus_phage	36.4	2.2e-12
>prophage 70
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	949174	950131	6393895	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_174812090.1|949174_950131_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	53.6	2.7e-93
>prophage 71
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	956424	957561	6393895	integrase	Bacillus_phage(100.0%)	1	950556:950571	963397:963412
950556:950571	attL	ATCCTTCTAATATCTG	NA	NA	NA	NA
WP_110899349.1|956424_957561_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	64.4	2.9e-62
WP_110899349.1|956424_957561_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	64.4	2.9e-62
963397:963412	attR	CAGATATTAGAAGGAT	NA	NA	NA	NA
>prophage 72
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	962360	963332	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110899345.1|962360_963332_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	45.8	1.9e-54
>prophage 73
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	969525	974797	6393895		Wolbachia_phage(50.0%)	2	NA	NA
WP_110899340.1|969525_971895_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	1.6e-59
WP_110899339.1|971917_974797_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	21.7	3.7e-29
>prophage 74
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	979426	980221	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110899335.1|979426_980221_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	2.3e-34
>prophage 75
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	985497	991107	6393895	tRNA	Cronobacter_phage(33.33%)	5	NA	NA
WP_110899328.1|985497_986760_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.2	1.3e-84
WP_110899326.1|987384_987840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433838.1|987836_988442_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110899324.1|988632_989400_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	4.0e-23
WP_110899323.1|989637_991107_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.8	4.7e-49
>prophage 76
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	994166	1001131	6393895		Klosneuvirus(33.33%)	8	NA	NA
WP_110899320.1|994166_995405_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.3	1.1e-17
WP_110899319.1|995464_996502_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_110899318.1|996598_997348_+	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.8	1.9e-14
WP_110899317.1|997507_997690_-	YjfB family protein	NA	NA	NA	NA	NA
WP_167433837.1|998105_998255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110899316.1|998289_999150_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_110899355.1|999270_999792_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110899315.1|999970_1001131_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	48.7	1.7e-94
>prophage 77
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1010985	1014704	6393895		Prochlorococcus_phage(33.33%)	3	NA	NA
WP_174812101.1|1010985_1012404_-	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.9	1.4e-34
WP_110894094.1|1012472_1013138_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	45.2	4.5e-47
WP_110894096.1|1013180_1014704_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.7	5.2e-67
>prophage 78
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1018351	1019941	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110894102.1|1018351_1019941_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.0	2.2e-15
>prophage 79
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1024160	1025186	6393895		Mycobacterium_phage(100.0%)	1	NA	NA
WP_110894111.1|1024160_1025186_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	26.5	2.5e-12
>prophage 80
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1044936	1047946	6393895		Bacillus_phage(66.67%)	3	NA	NA
WP_110894137.1|1044936_1045623_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	3.1e-35
WP_110894139.1|1045607_1047074_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	4.0e-24
WP_110894141.1|1047133_1047946_-	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	31.4	1.5e-20
>prophage 81
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1054536	1056054	6393895		Mycobacterium_phage(100.0%)	1	NA	NA
WP_110894159.1|1054536_1056054_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.4	1.8e-22
>prophage 82
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1060620	1072026	6393895	protease	Bacillus_virus(40.0%)	9	NA	NA
WP_110894169.1|1060620_1063083_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.8	4.3e-95
WP_110894171.1|1063095_1065075_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.9e-134
WP_110894173.1|1065151_1066141_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_110894175.1|1066133_1067099_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	7.2e-38
WP_110894177.1|1067099_1067975_-	lysophospholipase	NA	NA	NA	NA	NA
WP_110894179.1|1068211_1068949_-|protease	serine protease	protease	U5Q0C0	Bacillus_phage	61.4	7.9e-37
WP_110894181.1|1069111_1069570_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110894183.1|1069559_1070747_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_110894184.1|1070997_1072026_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	27.6	1.8e-15
>prophage 83
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1075180	1078800	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110894190.1|1075180_1077031_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	6.0e-57
WP_110894192.1|1077027_1078800_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.2	1.8e-55
>prophage 84
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1088050	1091123	6393895		Paenibacillus_phage(50.0%)	2	NA	NA
WP_110894205.1|1088050_1089460_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	41.4	1.4e-21
WP_110894207.1|1089701_1091123_-	N-acetylmuramoyl-L-alanine amidase	NA	G3MB93	Bacillus_virus	29.4	5.9e-12
>prophage 85
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1097880	1100254	6393895		Streptococcus_phage(100.0%)	2	NA	NA
WP_110894219.1|1097880_1098984_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.9	5.6e-79
WP_110894221.1|1099006_1100254_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.9	5.2e-105
>prophage 86
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1106335	1112168	6393895	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_110894235.1|1106335_1107040_-	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	45.5	1.3e-15
WP_090917136.1|1107060_1108356_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	1.1e-60
WP_110894237.1|1108457_1109663_-	acetate kinase	NA	NA	NA	NA	NA
WP_110894239.1|1109659_1110532_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_110894241.1|1110665_1112168_-	AAA family ATPase	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	41.8	2.0e-74
>prophage 87
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1115862	1118715	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110894250.1|1115862_1118715_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	31.3	1.3e-82
>prophage 88
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1123056	1124358	6393895	tRNA	unidentified_phage(100.0%)	1	NA	NA
WP_110894262.1|1123056_1124358_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.3	4.5e-43
>prophage 89
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1128866	1129736	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110894273.1|1128866_1129736_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.6	6.7e-59
>prophage 90
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1140246	1145948	6393895		Acinetobacter_phage(66.67%)	6	NA	NA
WP_110894297.1|1140246_1141347_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.4	7.0e-21
WP_110894299.1|1141393_1142200_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_110894301.1|1142199_1143396_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_110895410.1|1143392_1144076_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110894303.1|1144129_1144918_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.8	1.6e-51
WP_110895412.1|1144907_1145948_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.2	1.7e-72
>prophage 91
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1149632	1152229	6393895		Pandoravirus(50.0%)	3	NA	NA
WP_110894311.1|1149632_1150802_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.7	3.1e-43
WP_110894313.1|1150969_1151761_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_110894315.1|1151785_1152229_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	8.4e-26
>prophage 92
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1158186	1161180	6393895		Bacillus_phage(50.0%)	3	NA	NA
WP_090917341.1|1158186_1158459_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	5.5e-28
WP_110894333.1|1158676_1159663_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_110894335.1|1159659_1161180_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.9e-14
>prophage 93
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1180714	1182310	6393895		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_110894382.1|1180714_1182310_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.9	2.2e-44
>prophage 94
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1186295	1188462	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_174812107.1|1186295_1187690_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	37.5	1.8e-34
WP_110894386.1|1187745_1188462_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.1	2.3e-49
>prophage 95
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1195295	1198182	6393895		Erythrobacter_phage(50.0%)	3	NA	NA
WP_167433589.1|1195295_1196486_-	serine hydrolase	NA	A0A1P8VVG5	Erythrobacter_phage	32.5	3.6e-07
WP_110894404.1|1196660_1197464_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_146236095.1|1197537_1198182_-	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	35.2	2.7e-12
>prophage 96
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1220384	1229589	6393895		Brevibacillus_phage(60.0%)	7	NA	NA
WP_110894437.1|1220384_1221521_-	hypothetical protein	NA	A7KUQ3	Bacillus_phage	32.1	1.5e-18
WP_110894438.1|1221535_1223491_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	27.4	7.8e-15
WP_090922364.1|1223502_1223913_-	hypothetical protein	NA	A7KUQ2	Bacillus_phage	35.5	3.5e-18
WP_110894439.1|1223931_1224348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894440.1|1224347_1227470_-	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	25.7	1.8e-45
WP_110894441.1|1227485_1228889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894443.1|1228938_1229589_-	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	34.5	1.2e-28
>prophage 97
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1233856	1235288	6393895		Brevibacillus_phage(100.0%)	2	NA	NA
WP_110894449.1|1233856_1234336_-	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	46.7	3.8e-24
WP_110894451.1|1234466_1235288_-	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	31.9	1.7e-40
>prophage 98
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1240029	1248983	6393895	holin	Thermus_phage(16.67%)	8	NA	NA
WP_110894465.1|1240029_1240818_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	38.1	6.5e-29
WP_110895416.1|1240814_1241219_-|holin	phage holin family protein	holin	A0A1U9WQR6	Geobacillus_phage	50.4	3.3e-29
WP_110894467.1|1241406_1241802_-	GerW family sporulation protein	NA	NA	NA	NA	NA
WP_110894469.1|1241844_1243332_-	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	30.6	1.4e-61
WP_110895418.1|1243750_1244323_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2FM39	Brevibacillus_phage	54.2	1.9e-54
WP_174812108.1|1244348_1244576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894475.1|1244682_1247826_-	DNA polymerase III subunit alpha	NA	A0A218KC91	Bacillus_phage	54.7	0.0e+00
WP_110894477.1|1247999_1248983_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	39.0	3.1e-52
>prophage 99
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1252785	1253532	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110894491.1|1252785_1253532_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	48.0	2.4e-57
>prophage 100
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1256845	1275840	6393895	protease	Bacillus_phage(40.0%)	32	NA	NA
WP_110894498.1|1256845_1257259_-	hypothetical protein	NA	A0A1S5S9L3	Streptococcus_phage	34.3	1.3e-09
WP_110894500.1|1257245_1257488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894502.1|1257721_1258288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894504.1|1258361_1258649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894506.1|1258825_1259347_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_110894508.1|1259443_1259953_-	dihydrofolate reductase	NA	A0A0Y0DBA9	Bacillus_phage	38.4	3.1e-24
WP_110894510.1|1259949_1260744_-	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	72.7	7.6e-118
WP_110894512.1|1260744_1260963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894513.1|1261056_1261581_-	HAD family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	46.5	2.7e-31
WP_110894516.1|1261602_1262634_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	49.3	7.6e-94
WP_110894518.1|1262677_1264984_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	59.7	1.1e-246
WP_110894520.1|1265051_1265288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174812109.1|1265526_1265724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894524.1|1265734_1265950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894526.1|1266053_1266434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894528.1|1266483_1266648_-	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	64.0	1.6e-14
WP_110894530.1|1266656_1266872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895420.1|1266882_1267128_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	72.7	6.5e-20
WP_110894532.1|1267313_1267529_-	hypothetical protein	NA	U5J9S2	Bacillus_phage	37.9	2.5e-07
WP_110894533.1|1267541_1267955_-	hypothetical protein	NA	A0A2R2ZGS7	Clostridioides_phage	48.1	6.9e-22
WP_110895422.1|1267954_1269079_-	hypothetical protein	NA	A0A2R2ZGT9	Clostridioides_phage	47.6	1.9e-90
WP_110894535.1|1269101_1269488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894537.1|1269737_1270184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894539.1|1270219_1270582_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	29.6	9.3e-07
WP_167433594.1|1270640_1270808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433595.1|1270865_1271750_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	53.2	5.0e-78
WP_110894543.1|1271871_1272057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433596.1|1272061_1272229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894545.1|1272246_1272444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895424.1|1272594_1273278_-	site-specific DNA-methyltransferase	NA	M4M8X6	Vibrio_phage	67.8	2.1e-84
WP_110894549.1|1274119_1274338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146236101.1|1274370_1275840_-	DHH family phosphoesterase	NA	A0A0K2FM92	Brevibacillus_phage	36.1	1.6e-73
>prophage 101
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1279061	1284402	6393895		Bacillus_phage(80.0%)	8	NA	NA
WP_110894562.1|1279061_1279325_-	hypothetical protein	NA	D0R7I0	Paenibacillus_phage	58.5	1.2e-19
WP_110894564.1|1279382_1279628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433598.1|1279734_1279890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894566.1|1279912_1280980_-	DNA primase	NA	A0A218KBY7	Bacillus_phage	35.9	2.5e-60
WP_110894568.1|1280994_1282494_-	replicative DNA helicase	NA	U5JA35	Bacillus_phage	40.2	1.9e-109
WP_174812112.1|1282504_1283098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174812113.1|1283153_1283966_-	hypothetical protein	NA	A0A1P8CWY5	Bacillus_phage	47.1	1.4e-58
WP_110894574.1|1284183_1284402_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	53.3	1.7e-08
>prophage 102
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1290846	1293706	6393895		Streptococcus_phage(50.0%)	4	NA	NA
WP_110894609.1|1290846_1292088_-	DNA polymerase IV	NA	M1Q231	Streptococcus_phage	30.3	4.9e-47
WP_110894611.1|1292246_1292732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110894613.1|1292788_1293073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894614.1|1293085_1293706_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	48.5	1.1e-44
>prophage 103
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1298342	1301591	6393895		Geobacillus_virus(33.33%)	5	NA	NA
WP_110894641.1|1298342_1298855_-	siphovirus Gp157 family protein	NA	A6M981	Geobacillus_virus	40.1	2.8e-25
WP_146236106.1|1299181_1299430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894646.1|1299456_1300548_-	hypothetical protein	NA	A0A140HLM4	Bacillus_phage	39.2	1.3e-54
WP_110894648.1|1300601_1301189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894650.1|1301222_1301591_-	hypothetical protein	NA	A0A0K2CPG3	Brevibacillus_phage	42.7	1.2e-20
>prophage 104
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1304867	1307925	6393895		Bacillus_phage(100.0%)	7	NA	NA
WP_174812114.1|1304867_1305236_-	hypothetical protein	NA	A0A0Y0AFE8	Bacillus_phage	43.3	5.5e-23
WP_110894670.1|1305201_1305585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894672.1|1305609_1305828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894674.1|1305811_1306096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894676.1|1306470_1306815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895426.1|1306833_1307133_-	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	48.8	8.0e-12
WP_110894678.1|1307421_1307925_-	HNH endonuclease	NA	A0A0K1LMG2	Bacillus_phage	34.0	4.2e-13
>prophage 105
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1313299	1318879	6393895		Bacillus_phage(66.67%)	8	NA	NA
WP_110894694.1|1313299_1314313_-	hypothetical protein	NA	A0A1P8CWX4	Bacillus_phage	31.5	7.3e-33
WP_110894695.1|1314305_1315625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894699.1|1316054_1316420_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	38.8	8.2e-11
WP_110894701.1|1316659_1317142_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_174812115.1|1317196_1317940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894705.1|1318011_1318260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894707.1|1318302_1318500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895428.1|1318516_1318879_-	hypothetical protein	NA	A0A0A0RP18	Bacillus_phage	57.1	1.1e-28
>prophage 106
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1325017	1325269	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110894733.1|1325017_1325269_-	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	60.0	6.9e-09
>prophage 107
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1328654	1340164	6393895		Geobacillus_virus(40.0%)	15	NA	NA
WP_110894748.1|1328654_1329317_-	HNH endonuclease	NA	O64121	Bacillus_phage	37.2	1.1e-24
WP_110894750.1|1329348_1329558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894752.1|1329892_1330225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894754.1|1330318_1331359_-	hypothetical protein	NA	A0A2I7SCW0	Paenibacillus_phage	35.4	5.1e-13
WP_110894756.1|1331381_1331561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894758.1|1331642_1331876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894760.1|1332039_1332243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894762.1|1332257_1332491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433606.1|1332689_1332860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894764.1|1333029_1333245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894766.1|1333274_1333517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894768.1|1333605_1336638_-	N-6 DNA methylase	NA	A0A1W7GKP2	Tenacibaculum_phage	38.1	1.8e-199
WP_110894769.1|1336660_1338835_-	hypothetical protein	NA	A0A0H3UZM4	Geobacillus_virus	59.3	1.4e-09
WP_174812117.1|1338954_1339233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110894773.1|1339483_1340164_-	hypothetical protein	NA	A0A0H3UZP0	Geobacillus_virus	33.5	1.8e-19
>prophage 108
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1344106	1400444	6393895	tail,integrase,holin	Brevibacillus_phage(33.33%)	53	1360609:1360624	1381244:1381259
WP_110894781.1|1344106_1346347_-	AAA family ATPase	NA	A0A0H3UZA5	Geobacillus_virus	45.3	1.4e-177
WP_167433607.1|1346343_1347393_-|integrase	site-specific integrase	integrase	A0A218KCE2	Bacillus_phage	33.8	2.4e-31
WP_110895098.1|1347549_1347750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895100.1|1347789_1350366_+	hypothetical protein	NA	O64076	Bacillus_phage	44.1	5.0e-195
WP_110895102.1|1350557_1350881_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	54.7	1.2e-18
WP_110895104.1|1351006_1351201_+	YonK family protein	NA	NA	NA	NA	NA
WP_110895106.1|1351212_1352499_+	hypothetical protein	NA	A0A0U3TGE6	Bacillus_phage	54.9	1.9e-118
WP_167433608.1|1352668_1353310_+	AP2 domain-containing protein	NA	A0A218KBR8	Bacillus_phage	46.9	2.1e-46
WP_110895439.1|1354125_1354557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895110.1|1356442_1358020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433609.1|1358016_1358193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895111.1|1358179_1359619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895113.1|1359644_1360094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895114.1|1360121_1361111_+	hypothetical protein	NA	NA	NA	NA	NA
1360609:1360624	attL	ATAAGATGTTCTTTGA	NA	NA	NA	NA
WP_110895116.1|1361176_1361851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895118.1|1361862_1362351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895120.1|1362356_1363565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895122.1|1363577_1364087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895124.1|1364106_1364577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895126.1|1364588_1365305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895128.1|1365314_1366124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895130.1|1366179_1366959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895132.1|1366921_1367929_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_110895134.1|1367918_1368890_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_110895136.1|1368904_1369387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895138.1|1369376_1369802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895441.1|1369943_1370873_+|integrase	site-specific integrase	integrase	A0A0H3V0P2	Geobacillus_virus	62.4	2.0e-109
WP_110895140.1|1370923_1371337_+	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	38.1	8.1e-15
WP_110895142.1|1371419_1372871_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	31.4	1.4e-13
WP_110895144.1|1373344_1374385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146236109.1|1375002_1380183_+	C40 family peptidase	NA	A0A0H3V0Q1	Geobacillus_virus	30.1	1.6e-30
WP_167433610.1|1380231_1383732_+|tail	phage tail protein	tail	A0A0K2FLF6	Brevibacillus_phage	30.5	3.2e-104
1381244:1381259	attR	ATAAGATGTTCTTTGA	NA	NA	NA	NA
WP_110895443.1|1383855_1384569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433611.1|1384605_1384857_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110895150.1|1384993_1385368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433612.1|1385364_1386180_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	39.0	2.6e-20
WP_146236110.1|1386235_1386733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433613.1|1387127_1387295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_091014540.1|1387294_1387723_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_110895444.1|1387813_1388419_+|tail	phage tail family protein	tail	A0A0K2FMB9	Brevibacillus_phage	44.0	1.3e-32
WP_110895156.1|1388434_1389070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895157.1|1389078_1389717_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_146236111.1|1389725_1390199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895159.1|1390211_1391366_+	hypothetical protein	NA	A0A0K2FMC4	Brevibacillus_phage	35.2	7.5e-58
WP_110895161.1|1391392_1391935_+	hypothetical protein	NA	A0A0K2FLS8	Brevibacillus_phage	67.2	1.4e-67
WP_110895163.1|1392011_1392623_+	hypothetical protein	NA	A0A0K2FM15	Brevibacillus_phage	49.3	6.1e-51
WP_110895165.1|1392623_1393190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812118.1|1393233_1393464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895166.1|1393492_1394182_+	discoidin domain-containing protein	NA	E5ESI2	Bathycoccus_sp._RCC1105_virus	29.9	4.2e-08
WP_110895169.1|1394240_1395500_+	hypothetical protein	NA	G3MAA5	Bacillus_virus	28.3	1.3e-26
WP_110895171.1|1395547_1397644_+	hypothetical protein	NA	G3MAA7	Bacillus_virus	33.6	3.1e-70
WP_110895173.1|1397676_1399941_+	DNRLRE domain-containing protein	NA	A0A0K2FM25	Brevibacillus_phage	32.8	9.9e-54
WP_110895175.1|1399997_1400444_+|holin	phage holin family protein	holin	Q2I8E7	Bacillus_phage	37.1	2.9e-18
>prophage 109
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1404545	1410811	6393895		Staphylococcus_phage(66.67%)	7	NA	NA
WP_110895184.1|1404545_1405346_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.1	1.4e-07
WP_090922403.1|1405449_1405917_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.6	2.5e-44
WP_110895186.1|1406060_1407302_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.9	9.1e-118
WP_110895188.1|1407365_1408034_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.4	5.5e-37
WP_110895190.1|1408126_1409230_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	6.3e-62
WP_110895192.1|1409873_1410149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895194.1|1410379_1410811_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	46.5	2.5e-22
>prophage 110
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1415800	1420973	6393895		Bacillus_phage(50.0%)	6	NA	NA
WP_110895204.1|1415800_1416556_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	56.3	2.2e-66
WP_110895206.1|1416570_1417026_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_110895208.1|1417022_1417376_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_110895210.1|1417518_1418694_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.2	9.4e-40
WP_110895212.1|1419064_1419889_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	44.3	1.7e-59
WP_110895214.1|1420082_1420973_-	tyrosine recombinase	NA	A0A1B1P7C7	Bacillus_phage	25.5	6.7e-14
>prophage 111
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1433662	1437339	6393895		Mycoplasma_phage(50.0%)	4	NA	NA
WP_110895245.1|1433662_1434262_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	37.4	1.2e-22
WP_110895246.1|1434396_1434873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895248.1|1435411_1436062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895250.1|1436301_1437339_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	26.2	7.1e-15
>prophage 112
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1448535	1450768	6393895		Gordonia_phage(50.0%)	2	NA	NA
WP_110895273.1|1448535_1449900_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	26.7	3.8e-24
WP_110895275.1|1449910_1450768_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.9	5.6e-42
>prophage 113
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1467184	1468186	6393895		Klosneuvirus(100.0%)	1	NA	NA
WP_110895312.1|1467184_1468186_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	24.8	6.2e-16
>prophage 114
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1473691	1478561	6393895	tRNA	Bacillus_virus(33.33%)	4	NA	NA
WP_110895451.1|1473691_1474450_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.7e-15
WP_110895324.1|1474558_1475611_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110895326.1|1475861_1477886_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.0	2.1e-95
WP_110895327.1|1478306_1478561_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.0	4.8e-18
>prophage 115
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1481920	1485011	6393895		Klebsiella_phage(50.0%)	2	NA	NA
WP_110895333.1|1481920_1482673_-	pyruvate formate lyase-activating protein	NA	A0A0K1Y4M0	Klebsiella_phage	30.1	3.8e-10
WP_110895335.1|1482752_1485011_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.2	2.6e-187
>prophage 116
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1505806	1506703	6393895		Lactococcus_phage(100.0%)	1	NA	NA
WP_110895453.1|1505806_1506703_+	cysteine synthase A	NA	A0A1W6JIM2	Lactococcus_phage	55.5	6.8e-83
>prophage 117
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1536490	1537447	6393895	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_174812090.1|1536490_1537447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	53.6	2.7e-93
>prophage 118
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1551596	1554071	6393895		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_110898609.1|1551596_1552964_-	nucleotide sugar dehydrogenase	NA	M1I6A7	Acanthocystis_turfacea_Chlorella_virus	30.0	2.1e-38
WP_110898608.1|1553267_1554071_-	response regulator	NA	W8CYM9	Bacillus_phage	33.9	4.6e-14
>prophage 119
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1566674	1569185	6393895		Clostridioides_phage(50.0%)	2	NA	NA
WP_110898599.1|1566674_1567496_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	23.2	3.5e-09
WP_110898622.1|1567532_1569185_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.1	9.7e-51
>prophage 120
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1585103	1585967	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110898590.1|1585103_1585967_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	39.4	9.7e-18
>prophage 121
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1591124	1593338	6393895		Salmon_gill_poxvirus(100.0%)	1	NA	NA
WP_110898584.1|1591124_1593338_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	31.4	1.9e-25
>prophage 122
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1596930	1603473	6393895	tRNA	Synechococcus_phage(50.0%)	6	NA	NA
WP_174812305.1|1596930_1597875_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	32.0	6.6e-12
WP_110898580.1|1597902_1598391_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.6	6.4e-19
WP_110898579.1|1598546_1601096_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_110898578.1|1601099_1602371_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.5	1.0e-44
WP_110898577.1|1602527_1602740_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_110898576.1|1602900_1603473_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	31.6	1.2e-21
>prophage 123
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1607874	1610733	6393895		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_110898573.1|1607874_1610733_-	cation-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	28.8	3.4e-83
>prophage 124
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1628400	1630392	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110898557.1|1628400_1630392_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	2.5e-16
>prophage 125
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1637356	1639081	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110898553.1|1637356_1639081_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	69.7	4.0e-196
>prophage 126
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1644002	1647640	6393895		Hokovirus(50.0%)	2	NA	NA
WP_110898546.1|1644002_1645763_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	3.2e-15
WP_110898545.1|1645759_1647640_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	47.4	2.4e-13
>prophage 127
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1650932	1652342	6393895		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_174812134.1|1650932_1652342_-	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	31.2	6.4e-35
>prophage 128
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1664134	1684895	6393895		Paenibacillus_phage(22.22%)	22	NA	NA
WP_110898451.1|1664134_1664362_-	hypothetical protein	NA	A0A2I7SCF7	Paenibacillus_phage	47.3	1.0e-06
WP_110898452.1|1664568_1664898_-	DUF3889 domain-containing protein	NA	NA	NA	NA	NA
WP_146236205.1|1664955_1665258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898454.1|1665547_1666450_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_174812136.1|1666654_1666897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898456.1|1667115_1668831_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.0	2.6e-62
WP_110898457.1|1668883_1669915_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_110898529.1|1669914_1670955_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_110898458.1|1671246_1671984_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	30.9	1.7e-18
WP_146236207.1|1672213_1672558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898459.1|1672965_1673550_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	25.9	1.6e-08
WP_110898460.1|1673904_1674324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898461.1|1674344_1675013_-	uracil-DNA glycosylase	NA	A0A0A7D988	Equid_alphaherpesvirus	47.4	1.1e-50
WP_110898530.1|1675273_1676530_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_110898462.1|1676797_1677505_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110898463.1|1677719_1680641_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	25.4	1.1e-07
WP_146236208.1|1680836_1681145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898465.1|1681263_1681614_+	hypothetical protein	NA	A0A2I7SC08	Paenibacillus_phage	58.7	1.5e-25
WP_110898466.1|1681974_1682424_-	general stress protein	NA	NA	NA	NA	NA
WP_110898467.1|1682637_1682862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898468.1|1683142_1683625_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	56.6	4.2e-39
WP_110898469.1|1683746_1684895_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	38.1	7.2e-45
>prophage 129
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1691725	1692589	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110898476.1|1691725_1692589_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.0e-30
>prophage 130
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1696590	1698447	6393895		Planktothrix_phage(50.0%)	2	NA	NA
WP_110898533.1|1696590_1697346_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	2.7e-32
WP_110898479.1|1697805_1698447_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	34.6	1.6e-30
>prophage 131
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1702507	1706388	6393895		Halovirus(50.0%)	3	NA	NA
WP_110898482.1|1702507_1703650_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.5	1.4e-56
WP_110898483.1|1704042_1705347_-	dihydroorotase	NA	NA	NA	NA	NA
WP_110898484.1|1705473_1706388_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HQL8	Paramecium_bursaria_Chlorella_virus	38.1	4.3e-32
>prophage 132
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1715488	1721580	6393895	tRNA	Bodo_saltans_virus(50.0%)	5	NA	NA
WP_110898491.1|1715488_1716451_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.9	1.8e-09
WP_110898492.1|1716443_1716938_-	signal peptidase II	NA	NA	NA	NA	NA
WP_110898493.1|1717164_1717893_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_110898494.1|1717889_1718252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898495.1|1718481_1721580_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	35.8	6.5e-165
>prophage 133
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1726627	1728244	6393895		Bacillus_phage(50.0%)	2	NA	NA
WP_110898501.1|1726627_1727410_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.1	1.9e-44
WP_110898502.1|1727521_1728244_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	43.6	9.2e-22
>prophage 134
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1749121	1753999	6393895		Pandoravirus(50.0%)	3	NA	NA
WP_110898515.1|1749121_1750387_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	35.6	1.4e-65
WP_110898516.1|1750444_1752076_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_110898517.1|1752229_1753999_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	8.6e-21
>prophage 135
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1764721	1766056	6393895		Vibrio_phage(100.0%)	1	NA	NA
WP_110897959.1|1764721_1766056_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	33.3	7.8e-59
>prophage 136
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1772168	1780925	6393895	tRNA	Pseudomonas_phage(50.0%)	9	NA	NA
WP_110897966.1|1772168_1772828_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	39.2	5.8e-31
WP_110897967.1|1772916_1773618_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	40.4	2.2e-28
WP_110898080.1|1773768_1775010_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_110897968.1|1775018_1776167_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_110897969.1|1776341_1777085_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	45.6	5.4e-25
WP_110897970.1|1777308_1777737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897971.1|1777772_1777991_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_110897972.1|1778241_1778748_-	YpuI family protein	NA	NA	NA	NA	NA
WP_110897973.1|1779050_1780925_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	36.8	5.1e-56
>prophage 137
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1787057	1790063	6393895		Synechococcus_phage(50.0%)	2	NA	NA
WP_110897979.1|1787057_1788197_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.9	2.0e-39
WP_110898081.1|1788242_1790063_-	DNA primase	NA	A0A1S5REW9	Helicobacter_phage	32.0	5.0e-40
>prophage 138
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1800360	1801332	6393895		Pseudomonas_phage(100.0%)	1	NA	NA
WP_110897990.1|1800360_1801332_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	3.8e-47
>prophage 139
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1806459	1812068	6393895		Xanthomonas_phage(50.0%)	5	NA	NA
WP_110897995.1|1806459_1806903_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	34.3	3.2e-09
WP_005547957.1|1806918_1807092_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_110897996.1|1807270_1807630_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_174812140.1|1807911_1808295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897997.1|1808648_1812068_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	26.2	3.1e-11
>prophage 140
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1821516	1822893	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110898001.1|1821516_1822893_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	21.8	1.5e-17
>prophage 141
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1830017	1833112	6393895		Catovirus(50.0%)	2	NA	NA
WP_110898010.1|1830017_1831136_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	30.2	1.3e-25
WP_110898011.1|1831264_1833112_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.7	1.7e-141
>prophage 142
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1836441	1837173	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110898015.1|1836441_1837173_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	2.4e-38
>prophage 143
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1840679	1842494	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110898019.1|1840679_1842494_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.5	2.3e-21
>prophage 144
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1850199	1857627	6393895	tRNA	Clostridium_botulinum_C_phage(33.33%)	5	NA	NA
WP_110898085.1|1850199_1852884_-	ComEC family competence protein	NA	Q332B9	Clostridium_botulinum_C_phage	30.9	6.5e-28
WP_110898027.1|1853072_1853594_-	cytidine/deoxycytidylate deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	42.9	3.0e-22
WP_110898028.1|1853642_1854170_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_110898029.1|1854356_1855202_+	late competence protein ComER	NA	NA	NA	NA	NA
WP_110898030.1|1855182_1857627_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.6	0.0e+00
>prophage 145
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1882459	1883227	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110898054.1|1882459_1883227_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.6	7.8e-11
>prophage 146
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1893204	1918069	6393895		Paenibacillus_phage(33.33%)	6	NA	NA
WP_167433774.1|1893204_1897338_-	AMP-binding protein	NA	D0R7J2	Paenibacillus_phage	35.1	1.6e-30
WP_146236193.1|1897327_1914097_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	24.2	5.0e-86
WP_110898086.1|1914156_1914576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898066.1|1915053_1915911_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_110898087.1|1916290_1916725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898067.1|1917079_1918069_-	serine/threonine protein kinase	NA	A0A2I2L4T9	Orpheovirus	31.6	2.6e-14
>prophage 147
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1921125	1921893	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110898071.1|1921125_1921893_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.3	2.7e-11
>prophage 148
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1931025	1958380	6393895	holin,tail,capsid,portal,transposase,plate,terminase	Bacillus_phage(18.18%)	32	NA	NA
WP_174812090.1|1931025_1931982_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	53.6	2.7e-93
WP_110896538.1|1932985_1933420_-|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	63.4	8.2e-42
WP_110896537.1|1933592_1934039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896536.1|1934038_1934674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433674.1|1934674_1935913_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_110896534.1|1935959_1936280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896533.1|1936279_1936933_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_110896532.1|1936929_1937754_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_110896571.1|1937750_1938164_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_110896531.1|1938197_1938521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896530.1|1938520_1939501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896529.1|1939511_1940165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896528.1|1940168_1943468_-|tail	tail tape measure protein	tail	S5MBW5	Brevibacillus_phage	38.1	6.8e-11
WP_110896527.1|1943626_1944037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896526.1|1944158_1944509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896525.1|1944642_1945086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896524.1|1945089_1946442_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J187	uncultured_Caudovirales_phage	31.2	5.7e-25
WP_110896523.1|1946667_1947141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896522.1|1947137_1947662_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_110896521.1|1947651_1947975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896520.1|1947971_1948358_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_110896519.1|1948326_1948653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896518.1|1948652_1949585_-|capsid	major capsid protein	capsid	H7BVA6	unidentified_phage	32.5	2.1e-34
WP_110896517.1|1949614_1950856_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	42.8	1.6e-53
WP_110896516.1|1950921_1951206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110896515.1|1951202_1952033_-	hypothetical protein	NA	A0A142KA74	Gordonia_phage	43.8	4.5e-12
WP_110896514.1|1952025_1953507_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	30.8	2.3e-51
WP_110896513.1|1953507_1955199_-	DNA packaging protein	NA	M4MCI5	Vibrio_phage	30.0	8.5e-42
WP_110896512.1|1955192_1956080_-|terminase	terminase	terminase	D2J000	Enterococcus_phage	36.0	1.4e-24
WP_110896511.1|1956124_1956673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896510.1|1956729_1956939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896509.1|1957072_1958380_-	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	43.9	4.3e-94
>prophage 149
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1962205	1981328	6393895		Paenibacillus_phage(18.18%)	32	NA	NA
WP_110896502.1|1962205_1962685_-	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	38.8	5.7e-20
WP_110896501.1|1962897_1963077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433669.1|1963076_1963454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896500.1|1963450_1963915_-	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	25.1	6.6e-05
WP_110896499.1|1964000_1964900_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_110896498.1|1964901_1965204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110896497.1|1965288_1966140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896569.1|1966161_1966578_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	61.6	4.9e-44
WP_174812143.1|1966719_1966875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433668.1|1966913_1967072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896495.1|1967084_1968515_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	45.1	9.2e-98
WP_110896494.1|1968483_1968819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896493.1|1968805_1969813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896492.1|1969825_1970089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896491.1|1970085_1970280_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	48.4	1.1e-09
WP_110896490.1|1970282_1970471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896489.1|1970475_1971183_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	64.7	1.2e-85
WP_110896568.1|1971182_1972136_-	recombinase RecT	NA	NA	NA	NA	NA
WP_110896488.1|1972217_1974296_-	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	45.1	1.4e-150
WP_110896487.1|1974292_1974499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896486.1|1974591_1974837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896485.1|1974918_1975149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896484.1|1975145_1975418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896567.1|1975422_1975662_-	helix-turn-helix transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	56.6	2.7e-18
WP_146236147.1|1975769_1976054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167433667.1|1976040_1976202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896482.1|1976347_1976620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433666.1|1976875_1977100_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110896479.1|1977254_1977629_+	helix-turn-helix transcriptional regulator	NA	S5MUV6	Brevibacillus_phage	75.4	6.9e-21
WP_110896478.1|1977947_1979309_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	54.2	4.1e-63
WP_110896477.1|1979329_1979674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110896476.1|1979780_1981328_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	49.9	1.4e-131
>prophage 150
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	1988996	1989923	6393895		Serratia_phage(100.0%)	1	NA	NA
WP_110896471.1|1988996_1989923_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	45.6	1.0e-65
>prophage 151
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2004266	2005400	6393895	integrase	Bacillus_phage(100.0%)	1	1995652:1995665	2006160:2006173
1995652:1995665	attL	AATTTCCGTCAATG	NA	NA	NA	NA
WP_110896460.1|2004266_2005400_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	38.0	2.1e-57
WP_110896460.1|2004266_2005400_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	38.0	2.1e-57
2006160:2006173	attR	AATTTCCGTCAATG	NA	NA	NA	NA
>prophage 152
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2010412	2011642	6393895		Bordetella_phage(100.0%)	1	NA	NA
WP_110896456.1|2010412_2011642_+	hypothetical protein	NA	A0A2D0W9A5	Bordetella_phage	29.5	1.9e-14
>prophage 153
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2024074	2025091	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110896444.1|2024074_2025091_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.2	1.3e-32
>prophage 154
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2033783	2035856	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110896438.1|2033783_2035856_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.5	3.8e-12
>prophage 155
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2039559	2041707	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110896561.1|2039559_2041707_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.2	5.9e-24
>prophage 156
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2056559	2058809	6393895		Mollivirus(100.0%)	1	NA	NA
WP_110896421.1|2056559_2058809_-	carboxylesterase family protein	NA	A0A0M4JT58	Mollivirus	31.5	2.8e-32
>prophage 157
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2066201	2069581	6393895		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_167433660.1|2066201_2067674_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.8	7.7e-07
WP_110896415.1|2068042_2069581_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.9	6.6e-09
>prophage 158
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2082229	2083981	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110896405.1|2082229_2083981_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	3.5e-22
>prophage 159
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2099744	2100500	6393895		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_110896391.1|2099744_2100500_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.3	4.3e-62
>prophage 160
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2112947	2118122	6393895		Enterobacteria_phage(50.0%)	4	NA	NA
WP_110896382.1|2112947_2113976_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	1.6e-27
WP_110896381.1|2114195_2114558_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_174812147.1|2115031_2115901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433656.1|2116061_2118122_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.0	8.0e-10
>prophage 161
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2129762	2131373	6393895		Catovirus(100.0%)	1	NA	NA
WP_110896370.1|2129762_2131373_-	Hsp70 family protein	NA	A0A1V0SC87	Catovirus	29.8	1.5e-40
>prophage 162
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2139353	2144099	6393895		Streptococcus_phage(33.33%)	5	NA	NA
WP_110896361.1|2139353_2140301_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.9	6.6e-20
WP_110896360.1|2140453_2141209_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	4.8e-13
WP_167433671.1|2141271_2142174_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_110896358.1|2142176_2143145_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_110896357.1|2143235_2144099_-	phosphate ABC transporter substrate-binding protein	NA	E3SLK5	Synechococcus_phage	26.2	2.6e-07
>prophage 163
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2147201	2151915	6393895		Enterobacteria_phage(50.0%)	4	NA	NA
WP_110896354.1|2147201_2150234_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.8	1.0e-21
WP_174812148.1|2150439_2150601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174812149.1|2150892_2151054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896353.1|2151096_2151915_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.2	1.7e-59
>prophage 164
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2157944	2159777	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110896348.1|2157944_2159777_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.1	1.5e-15
>prophage 165
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2164892	2165624	6393895		Halovirus(100.0%)	1	NA	NA
WP_110896343.1|2164892_2165624_-	metallophosphoesterase family protein	NA	R4T9B5	Halovirus	22.1	7.9e-05
>prophage 166
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2171321	2171876	6393895		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_110896335.1|2171321_2171876_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	54.4	8.4e-23
>prophage 167
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2175525	2181751	6393895		Bacillus_virus(50.0%)	4	NA	NA
WP_110896331.1|2175525_2177076_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.1e-16
WP_110896330.1|2177106_2178192_-	sugar-binding protein	NA	NA	NA	NA	NA
WP_110896553.1|2178497_2179745_-	response regulator	NA	NA	NA	NA	NA
WP_110896329.1|2179765_2181751_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	35.5	1.0e-25
>prophage 168
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2198137	2202236	6393895		Indivirus(33.33%)	3	NA	NA
WP_110896551.1|2198137_2199430_-	ATP-binding protein	NA	A0A1V0SEI6	Indivirus	34.0	3.7e-13
WP_174812150.1|2199450_2200914_-	RtcB family protein	NA	A0A0K2CNT0	Brevibacillus_phage	57.6	1.6e-150
WP_110896549.1|2201417_2202236_-	TerC family protein	NA	S5MAL1	Bacillus_phage	43.4	3.0e-29
>prophage 169
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2231147	2234116	6393895		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_110896293.1|2231147_2232503_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	36.3	3.2e-52
WP_110896547.1|2232640_2234116_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	40.2	2.8e-81
>prophage 170
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2239799	2241344	6393895		Orpheovirus(100.0%)	1	NA	NA
WP_110896289.1|2239799_2241344_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	25.3	4.4e-05
>prophage 171
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2245884	2246874	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110896284.1|2245884_2246874_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	38.0	8.7e-55
>prophage 172
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2250413	2251154	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110896281.1|2250413_2251154_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	34.5	2.1e-29
>prophage 173
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2263164	2273365	6393895	tRNA	Phage_TP(50.0%)	9	NA	NA
WP_110896272.1|2263164_2265447_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	4.7e-11
WP_110896271.1|2265780_2267109_-	U32 family peptidase	NA	Q6DW11	Phage_TP	35.4	2.9e-45
WP_110896270.1|2267126_2268056_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.4	9.4e-19
WP_110896544.1|2268070_2269096_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_110896269.1|2269186_2269501_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_017686820.1|2269501_2269801_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_174812308.1|2269813_2270230_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_090915537.1|2270353_2270614_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_110896267.1|2270743_2273365_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	36.0	7.9e-71
>prophage 174
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2280415	2306203	6393895	tRNA	Bacillus_phage(16.67%)	20	NA	NA
WP_110896259.1|2280415_2281723_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	49.7	1.1e-105
WP_110896258.1|2281781_2282702_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110896257.1|2282849_2283593_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.8	2.8e-13
WP_110896256.1|2283589_2284498_+	EamA family transporter	NA	NA	NA	NA	NA
WP_110896255.1|2284603_2286790_-	UvrD-helicase domain-containing protein	NA	A0A1V0SG90	Hokovirus	25.0	4.6e-08
WP_174812151.1|2287070_2288873_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	55.2	8.7e-146
WP_110896254.1|2288911_2290210_-	NCS2 family permease	NA	NA	NA	NA	NA
WP_110896253.1|2290403_2291162_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_110896252.1|2291180_2292959_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.9	5.2e-18
WP_110896251.1|2293040_2294294_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.2	1.4e-17
WP_110896250.1|2295193_2295640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896249.1|2295737_2296244_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	38.8	3.0e-19
WP_167433649.1|2296479_2296647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896248.1|2296750_2297200_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_110896247.1|2297212_2299390_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	40.7	2.6e-11
WP_110896246.1|2299716_2301033_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.0	8.8e-63
WP_110896245.1|2301261_2301777_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.2	2.8e-28
WP_110896244.1|2301814_2304223_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.6	2.7e-86
WP_110896243.1|2304261_2305221_-	cation transporter	NA	NA	NA	NA	NA
WP_110896242.1|2305294_2306203_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.8	4.1e-35
>prophage 175
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2311061	2312583	6393895	tRNA	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_110896541.1|2311061_2311367_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.8	9.3e-08
WP_110896237.1|2311446_2312583_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	4.2e-85
>prophage 176
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2315901	2316912	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110896235.1|2315901_2316912_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.8	4.8e-08
>prophage 177
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2336379	2336709	6393895	protease	Enterococcus_phage(100.0%)	1	NA	NA
WP_110898890.1|2336379_2336709_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	30.2	2.1e-05
>prophage 178
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2350900	2356788	6393895	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_110898904.1|2350900_2353564_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.7	2.5e-165
WP_110898905.1|2354128_2355667_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_110898906.1|2355867_2356788_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	2.2e-07
>prophage 179
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2366059	2373495	6393895	protease	Moraxella_phage(50.0%)	5	NA	NA
WP_110898914.1|2366059_2368399_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	9.9e-174
WP_174812153.1|2368485_2370243_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	29.6	2.8e-16
WP_110898915.1|2370420_2371518_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_110898916.1|2371638_2372892_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.7	8.5e-148
WP_090919143.1|2372904_2373495_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.7	1.5e-54
>prophage 180
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2379203	2390229	6393895		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_167433815.1|2379203_2383151_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	35.4	7.8e-22
WP_110898947.1|2383566_2384346_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_110898920.1|2385155_2385449_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	39.1	7.6e-07
WP_110898921.1|2385648_2386005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898922.1|2386066_2386366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898923.1|2386560_2388405_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9L187	Tupanvirus	26.3	4.7e-30
WP_110898924.1|2388531_2390229_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	2.7e-16
>prophage 181
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2399028	2399595	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110898932.1|2399028_2399595_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.2	2.2e-39
>prophage 182
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2404128	2405004	6393895		Kaumoebavirus(100.0%)	1	NA	NA
WP_110898938.1|2404128_2405004_+	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	33.6	3.3e-13
>prophage 183
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2415154	2415382	6393895		Caldibacillus_phage(100.0%)	1	NA	NA
WP_090919235.1|2415154_2415382_-	helix-turn-helix transcriptional regulator	NA	A0A290GJH9	Caldibacillus_phage	73.2	6.0e-12
>prophage 184
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2419950	2421135	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110897457.1|2419950_2421135_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	1.4e-30
>prophage 185
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2427646	2433089	6393895		Catovirus(80.0%)	7	NA	NA
WP_110897451.1|2427646_2428363_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.3	6.4e-07
WP_110897450.1|2428325_2428544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897449.1|2428558_2429275_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.4	2.7e-05
WP_110897448.1|2429271_2430213_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_110897447.1|2430194_2431022_-	SDR family oxidoreductase	NA	A0A1V0SAG7	Catovirus	34.9	6.8e-29
WP_110897446.1|2431018_2432005_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	32.8	1.1e-38
WP_110897486.1|2431997_2433089_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	45.3	1.5e-92
>prophage 186
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2438763	2439516	6393895		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_110897440.1|2438763_2439516_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	1.8e-15
>prophage 187
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2451698	2452508	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110897429.1|2451698_2452508_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	7.7e-17
>prophage 188
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2474845	2475577	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110897412.1|2474845_2475577_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	41.6	3.5e-45
>prophage 189
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2493835	2495993	6393895		Staphylococcus_phage(50.0%)	2	NA	NA
WP_110897399.1|2493835_2494588_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-20
WP_110897398.1|2494613_2495993_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	29.9	7.4e-44
>prophage 190
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2503908	2505651	6393895		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_110897389.1|2503908_2505651_-	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.9	2.6e-17
>prophage 191
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2514300	2516094	6393895		Staphylococcus_phage(50.0%)	3	NA	NA
WP_110897382.1|2514300_2514618_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	1.6e-23
WP_110897381.1|2514884_2515040_+	YqzM family protein	NA	NA	NA	NA	NA
WP_110897380.1|2515143_2516094_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	37.5	1.1e-43
>prophage 192
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2542100	2543102	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110897368.1|2542100_2543102_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	45.2	1.0e-23
>prophage 193
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2555813	2556170	6393895		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_110897355.1|2555813_2556170_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	37.9	2.3e-13
>prophage 194
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2563307	2564342	6393895		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_110897347.1|2563307_2564342_-	methionine ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	25.2	2.9e-08
>prophage 195
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2574237	2575002	6393895		Pithovirus(100.0%)	1	NA	NA
WP_110897471.1|2574237_2575002_-	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.9	2.9e-18
>prophage 196
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2586552	2586768	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_090919614.1|2586552_2586768_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	52.1	1.6e-09
>prophage 197
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2590035	2590269	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_076211017.1|2590035_2590269_+	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	43.3	1.6e-07
>prophage 198
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2598789	2603976	6393895		Synechococcus_phage(66.67%)	4	NA	NA
WP_110897466.1|2598789_2599821_+	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	43.0	4.0e-10
WP_110897320.1|2599991_2600930_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_110897319.1|2601248_2602142_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	36.6	9.3e-56
WP_110897318.1|2602521_2603976_-	glucose-6-phosphate dehydrogenase	NA	M1UG55	Synechococcus_phage	33.3	2.2e-67
>prophage 199
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2641739	2645744	6393895		Mycobacterium_phage(100.0%)	1	NA	NA
WP_110899370.1|2641739_2645744_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.0	2.3e-45
>prophage 200
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2659262	2666635	6393895		Sinorhizobium_phage(33.33%)	7	NA	NA
WP_110899384.1|2659262_2659856_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	32.2	6.4e-05
WP_110899385.1|2660093_2660882_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_110899386.1|2661007_2661670_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_036673259.1|2661839_2662073_+	spore protein	NA	NA	NA	NA	NA
WP_110899387.1|2662266_2663850_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	32.3	7.0e-14
WP_110899404.1|2664222_2664621_-	DoxX family protein	NA	NA	NA	NA	NA
WP_110899388.1|2665084_2666635_-	glucose-6-phosphate dehydrogenase	NA	A0A1D8KIX9	Synechococcus_phage	36.8	3.5e-87
>prophage 201
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2693235	2693946	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110898342.1|2693235_2693946_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.4	3.0e-17
>prophage 202
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2700272	2700905	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110898351.1|2700272_2700905_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	34.3	2.7e-25
>prophage 203
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2708176	2709541	6393895	protease	Mycobacterium_phage(50.0%)	2	NA	NA
WP_110898359.1|2708176_2708968_-	alpha/beta fold hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	29.5	9.8e-17
WP_110898430.1|2709028_2709541_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	40.7	9.5e-13
>prophage 204
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2714582	2723776	6393895		Bacillus_phage(50.0%)	7	NA	NA
WP_110898364.1|2714582_2715356_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	28.7	1.2e-14
WP_110898365.1|2715352_2715805_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_110898366.1|2715823_2716162_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_110898367.1|2716249_2717926_-	response regulator	NA	A0A1V0SGX0	Hokovirus	35.2	5.4e-65
WP_110898368.1|2717942_2718815_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_110898369.1|2718884_2722610_-	response regulator	NA	A0A1V0SGX0	Hokovirus	38.8	2.9e-34
WP_110898370.1|2722606_2723776_-	fused response regulator/phosphatase	NA	W8CYM9	Bacillus_phage	30.6	1.6e-10
>prophage 205
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2728540	2730166	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110898377.1|2728540_2730166_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	4.2e-54
>prophage 206
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2737727	2738426	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110898383.1|2737727_2738426_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.5	1.2e-26
>prophage 207
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2754396	2758289	6393895		Cedratvirus(50.0%)	3	NA	NA
WP_110898434.1|2754396_2755275_-	alpha/beta fold hydrolase	NA	A0A1M7XV24	Cedratvirus	28.2	1.3e-06
WP_110898392.1|2755385_2756012_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_110898435.1|2756339_2758289_-	glycosyltransferase	NA	S5WBE2	Pseudomonas_phage	23.6	5.6e-13
>prophage 208
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2766034	2773128	6393895		Orpheovirus(25.0%)	6	NA	NA
WP_110898400.1|2766034_2766976_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	50.2	3.3e-72
WP_110898401.1|2767232_2767964_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_110898402.1|2768084_2768894_-	alpha/beta hydrolase	NA	A0A142K5G0	Mycobacterium_phage	28.8	2.6e-12
WP_110898403.1|2769171_2771121_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.6	1.1e-109
WP_110898404.1|2771260_2771455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898405.1|2771820_2773128_-	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.9	5.9e-19
>prophage 209
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2782239	2783586	6393895		Pandoravirus(100.0%)	1	NA	NA
WP_110898415.1|2782239_2783586_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	32.0	4.3e-65
>prophage 210
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2791925	2796739	6393895		Bacillus_phage(33.33%)	4	NA	NA
WP_110898420.1|2791925_2793533_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	9.6e-11
WP_110898438.1|2793525_2795316_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.3	3.4e-17
WP_090924948.1|2795543_2795966_-	OsmC family protein	NA	NA	NA	NA	NA
WP_110898421.1|2795992_2796739_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.1e-33
>prophage 211
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2810533	2812974	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110899456.1|2810533_2812297_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.9	1.2e-27
WP_110899457.1|2812293_2812974_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.1	4.0e-43
>prophage 212
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2817084	2818053	6393895		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_110899494.1|2817084_2818053_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.4	4.7e-21
>prophage 213
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2849107	2896384	6393895		Tupanvirus(42.86%)	9	NA	NA
WP_110899489.1|2849107_2850028_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.7	3.0e-09
WP_110899490.1|2850439_2850778_-	VOC family protein	NA	NA	NA	NA	NA
WP_174812171.1|2851088_2870162_-	non-ribosomal peptide synthase/polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	27.0	1.9e-182
WP_110899694.1|2870247_2871981_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	1.4e-52
WP_110899693.1|2871977_2873804_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	2.0e-49
WP_110899692.1|2873793_2877075_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.4	2.3e-88
WP_174812316.1|2877228_2892288_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.8	6.3e-88
WP_110899675.1|2892769_2894053_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_110899674.1|2894551_2896384_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	41.1	9.0e-114
>prophage 214
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2907130	2908717	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110899665.1|2907130_2908717_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	41.0	1.7e-76
>prophage 215
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2911727	2920887	6393895	capsid,integrase,head,protease	Paenibacillus_phage(62.5%)	13	2906772:2906816	2920983:2921027
2906772:2906816	attL	AAGCGGGTGATGGGAATCGAACCCACGCTATTAGCTTGGAAGGCT	NA	NA	NA	NA
WP_110899717.1|2911727_2912036_-	HNH endonuclease	NA	A0A2I7SC48	Paenibacillus_phage	63.4	2.8e-28
WP_110899716.1|2912414_2913422_-|capsid	phage major capsid protein	capsid	A6XMJ6	Bacillus_virus	41.2	5.2e-63
WP_110899715.1|2913421_2914048_-|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	60.8	1.8e-61
WP_110899714.1|2914232_2914865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110899713.1|2914891_2915503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146236236.1|2915503_2916247_-	hypothetical protein	NA	A0A2H4J3N3	uncultured_Caudovirales_phage	58.5	2.8e-21
WP_174812172.1|2916282_2917182_-	DUF4373 domain-containing protein	NA	R9TLQ3	Paenibacillus_phage	56.5	5.6e-61
WP_110899710.1|2917317_2917506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110899709.1|2917495_2917978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110899719.1|2918228_2918549_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110899708.1|2918613_2918838_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	61.2	1.8e-16
WP_110899718.1|2918941_2919523_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	35.5	1.1e-22
WP_110899707.1|2919681_2920887_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	37.2	6.8e-70
2920983:2921027	attR	AAGCGGGTGATGGGAATCGAACCCACGCTATTAGCTTGGAAGGCT	NA	NA	NA	NA
>prophage 216
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2933932	2935102	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110899297.1|2933932_2935102_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.6	1.2e-42
>prophage 217
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2954261	2966531	6393895		Tupanvirus(25.0%)	7	NA	NA
WP_110899278.1|2954261_2955452_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.6	2.4e-14
WP_110899277.1|2955547_2957626_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	3.7e-63
WP_007432586.1|2957675_2958146_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017692070.1|2958233_2958656_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_110899276.1|2958808_2959057_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_110899275.1|2959257_2962872_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.4	5.1e-60
WP_110899274.1|2962985_2966531_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.4	1.8e-49
>prophage 218
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2970103	2970637	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_024633599.1|2970103_2970637_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.8	5.2e-14
>prophage 219
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2973999	2975400	6393895	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_110899268.1|2973999_2975400_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	27.8	2.3e-45
>prophage 220
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2984748	2987211	6393895	protease	Cronobacter_phage(100.0%)	1	NA	NA
WP_110899258.1|2984748_2987211_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.9	2.7e-129
>prophage 221
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	2998726	3022779	6393895		Bacillus_phage(20.0%)	14	NA	NA
WP_110895460.1|2998726_3000739_-	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	33.0	7.3e-93
WP_110895461.1|3000857_3003230_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.4	5.0e-133
WP_110895463.1|3003859_3004555_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_110895465.1|3004770_3005646_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_110895467.1|3005802_3006684_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	2.3e-35
WP_110895469.1|3006680_3007706_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.1	2.2e-77
WP_110895471.1|3007779_3008325_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.9	3.4e-37
WP_110895870.1|3008539_3009418_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.5	1.8e-80
WP_110895473.1|3009551_3013160_-	DEAD/DEAH box helicase	NA	E5ESE1	Bathycoccus_sp._RCC1105_virus	28.4	1.7e-39
WP_110895475.1|3013247_3015761_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.7	1.5e-26
WP_110895476.1|3016044_3017940_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_110895871.1|3017982_3019152_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	26.9	7.7e-10
WP_110895478.1|3019415_3019628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895480.1|3019920_3022779_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.4	0.0e+00
>prophage 222
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3029306	3030236	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_167433632.1|3029306_3030236_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.0e-28
>prophage 223
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3033896	3038642	6393895		Moraxella_phage(33.33%)	4	NA	NA
WP_110895500.1|3033896_3035369_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.8	4.5e-23
WP_110895502.1|3035576_3036854_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	45.6	1.1e-20
WP_110895504.1|3037048_3037966_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_056693908.1|3037955_3038642_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.3	6.5e-25
>prophage 224
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3059267	3061663	6393895		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_110895524.1|3059267_3060233_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	27.6	4.7e-21
WP_110895525.1|3060409_3061663_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.1	4.4e-27
>prophage 225
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3067765	3069882	6393895		Streptococcus_phage(50.0%)	2	NA	NA
WP_110895531.1|3067765_3068674_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.5e-32
WP_110895532.1|3068768_3069882_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	5.4e-05
>prophage 226
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3074412	3074610	6393895		Lactococcus_phage(100.0%)	1	NA	NA
WP_024631599.1|3074412_3074610_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
>prophage 227
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3087870	3089880	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110895567.1|3087870_3089880_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	36.8	1.2e-55
>prophage 228
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3099909	3101645	6393895		Staphylococcus_phage(50.0%)	2	NA	NA
WP_110895579.1|3099909_3101112_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	71.6	1.9e-160
WP_110895581.1|3101366_3101645_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	39.5	9.4e-07
>prophage 229
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3119516	3121238	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110895600.1|3119516_3121238_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	47.6	4.4e-147
>prophage 230
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3125721	3128506	6393895		Clostridium_phage(50.0%)	3	NA	NA
WP_024632710.1|3125721_3126009_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	45.3	6.9e-13
WP_110895610.1|3126180_3126918_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_110895612.1|3127108_3128506_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	41.4	2.1e-38
>prophage 231
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3139365	3146676	6393895		Chrysochromulina_ericina_virus(33.33%)	7	NA	NA
WP_110895636.1|3139365_3140523_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.2	7.3e-21
WP_090922856.1|3140561_3141191_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_110895638.1|3141628_3142876_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	7.5e-96
WP_110895640.1|3143096_3143690_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_110895642.1|3144007_3144580_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_110895643.1|3144644_3145205_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_110895877.1|3145455_3146676_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.7	2.6e-53
>prophage 232
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3173571	3176832	6393895		Leptospira_phage(100.0%)	1	NA	NA
WP_110895687.1|3173571_3176832_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.8	3.6e-65
>prophage 233
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3186028	3191239	6393895		Klosneuvirus(50.0%)	5	NA	NA
WP_110895694.1|3186028_3187408_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	21.9	1.5e-09
WP_110895695.1|3187478_3188537_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110895882.1|3188659_3189523_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_110895696.1|3189603_3190416_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_110895697.1|3190396_3191239_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.2	6.5e-27
>prophage 234
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3195348	3196185	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110895700.1|3195348_3196185_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.7	5.5e-10
>prophage 235
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3202021	3203788	6393895	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_110895883.1|3202021_3203788_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.5	2.5e-177
>prophage 236
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3214182	3217657	6393895		Staphylococcus_phage(50.0%)	2	NA	NA
WP_110895884.1|3214182_3215412_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	27.7	5.0e-36
WP_110895713.1|3215569_3217657_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	26.9	1.5e-56
>prophage 237
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3222430	3224857	6393895		Fowlpox_virus(50.0%)	3	NA	NA
WP_110895717.1|3222430_3222910_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	36.7	4.7e-22
WP_110895885.1|3223051_3223870_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_110895718.1|3223975_3224857_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.5	2.5e-13
>prophage 238
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3243164	3250098	6393895		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	6	NA	NA
WP_110895727.1|3243164_3244712_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	1.5e-61
WP_110895728.1|3244938_3245412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895729.1|3245514_3245901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895730.1|3246259_3247711_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	52.7	1.9e-127
WP_146236124.1|3247846_3248032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110895731.1|3248427_3250098_-	AarF/ABC1/UbiB kinase family protein	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	32.6	1.2e-51
>prophage 239
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3275095	3287269	6393895		Tupanvirus(16.67%)	9	NA	NA
WP_110895751.1|3275095_3276547_-	catalase	NA	A0A2K9L572	Tupanvirus	52.3	1.1e-117
WP_110895752.1|3276900_3277713_-	winged-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110895753.1|3277688_3278084_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_110895754.1|3278367_3279489_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.3	1.2e-20
WP_110895755.1|3279607_3280546_-	aldo/keto reductase family protein	NA	NA	NA	NA	NA
WP_146236125.1|3280746_3282429_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.9	3.7e-13
WP_110895757.1|3282942_3284904_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	37.7	7.8e-124
WP_110895758.1|3284900_3285410_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2I7RVV0	Vibrio_phage	39.5	2.7e-28
WP_110895759.1|3285520_3287269_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.1	1.6e-11
>prophage 240
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3294561	3295933	6393895		Bacillus_phage(50.0%)	2	NA	NA
WP_110895765.1|3294561_3295281_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	65.0	3.5e-37
WP_110895766.1|3295384_3295933_-	helix-turn-helix transcriptional regulator	NA	B0ZSI5	Halomonas_phage	40.6	3.5e-05
>prophage 241
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3304985	3311182	6393895		Mycoplasma_phage(33.33%)	5	NA	NA
WP_110895775.1|3304985_3306095_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.5	9.2e-37
WP_110895776.1|3306366_3307728_+	transcriptional regulator	NA	A0A0K2CP77	Brevibacillus_phage	26.7	3.2e-39
WP_110895777.1|3308041_3309304_+	MFS transporter	NA	NA	NA	NA	NA
WP_110895778.1|3309319_3310582_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_110895779.1|3310702_3311182_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	54.9	3.6e-38
>prophage 242
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3321261	3322983	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110895787.1|3321261_3322983_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.9	2.2e-13
>prophage 243
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3328119	3336965	6393895		Bacillus_phage(75.0%)	7	NA	NA
WP_110895792.1|3328119_3329016_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.3	2.1e-15
WP_110895793.1|3329275_3329803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110895794.1|3330000_3331884_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.3	2.0e-60
WP_110895795.1|3331880_3333608_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.4e-52
WP_110895796.1|3333604_3334189_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110895797.1|3334526_3335966_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_167433626.1|3336212_3336965_+	ribonuclease Z	NA	A0A0A0RUN7	Bacillus_phage	31.3	4.6e-24
>prophage 244
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3345934	3348714	6393895	lysis,holin	Lactobacillus_phage(50.0%)	4	NA	NA
WP_110895806.1|3345934_3346828_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.1e-21
WP_110895807.1|3347032_3347404_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_110895808.1|3347400_3348081_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_110895809.1|3348207_3348714_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	42.7	6.7e-11
>prophage 245
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3357464	3358232	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110895815.1|3357464_3358232_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.7	6.8e-31
>prophage 246
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3367825	3371762	6393895		Bacillus_phage(50.0%)	2	NA	NA
WP_110895823.1|3367825_3369799_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	37.1	5.6e-21
WP_110895824.1|3369800_3371762_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4UU96	Bodo_saltans_virus	28.0	5.1e-14
>prophage 247
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3381594	3383736	6393895		Pseudomonas_phage(100.0%)	1	NA	NA
WP_110895831.1|3381594_3383736_-	glycosyltransferase	NA	S5WBE2	Pseudomonas_phage	25.4	1.1e-06
>prophage 248
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3389881	3394033	6393895	transposase	Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_110895837.1|3389881_3390676_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	1.1e-10
WP_110895838.1|3390677_3391598_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_110895839.1|3391723_3392773_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110895840.1|3393130_3394033_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	32.6	6.1e-23
>prophage 249
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3397218	3399443	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110895843.1|3397218_3398736_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-22
WP_110895844.1|3398732_3399443_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	4.8e-39
>prophage 250
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3407213	3409704	6393895		Bordetella_phage(50.0%)	2	NA	NA
WP_110895851.1|3407213_3408005_-	response regulator	NA	A0A291LAM3	Bordetella_phage	33.8	2.3e-05
WP_110895902.1|3407994_3409704_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.6	1.9e-17
>prophage 251
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3417674	3419723	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110895858.1|3417674_3419723_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.6	4.4e-53
>prophage 252
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3440433	3442219	6393895		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_110899075.1|3440433_3441234_-	nickel import ATP-binding protein NikE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	19.8	1.6e-06
WP_110899076.1|3441412_3442219_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	7.6e-17
>prophage 253
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3446038	3447466	6393895		Aureococcus_anophage(100.0%)	1	NA	NA
WP_110899079.1|3446038_3447466_-	hypothetical protein	NA	A0A076FFT1	Aureococcus_anophage	31.0	4.7e-09
>prophage 254
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3452570	3453356	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110899082.1|3452570_3453356_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	5.3e-23
>prophage 255
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3464163	3475800	6393895		Hokovirus(50.0%)	11	NA	NA
WP_110899093.1|3464163_3465165_-	NAD-dependent epimerase/dehydratase family protein	NA	K7QJG5	Escherichia_phage	29.3	6.8e-31
WP_110899129.1|3465327_3465849_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_110899094.1|3465961_3466621_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_110899095.1|3466617_3466896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110899130.1|3466908_3467409_-	HNH endonuclease	NA	Q58M63	Prochlorococcus_phage	36.5	5.8e-07
WP_174812186.1|3467819_3468086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174812187.1|3468122_3468272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110899097.1|3468481_3469657_-	acyltransferase	NA	NA	NA	NA	NA
WP_110899098.1|3470026_3471379_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.7	8.0e-51
WP_110899099.1|3471405_3472569_-	response regulator	NA	NA	NA	NA	NA
WP_110899100.1|3472680_3475800_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	6.3e-35
>prophage 256
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3481391	3482231	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110899131.1|3481391_3482231_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.1	2.6e-07
>prophage 257
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3496817	3497495	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110899111.1|3496817_3497495_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	4.9e-33
>prophage 258
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3517123	3517966	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110899137.1|3517123_3517966_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	49.3	8.4e-75
>prophage 259
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3527799	3529689	6393895		Staphylococcus_phage(50.0%)	2	NA	NA
WP_110897072.1|3527799_3528636_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.5e-12
WP_110897070.1|3528954_3529689_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	29.0	5.0e-23
>prophage 260
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3553789	3555247	6393895		Samba_virus(100.0%)	1	NA	NA
WP_110897049.1|3553789_3555247_-	carboxylesterase/lipase family protein	NA	A0A140E1D0	Samba_virus	27.6	2.8e-33
>prophage 261
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3567901	3572203	6393895		Acanthamoeba_polyphaga_mimivirus(50.0%)	5	NA	NA
WP_110897040.1|3567901_3568951_+	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.7	3.5e-22
WP_110897039.1|3569014_3569800_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_110897038.1|3569909_3570452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897037.1|3570626_3571325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897036.1|3571321_3572203_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.8	1.5e-10
>prophage 262
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3582140	3583586	6393895		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_110897029.1|3582140_3583586_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	34.6	1.8e-56
>prophage 263
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3600730	3605178	6393895		Bacillus_phage(33.33%)	4	NA	NA
WP_110897092.1|3600730_3601432_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.4e-35
WP_110897022.1|3601436_3603587_-	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	24.7	1.2e-11
WP_110897021.1|3603753_3604035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897020.1|3604269_3605178_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	23.6	4.4e-05
>prophage 264
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3609532	3617619	6393895		Planktothrix_phage(33.33%)	6	NA	NA
WP_110897015.1|3609532_3610255_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	2.1e-34
WP_110897091.1|3610251_3610908_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_110897014.1|3610925_3611723_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_110897013.1|3612035_3612929_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_110897012.1|3612900_3614217_-	GHKL domain-containing protein	NA	Q8QNA2	Ectocarpus_siliculosus_virus	30.1	1.5e-06
WP_110897011.1|3614454_3617619_-	response regulator	NA	Q9EYF3	Enterobacteria_phage	33.8	5.9e-20
>prophage 265
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3635731	3637443	6393895		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_110897088.1|3635731_3636589_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.8e-11
WP_110897000.1|3636642_3637443_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.3	2.2e-08
>prophage 266
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3644150	3646312	6393895		Vibrio_phage(50.0%)	3	NA	NA
WP_110896996.1|3644150_3644729_+	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	46.0	1.4e-36
WP_110896995.1|3644767_3645583_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_110896994.1|3645586_3646312_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.8	2.1e-05
>prophage 267
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3656929	3659862	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110896985.1|3656929_3658630_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.8	9.8e-22
WP_110896984.1|3659091_3659862_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	31.2	1.3e-13
>prophage 268
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3671979	3674346	6393895		Hokovirus(100.0%)	1	NA	NA
WP_174812196.1|3671979_3674346_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.9	1.8e-37
>prophage 269
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3698424	3699981	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110896960.1|3698424_3699981_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	9.3e-19
>prophage 270
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3704151	3707268	6393895		uncultured_virus(50.0%)	2	NA	NA
WP_110896956.1|3704151_3705237_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	47.0	3.8e-88
WP_110896955.1|3705528_3707268_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.7	4.2e-28
>prophage 271
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3712328	3713273	6393895		Hokovirus(100.0%)	1	NA	NA
WP_110896950.1|3712328_3713273_-	MBL fold metallo-hydrolase	NA	A0A1V0SGC6	Hokovirus	22.4	7.9e-05
>prophage 272
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3720595	3722416	6393895		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_146236165.1|3720595_3722416_-	N-6 DNA methylase	NA	M1HFU9	Paramecium_bursaria_Chlorella_virus	21.5	2.5e-07
>prophage 273
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3727320	3746066	6393895		Bacillus_phage(37.5%)	15	NA	NA
WP_110896939.1|3727320_3729429_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	30.0	2.3e-52
WP_146236164.1|3730177_3730423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090923561.1|3730478_3730646_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_110897083.1|3730990_3731203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896938.1|3731965_3733249_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.5	2.0e-11
WP_110896937.1|3733852_3734065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110896936.1|3734033_3734840_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	35.0	2.0e-41
WP_110897082.1|3734846_3735590_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_110896935.1|3736135_3737416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896934.1|3737399_3739250_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.0	3.5e-33
WP_110896933.1|3739249_3739972_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.6	3.1e-41
WP_110896932.1|3740240_3741773_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	39.8	4.2e-16
WP_110896931.1|3742207_3742864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110896930.1|3743049_3744336_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.5	2.3e-68
WP_110896929.1|3744704_3746066_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.4	2.4e-111
>prophage 274
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3761072	3773496	6393895	protease	Bacillus_virus(25.0%)	16	NA	NA
WP_167433715.1|3761072_3762008_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.8	1.1e-19
WP_110897080.1|3762009_3763008_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.7e-13
WP_110896918.1|3763760_3764360_-	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	55.2	4.8e-40
WP_090923587.1|3764607_3764877_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_110896917.1|3764934_3765417_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	61.5	2.7e-46
WP_024629534.1|3765469_3765763_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_110896916.1|3765978_3766173_+	YjzC family protein	NA	NA	NA	NA	NA
WP_110896915.1|3766824_3767034_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_110897079.1|3767023_3767911_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_174812198.1|3767982_3768246_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_110896914.1|3768371_3768977_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.5	1.6e-19
WP_110896913.1|3768951_3769452_-	DUF4446 family protein	NA	NA	NA	NA	NA
WP_110896912.1|3769593_3770748_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_110896911.1|3770885_3771734_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	32.3	4.9e-14
WP_110896910.1|3771726_3772488_-	ParA family protein	NA	Q8JL10	Natrialba_phage	28.2	5.7e-22
WP_110896909.1|3772677_3773496_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	34.1	2.5e-15
>prophage 275
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3787241	3796031	6393895		Bacillus_virus(66.67%)	7	NA	NA
WP_110896898.1|3787241_3788384_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	26.8	2.2e-25
WP_174812199.1|3788397_3788616_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_110896896.1|3788675_3789788_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_090923610.1|3789801_3790050_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_110896895.1|3790136_3792047_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	49.1	1.3e-160
WP_110896894.1|3792103_3793051_-	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_110896893.1|3793478_3796031_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.3	1.2e-116
>prophage 276
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3807394	3818428	6393895	tRNA	Streptococcus_phage(50.0%)	12	NA	NA
WP_110899243.1|3807394_3808042_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.3	2.1e-49
WP_047914178.1|3808104_3808434_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_110899241.1|3808789_3809233_+	YaaR family protein	NA	NA	NA	NA	NA
WP_110899240.1|3809242_3810214_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	38.5	4.1e-25
WP_110899239.1|3810331_3811132_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_110899238.1|3811160_3811529_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_110899237.1|3811605_3812385_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_110899236.1|3812385_3813270_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.1	1.6e-55
WP_017691383.1|3813513_3813768_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	69.2	5.0e-23
WP_110899235.1|3814095_3815373_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.8	7.6e-27
WP_110899234.1|3815713_3816481_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_110899253.1|3817246_3818428_+	DUF348 domain-containing protein	NA	A0A0A0RMW1	Bacillus_phage	46.5	3.2e-11
>prophage 277
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3824570	3827026	6393895		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_167433836.1|3824570_3825974_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2L2DII3	Acanthamoeba_polyphaga_mimivirus	30.6	4.6e-25
WP_017691370.1|3826072_3827026_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.0	2.5e-43
>prophage 278
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3833625	3834168	6393895		Paenibacillus_phage(100.0%)	1	NA	NA
WP_110899222.1|3833625_3834168_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 279
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3838307	3838580	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_090924617.1|3838307_3838580_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.0	3.5e-22
>prophage 280
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3847310	3849994	6393895		uncultured_virus(50.0%)	2	NA	NA
WP_110899212.1|3847310_3847850_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.3	1.4e-14
WP_110899211.1|3847951_3849994_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	49.9	2.5e-112
>prophage 281
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3856756	3862020	6393895		Pandoravirus(50.0%)	5	NA	NA
WP_110899204.1|3856756_3857695_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.6	1.3e-97
WP_110899203.1|3858040_3859633_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	41.1	1.1e-35
WP_110899202.1|3859683_3860262_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	6.4e-66
WP_110899201.1|3860263_3861157_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_110899200.1|3861153_3862020_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.4	4.8e-25
>prophage 282
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3865211	3866723	6393895	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_110899196.1|3865211_3866723_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.4	9.1e-96
>prophage 283
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3875613	3882133	6393895	tRNA	Klosneuvirus(33.33%)	5	NA	NA
WP_110899497.1|3875613_3877071_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.1	4.5e-100
WP_110899498.1|3877507_3878899_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.2	7.4e-36
WP_062329598.1|3879080_3879962_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_110899499.1|3879980_3880571_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_110899500.1|3880849_3882133_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.1	3.8e-95
>prophage 284
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3893606	3894077	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110899514.1|3893606_3894077_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	42.1	3.5e-14
>prophage 285
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3909010	3913323	6393895		Bacillus_phage(50.0%)	3	NA	NA
WP_110899525.1|3909010_3910165_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	42.6	3.2e-48
WP_110899526.1|3910656_3911226_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_110899527.1|3911718_3913323_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.2	6.2e-151
>prophage 286
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3920700	3922443	6393895		Bacteriophage(100.0%)	1	NA	NA
WP_110899533.1|3920700_3922443_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	35.2	3.9e-50
>prophage 287
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3932140	3933265	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110898810.1|3932140_3933265_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	34.6	4.8e-25
>prophage 288
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3945301	3946249	6393895		Hokovirus(100.0%)	1	NA	NA
WP_110898875.1|3945301_3946249_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.2	1.7e-44
>prophage 289
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3957846	3958806	6393895		Orpheovirus(100.0%)	1	NA	NA
WP_110898830.1|3957846_3958806_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.4	6.4e-71
>prophage 290
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3962320	3964252	6393895		Streptococcus_phage(100.0%)	2	NA	NA
WP_110898833.1|3962320_3963307_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.9	9.2e-57
WP_110898834.1|3963313_3964252_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.2	7.0e-54
>prophage 291
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3967406	3968003	6393895		Agrobacterium_phage(100.0%)	1	NA	NA
WP_090924795.1|3967406_3968003_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.5	7.5e-54
>prophage 292
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3974866	3984249	6393895		Streptococcus_phage(25.0%)	9	NA	NA
WP_110898842.1|3974866_3976153_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	73.7	2.3e-172
WP_110898843.1|3976338_3976572_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_110898844.1|3977150_3979955_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.4	2.9e-87
WP_110898845.1|3980293_3980776_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	55.2	2.2e-40
WP_146236219.1|3981126_3981306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110898846.1|3981876_3982074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898847.1|3982066_3982639_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_110898848.1|3982827_3983130_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110898877.1|3983619_3984249_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	1.4e-26
>prophage 293
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	3990478	3992098	6393895		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_110898852.1|3990478_3992098_+	response regulator	NA	B5LWA6	Feldmannia_species_virus	27.0	7.9e-05
>prophage 294
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4004720	4005572	6393895		Indivirus(100.0%)	1	NA	NA
WP_110898860.1|4004720_4005572_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	32.6	1.0e-27
>prophage 295
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4056971	4062538	6393895		Clostridium_phage(50.0%)	4	NA	NA
WP_110898969.1|4056971_4058177_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.7	1.7e-36
WP_110899003.1|4058481_4058559_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_110899004.1|4058656_4060330_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_110899005.1|4060432_4062538_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.5	1.2e-24
>prophage 296
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4065651	4069789	6393895		Ectocarpus_siliculosus_virus(66.67%)	4	NA	NA
WP_110899007.1|4065651_4067223_+	DUF4118 domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.0	7.7e-13
WP_110898971.1|4067223_4067922_+	response regulator	NA	W8CYM9	Bacillus_phage	30.9	1.9e-32
WP_110898972.1|4068026_4068416_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_167433818.1|4068532_4069789_-	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-14
>prophage 297
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4079122	4079941	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110898983.1|4079122_4079941_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	4.3e-15
>prophage 298
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4086386	4092280	6393895		Catovirus(50.0%)	4	NA	NA
WP_110898988.1|4086386_4087019_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.8	1.9e-34
WP_110898989.1|4087667_4088351_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_167433823.1|4088741_4089113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898991.1|4089247_4092280_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	28.0	1.2e-41
>prophage 299
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4114328	4116194	6393895		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_110899660.1|4114328_4116194_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	H8ZJ31	Ostreococcus_tauri_virus	22.3	6.5e-11
>prophage 300
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4123294	4125274	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110899654.1|4123294_4125274_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.9	2.9e-17
>prophage 301
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4130025	4131552	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110899648.1|4130025_4131552_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.6	1.9e-08
>prophage 302
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4136016	4136217	6393895		Lactococcus_phage(100.0%)	1	NA	NA
WP_024633772.1|4136016_4136217_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	2.9e-18
>prophage 303
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4140582	4141566	6393895		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_110899638.1|4140582_4141566_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	35.2	7.1e-25
>prophage 304
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4165604	4166738	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110899684.1|4165604_4166738_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-18
>prophage 305
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4172479	4179819	6393895		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_110899406.1|4172479_4173877_-	serine hydrolase	NA	A0A0B5A438	Mycobacterium_phage	27.2	4.1e-10
WP_110899407.1|4174133_4176107_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.6	3.7e-12
WP_110899408.1|4176356_4177619_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_110899409.1|4177818_4179819_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.9	1.1e-16
>prophage 306
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4224018	4224726	6393895		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_110899446.1|4224018_4224726_+	AAA family ATPase	NA	F2Y1V5	Organic_Lake_phycodnavirus	23.7	1.2e-05
>prophage 307
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4251292	4253830	6393895		Tupanvirus(50.0%)	2	NA	NA
WP_174812213.1|4251292_4252798_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.2	4.3e-37
WP_110898219.1|4252843_4253830_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	3.4e-11
>prophage 308
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4256870	4257482	6393895		Moumouvirus(100.0%)	1	NA	NA
WP_110898107.1|4256870_4257482_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	36.1	1.8e-18
>prophage 309
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4261116	4261665	6393895		Halovirus(100.0%)	1	NA	NA
WP_110898112.1|4261116_4261665_+	dCTP deaminase	NA	L7TI54	Halovirus	30.0	2.9e-07
>prophage 310
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4276155	4277778	6393895		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_174812321.1|4276155_4276992_-	transporter substrate-binding domain-containing protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	25.8	6.9e-13
WP_110898122.1|4277049_4277778_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-31
>prophage 311
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4281579	4282410	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_174812322.1|4281579_4282410_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	49.3	9.1e-74
>prophage 312
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4297673	4299173	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110898141.1|4297673_4299173_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.5e-18
>prophage 313
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4305614	4310917	6393895		uncultured_virus(50.0%)	4	NA	NA
WP_174812323.1|4305614_4308170_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.8	2.4e-125
WP_110898150.1|4308604_4309255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812217.1|4309421_4310309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898152.1|4310305_4310917_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	29.5	9.0e-10
>prophage 314
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4316262	4317132	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110898158.1|4316262_4317132_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.3e-30
>prophage 315
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4321028	4322354	6393895	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_110898164.1|4321028_4322354_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	37.2	5.8e-54
>prophage 316
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4335417	4343150	6393895		uncultured_Caudovirales_phage(25.0%)	6	NA	NA
WP_110898176.1|4335417_4337508_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	2.5e-19
WP_110898177.1|4337676_4338969_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	59.9	6.9e-137
WP_110898178.1|4339508_4340441_+	phosphate ABC transporter substrate-binding protein	NA	E3SLK5	Synechococcus_phage	30.1	4.5e-13
WP_174812324.1|4340583_4341492_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_110898180.1|4341488_4342382_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_110898181.1|4342394_4343150_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	7.4e-14
>prophage 317
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4348261	4350409	6393895		Cedratvirus(100.0%)	1	NA	NA
WP_174812219.1|4348261_4350409_+	collagen-like triple helix repeat-containing protein	NA	A0A2R8FDW1	Cedratvirus	43.5	1.2e-16
>prophage 318
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4357098	4365842	6393895		Staphylococcus_phage(33.33%)	7	NA	NA
WP_110898191.1|4357098_4358013_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.0e-45
WP_110898192.1|4358009_4358726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_110898193.1|4358727_4359459_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_110898194.1|4359749_4362458_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.4	7.4e-56
WP_110898195.1|4362653_4363607_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_110898196.1|4364124_4364862_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110898230.1|4364933_4365842_+	serine/threonine-protein kinase	NA	A0A2R8FDC8	Brazilian_cedratvirus	28.8	5.2e-06
>prophage 319
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4393326	4399668	6393895		uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_110899010.1|4393326_4394979_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.8	3.6e-13
WP_110899011.1|4395003_4396011_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	27.3	4.7e-24
WP_110899012.1|4396338_4397949_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_110899013.1|4398185_4399085_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.3	2.2e-41
WP_110899014.1|4399245_4399668_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	56.8	3.4e-32
>prophage 320
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4404647	4408139	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110899018.1|4404647_4405679_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	47.8	5.4e-92
WP_110899019.1|4405805_4408139_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	60.4	9.9e-251
>prophage 321
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4415763	4417173	6393895		Hokovirus(100.0%)	1	NA	NA
WP_110899025.1|4415763_4417173_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	36.8	8.3e-35
>prophage 322
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4433745	4437048	6393895		Rhodococcus_phage(100.0%)	1	NA	NA
WP_110899038.1|4433745_4437048_+	DEAD/DEAH box helicase	NA	D4P754	Rhodococcus_phage	30.3	2.4e-40
>prophage 323
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4467911	4468814	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110899072.1|4467911_4468814_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	7.2e-24
>prophage 324
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4480410	4481145	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110899603.1|4480410_4481145_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	55.6	2.8e-74
>prophage 325
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4489972	4492333	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110899612.1|4489972_4492333_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	1.7e-109
>prophage 326
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4506773	4514830	6393895		Staphylococcus_phage(66.67%)	7	NA	NA
WP_110899625.1|4506773_4507514_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.5	3.3e-14
WP_167433861.1|4507524_4508778_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_146236234.1|4509025_4509409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110899628.1|4510081_4511350_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.6	2.8e-29
WP_167433862.1|4511543_4513238_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_110899630.1|4513461_4513896_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_110899631.1|4514020_4514830_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.1	1.4e-50
>prophage 327
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4519503	4528821	6393895	tRNA	Bacillus_thuringiensis_phage(50.0%)	10	NA	NA
WP_110899138.1|4519503_4520115_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	65.0	4.2e-76
WP_090924581.1|4520532_4520958_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110899139.1|4521291_4521867_+	signal peptidase I	NA	NA	NA	NA	NA
WP_110899140.1|4522041_4523886_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.6	1.1e-15
WP_110899141.1|4523901_4524927_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_110899142.1|4525098_4525362_+	YneF family protein	NA	NA	NA	NA	NA
WP_110899143.1|4525418_4526012_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	52.5	2.3e-47
WP_110899144.1|4526129_4527002_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_090924575.1|4527073_4527298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110899145.1|4527528_4528821_-	DUF2935 domain-containing protein	NA	Q56AR7	Bacillus_thuringiensis_phage	47.0	3.1e-44
>prophage 328
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4536768	4540811	6393895		Streptococcus_phage(33.33%)	4	NA	NA
WP_110899151.1|4536768_4537719_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	25.9	2.2e-07
WP_110899152.1|4538063_4538762_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	1.9e-35
WP_110899153.1|4538754_4539861_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_110899154.1|4539941_4540811_+	M15 family metallopeptidase	NA	A0A0F7L850	uncultured_marine_virus	30.6	1.1e-05
>prophage 329
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4548180	4549182	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110899161.1|4548180_4549182_+	UV DNA damage repair endonuclease UvsE	NA	G3MAQ2	Bacillus_virus	31.2	5.4e-36
>prophage 330
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4553015	4554845	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110899165.1|4553015_4554845_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	4.9e-27
>prophage 331
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4564210	4565596	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110899192.1|4564210_4565596_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	38.4	1.4e-63
>prophage 332
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4569049	4570096	6393895		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_110899175.1|4569049_4570096_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.7	5.3e-18
>prophage 333
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4586163	4590859	6393895		Hokovirus(50.0%)	3	NA	NA
WP_110899188.1|4586163_4587702_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.0	9.1e-19
WP_110899189.1|4587898_4588756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110899190.1|4589482_4590859_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	2.8e-43
>prophage 334
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4600537	4619211	6393895		Mollivirus(20.0%)	17	NA	NA
WP_110897828.1|4600537_4602667_+	DNA topoisomerase III	NA	A0A1S5V180	Saudi_moumouvirus	23.2	3.8e-23
WP_167433760.1|4602747_4602852_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_167433761.1|4603389_4603527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897830.1|4603706_4603970_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_110897831.1|4604186_4604621_+	universal stress protein	NA	NA	NA	NA	NA
WP_110897944.1|4605169_4605655_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	8.1e-22
WP_110897832.1|4605651_4606857_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_110897833.1|4606853_4608152_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.7	1.6e-19
WP_110897834.1|4608483_4609356_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.5	1.0e-38
WP_110897836.1|4610437_4610683_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	39.0	1.7e-07
WP_110897837.1|4610687_4611377_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_110897838.1|4611354_4613598_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.3	6.8e-164
WP_110897839.1|4613582_4615061_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.4	5.5e-53
WP_110897840.1|4615073_4615517_+	immunity 26/phosphotriesterase HocA family protein	NA	NA	NA	NA	NA
WP_110897841.1|4615761_4616802_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	9.4e-68
WP_110897842.1|4616801_4617419_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	4.9e-24
WP_110897843.1|4617663_4619211_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.3	9.1e-75
>prophage 335
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4650994	4655248	6393895		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_110897864.1|4650994_4652635_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	41.6	4.0e-113
WP_110897865.1|4653515_4653758_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_110897866.1|4653754_4655248_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	1.3e-30
>prophage 336
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4662063	4665564	6393895		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_110897872.1|4662063_4663050_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.2	1.7e-13
WP_110897873.1|4663046_4663856_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_110897874.1|4663860_4664673_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_167433763.1|4664712_4665564_+	FkbM family methyltransferase	NA	G8DGX3	Emiliania_huxleyi_virus	26.0	8.9e-08
>prophage 337
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4677963	4681044	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110897886.1|4677963_4681044_+	response regulator	NA	Q9EYF3	Enterobacteria_phage	35.8	8.0e-22
>prophage 338
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4688200	4690145	6393895		uncultured_virus(50.0%)	3	NA	NA
WP_110897891.1|4688200_4689367_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	30.4	4.8e-44
WP_174812232.1|4689382_4689523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897892.1|4689590_4690145_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	32.5	3.3e-11
>prophage 339
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4694981	4710749	6393895		Bacillus_phage(60.0%)	10	NA	NA
WP_110897953.1|4694981_4696724_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	5.8e-38
WP_110897898.1|4696710_4698528_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.1	2.2e-40
WP_110897899.1|4698641_4700453_-	flagellar protein	NA	NA	NA	NA	NA
WP_110897900.1|4700650_4702186_-	carboxylesterase family protein	NA	A0A1S5V000	Saudi_moumouvirus	37.8	7.7e-34
WP_167433765.1|4702353_4703199_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110897902.1|4703315_4703519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897954.1|4703519_4704668_-	glycoside hydrolase family 27 protein	NA	A0A2P0VP48	Tetraselmis_virus	28.5	1.8e-35
WP_110897903.1|4705255_4706428_+	DUF4317 domain-containing protein	NA	NA	NA	NA	NA
WP_167433766.1|4706500_4707619_-	response regulator	NA	NA	NA	NA	NA
WP_110897905.1|4707590_4710749_-	response regulator	NA	W8CYF6	Bacillus_phage	25.0	1.2e-20
>prophage 340
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4729732	4731529	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_167433768.1|4729732_4731529_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.9	5.3e-18
>prophage 341
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4742218	4743985	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110897920.1|4742218_4743985_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.3	2.0e-46
>prophage 342
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4747067	4747970	6393895		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_110897923.1|4747067_4747970_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	51.9	6.4e-73
>prophage 343
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4756644	4761555	6393895		Pseudomonas_phage(50.0%)	3	NA	NA
WP_110897931.1|4756644_4758066_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	35.4	4.7e-62
WP_110897932.1|4758097_4759258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110897933.1|4759278_4761555_-	glycosyltransferase	NA	M1ICB9	Acanthocystis_turfacea_Chlorella_virus	28.2	1.1e-23
>prophage 344
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4767890	4769042	6393895		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_110897939.1|4767890_4769042_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.6	6.9e-11
>prophage 345
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4777503	4778780	6393895		Lactobacillus_virus(100.0%)	2	NA	NA
WP_110899565.1|4777503_4778127_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	32.4	3.2e-15
WP_110899564.1|4778123_4778780_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	30.5	7.6e-15
>prophage 346
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4789841	4795774	6393895		Planktothrix_phage(50.0%)	4	NA	NA
WP_110899557.1|4789841_4790660_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.4	2.1e-30
WP_110899556.1|4790649_4791318_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_110899569.1|4791460_4792297_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174812235.1|4792627_4795774_+	response regulator	NA	A0A1V0SGX0	Hokovirus	41.6	1.9e-47
>prophage 347
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4827386	4829141	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110898324.1|4827386_4829141_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.4	2.2e-08
>prophage 348
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4844423	4850213	6393895		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_110898311.1|4844423_4845437_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.9	1.9e-12
WP_110898310.1|4845433_4846477_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_110898309.1|4846490_4847315_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.7e-08
WP_110898334.1|4847638_4848664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898308.1|4848857_4850213_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.5	1.1e-20
>prophage 349
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4865060	4875583	6393895		Lactobacillus_phage(33.33%)	9	NA	NA
WP_110898300.1|4865060_4868198_+	DUF3427 domain-containing protein	NA	Q9T1H9	Lactobacillus_phage	28.2	9.9e-36
WP_110898299.1|4868228_4869035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898298.1|4869101_4869836_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_110898297.1|4869917_4870259_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110898296.1|4870399_4870921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898295.1|4871096_4872134_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	37.5	5.8e-09
WP_110898294.1|4872130_4872646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898293.1|4872834_4873161_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_110898292.1|4873144_4875583_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	32.4	5.3e-37
>prophage 350
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4894458	4912650	6393895		Bacillus_phage(40.0%)	9	NA	NA
WP_110898274.1|4894458_4896342_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	2.5e-42
WP_110898273.1|4896322_4898164_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	4.3e-55
WP_110898271.1|4899031_4900732_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	31.9	2.2e-05
WP_110898270.1|4901007_4901994_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110898269.1|4902165_4902963_+	phosphonate ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	1.5e-09
WP_110898268.1|4902959_4903826_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_110898267.1|4903822_4904635_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_110898266.1|4904870_4905494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812239.1|4905525_4912650_+	hypothetical protein	NA	A0A2D1GD28	Mycobacterium_phage	30.8	3.2e-05
>prophage 351
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4917640	4921861	6393895		Bacillus_phage(66.67%)	4	NA	NA
WP_110898261.1|4917640_4918354_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	1.3e-39
WP_110898260.1|4918350_4919817_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.5	3.4e-23
WP_110898259.1|4919813_4920971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898258.1|4921186_4921861_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	2.2e-33
>prophage 352
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4942671	4943427	6393895		Planktothrix_phage(100.0%)	1	NA	NA
WP_110898243.1|4942671_4943427_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.0e-31
>prophage 353
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4966789	4974909	6393895		Lactococcus_phage(33.33%)	6	NA	NA
WP_090917732.1|4966789_4966990_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.3	2.1e-21
WP_110897285.1|4967449_4969054_+	response regulator	NA	NA	NA	NA	NA
WP_110897284.1|4969050_4970877_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.8	4.0e-21
WP_167433738.1|4970860_4972045_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_110897314.1|4972236_4973310_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_110897282.1|4973385_4974909_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	35.2	2.6e-10
>prophage 354
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4982143	4986942	6393895		Bacillus_virus(66.67%)	5	NA	NA
WP_110897277.1|4982143_4983136_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	43.4	5.5e-57
WP_110897276.1|4983232_4983655_+	macro domain-containing protein	NA	G3MAH8	Bacillus_virus	43.4	6.8e-25
WP_110897312.1|4983846_4984803_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110897311.1|4984903_4985956_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_110897275.1|4985970_4986942_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.0	1.9e-14
>prophage 355
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	4996431	4997334	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110897268.1|4996431_4997334_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.9	7.2e-24
>prophage 356
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5000640	5001819	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110897264.1|5000640_5001819_-	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X9I5H2	Streptococcus_phage	34.1	3.6e-07
>prophage 357
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5006463	5007162	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110897259.1|5006463_5007162_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.9e-20
>prophage 358
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5011118	5011913	6393895		Pseudomonas_phage(100.0%)	1	NA	NA
WP_110897254.1|5011118_5011913_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.1	1.2e-46
>prophage 359
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5033271	5034195	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110897236.1|5033271_5034195_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	36.3	2.3e-49
>prophage 360
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5045752	5046415	6393895		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_110897227.1|5045752_5046415_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	44.1	6.1e-20
>prophage 361
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5056520	5058224	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110897304.1|5056520_5058224_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.5	8.6e-18
>prophage 362
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5061633	5064909	6393895		Erwinia_phage(100.0%)	1	NA	NA
WP_110897215.1|5061633_5064909_+	fibronectin type III domain-containing protein	NA	G0YQI6	Erwinia_phage	34.9	9.8e-103
>prophage 363
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5077465	5079208	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110897207.1|5077465_5079208_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	2.1e-43
>prophage 364
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5101649	5104225	6393895		Pneumococcus_phage(50.0%)	4	NA	NA
WP_110897191.1|5101649_5102141_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	62.3	2.4e-50
WP_110897190.1|5102257_5103052_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	44.6	7.4e-57
WP_110897189.1|5103044_5103536_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.0	2.1e-54
WP_110897301.1|5103532_5104225_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.1	4.6e-63
>prophage 365
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5109615	5151236	6393895	portal,tail,tRNA,plate	Bacillus_phage(28.0%)	40	NA	NA
WP_110897183.1|5109615_5111352_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_110897182.1|5111914_5113744_-	5'-nucleotidase C-terminal domain-containing protein	NA	A0A2P1CFS5	Microbacterium_phage	48.9	1.4e-05
WP_110897181.1|5113922_5114339_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	38.1	2.3e-17
WP_110897180.1|5114384_5114828_-	transcriptional regulator	NA	S6C481	Thermus_phage	41.7	5.9e-19
WP_110897300.1|5115475_5115958_+	transcriptional regulator	NA	A0A0C5AN03	Paenibacillus_phage	62.2	1.3e-43
WP_110897179.1|5116056_5117730_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_110897178.1|5117749_5118532_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_110897177.1|5118773_5119340_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_110897176.1|5119375_5119834_+	VOC family protein	NA	NA	NA	NA	NA
WP_110897175.1|5119906_5120566_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_110897174.1|5120759_5121710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897173.1|5122000_5123704_+	DUF4127 family protein	NA	NA	NA	NA	NA
WP_110897172.1|5124002_5125091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897171.1|5125234_5125435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897170.1|5125434_5126898_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0N7AEC6	Bacillus_phage	35.9	1.3e-75
WP_110897169.1|5127005_5127413_+|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	56.5	9.4e-40
WP_110897168.1|5127586_5128021_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	41.3	4.7e-21
WP_110897167.1|5128204_5129959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897299.1|5130015_5130645_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	46.9	5.2e-37
WP_110897166.1|5130641_5131631_+|portal	phage portal protein	portal	A0A0N6W8H4	Bacillus_phage	47.0	1.1e-78
WP_110897298.1|5131662_5132034_+	hypothetical protein	NA	A0A0N7ACD3	Bacillus_phage	33.6	2.1e-06
WP_110897165.1|5132026_5132482_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	42.1	7.6e-22
WP_110897164.1|5132486_5133626_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	35.8	6.5e-46
WP_110897163.1|5133627_5134224_+	YmfQ family protein	NA	A0A0A8WI80	Clostridium_phage	32.7	9.3e-20
WP_110897162.1|5134223_5135981_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_110897161.1|5135994_5136312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897160.1|5136425_5136845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897159.1|5137052_5137292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897158.1|5137291_5138608_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5MNC1	Brevibacillus_phage	50.7	6.4e-122
WP_017690162.1|5138609_5139068_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	65.6	1.4e-52
WP_110897157.1|5139297_5139720_+|portal	phage portal protein	portal	Q708L8	Streptococcus_phage	39.4	1.5e-16
WP_110897155.1|5139920_5141903_+	hypothetical protein	NA	S5MNW9	Brevibacillus_phage	31.5	1.7e-62
WP_110897154.1|5141903_5142602_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	49.6	1.1e-51
WP_110897153.1|5142615_5143626_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	52.3	1.7e-98
WP_174812246.1|5143632_5143890_+	DUF2577 family protein	NA	S6C459	Thermus_phage	48.2	5.1e-15
WP_110897152.1|5143886_5144300_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	38.9	2.6e-13
WP_110897151.1|5144292_5145351_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	47.3	1.4e-82
WP_110897150.1|5145347_5145893_+	DUF2313 domain-containing protein	NA	A0A0A7RUW8	Clostridium_phage	30.7	2.7e-18
WP_110897149.1|5145892_5149174_+	hypothetical protein	NA	A0A0A0RMM9	Bacillus_phage	31.8	5.9e-23
WP_110897148.1|5150255_5151236_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	51.7	8.9e-60
>prophage 366
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5156938	5158822	6393895		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_110897146.1|5156938_5158822_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	1.8e-93
>prophage 367
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5162209	5168154	6393895		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_110897143.1|5162209_5163922_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.7	1.3e-10
WP_110897142.1|5164213_5165248_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_110897141.1|5165407_5166364_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	24.7	3.8e-15
WP_110897140.1|5166563_5167166_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_110897139.1|5167296_5168154_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	48.2	2.8e-17
>prophage 368
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5178920	5179289	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110897135.1|5178920_5179289_-	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	43.2	7.5e-12
>prophage 369
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5182682	5185284	6393895		Bacillus_phage(50.0%)	3	NA	NA
WP_110897293.1|5182682_5183591_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.2	6.1e-79
WP_110897292.1|5183626_5184256_+	sugar transferase	NA	NA	NA	NA	NA
WP_110897130.1|5184288_5185284_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	42.6	4.6e-64
>prophage 370
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5193909	5200320	6393895		Hokovirus(33.33%)	6	NA	NA
WP_110897122.1|5193909_5195298_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	28.0	4.1e-42
WP_110897121.1|5195294_5196626_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.0	3.4e-94
WP_110897120.1|5196715_5197633_+	LCP family protein	NA	NA	NA	NA	NA
WP_167433725.1|5197667_5198216_+	VanZ family protein	NA	NA	NA	NA	NA
WP_110897118.1|5198321_5198837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897116.1|5199408_5200320_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.9	2.9e-36
>prophage 371
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5211546	5223235	6393895	tRNA	Mycobacterium_phage(25.0%)	10	NA	NA
WP_110897107.1|5211546_5212458_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	37.8	2.9e-41
WP_110897291.1|5212714_5212909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110897290.1|5212913_5213090_+	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_110897106.1|5213394_5213880_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_110897289.1|5213930_5214782_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_110897288.1|5214814_5215321_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_110897105.1|5215317_5216376_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	38.9	3.9e-61
WP_110897104.1|5217463_5219020_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.0	2.1e-10
WP_174812248.1|5219226_5220660_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_110897102.1|5221279_5223235_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	2.2e-57
>prophage 372
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5226992	5230884	6393895	transposase	uncultured_virus(66.67%)	3	NA	NA
WP_110897098.1|5226992_5227274_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	50.0	1.4e-18
WP_090918203.1|5227348_5228980_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.7	1.5e-157
WP_174812090.1|5229927_5230884_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	53.6	2.7e-93
>prophage 373
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5234469	5237610	6393895		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_110899596.1|5234469_5237610_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	37.9	5.7e-185
>prophage 374
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5249295	5250525	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110899585.1|5249295_5250525_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	3.4e-32
>prophage 375
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5255698	5256601	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_146236233.1|5255698_5256601_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	1.0e-30
>prophage 376
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5260449	5260677	6393895		Clostridioides_phage(100.0%)	1	NA	NA
WP_110899602.1|5260449_5260677_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	40.0	4.2e-05
>prophage 377
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5264481	5264832	6393895		Lactobacillus_phage(100.0%)	1	NA	NA
WP_024630714.1|5264481_5264832_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	39.5	3.4e-14
>prophage 378
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5274658	5275435	6393895		Escherichia_phage(100.0%)	1	NA	NA
WP_110898630.1|5274658_5275435_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	3.3e-17
>prophage 379
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5280767	5281244	6393895		Molluscum_contagiosum_virus(100.0%)	1	NA	NA
WP_110898637.1|5280767_5281244_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	30.4	6.5e-08
>prophage 380
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5301504	5302611	6393895		Indivirus(100.0%)	1	NA	NA
WP_110898655.1|5301504_5302611_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	29.8	7.7e-28
>prophage 381
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5308775	5309408	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110898660.1|5308775_5309408_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.3	4.0e-37
>prophage 382
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5312458	5313523	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110898664.1|5312458_5313523_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	2.4e-26
>prophage 383
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5317371	5319568	6393895		Agrobacterium_phage(50.0%)	3	NA	NA
WP_167433804.1|5317371_5318028_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	50.5	4.0e-48
WP_110898667.1|5318321_5318696_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110898668.1|5318701_5319568_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	1.8e-24
>prophage 384
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5334858	5335641	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110898726.1|5334858_5335641_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.4	4.8e-16
>prophage 385
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5340096	5341797	6393895		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_110898682.1|5340096_5341797_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	1.3e-10
>prophage 386
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5350173	5364679	6393895	tRNA	Bacillus_phage(50.0%)	13	NA	NA
WP_110898690.1|5350173_5352162_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	42.1	1.9e-141
WP_110898691.1|5352698_5354453_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_110898692.1|5354449_5355211_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	5.9e-27
WP_110898693.1|5355427_5356486_+	M23 family metallopeptidase	NA	A0A1W6JQH9	Corynebacterium_phage	41.1	2.9e-08
WP_110898694.1|5356654_5357158_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_110898695.1|5357381_5357873_-	DinB family protein	NA	NA	NA	NA	NA
WP_110898696.1|5358131_5358551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110898697.1|5358547_5359837_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.7	1.9e-65
WP_110898698.1|5359984_5360944_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_110898699.1|5361179_5361638_+	DinB family protein	NA	NA	NA	NA	NA
WP_167433802.1|5361774_5362731_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_110898701.1|5362789_5363494_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	3.4e-37
WP_110898702.1|5363542_5364679_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	8.5e-30
>prophage 387
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5372284	5372824	6393895		Pterostylis_sanguinea_virus(100.0%)	1	NA	NA
WP_110898730.1|5372284_5372824_-	NUDIX domain-containing protein	NA	A0A288R5Z2	Pterostylis_sanguinea_virus	42.0	4.5e-05
>prophage 388
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5379372	5381253	6393895		Hokovirus(100.0%)	1	NA	NA
WP_110898715.1|5379372_5381253_+	DNA helicase RecQ	NA	A0A1V0SGM9	Hokovirus	33.3	4.6e-73
>prophage 389
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5386574	5387441	6393895	integrase	Leptospira_phage(100.0%)	1	5384459:5384472	5390758:5390771
5384459:5384472	attL	GGATGAACCGAATT	NA	NA	NA	NA
WP_110899738.1|5386574_5387441_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	36.0	2.1e-41
WP_110899738.1|5386574_5387441_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	36.0	2.1e-41
5390758:5390771	attR	GGATGAACCGAATT	NA	NA	NA	NA
>prophage 390
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5408810	5410283	6393895		Catovirus(100.0%)	1	NA	NA
WP_110897801.1|5408810_5410283_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	38.4	6.9e-16
>prophage 391
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5413336	5414134	6393895		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_110897796.1|5413336_5414134_+	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	30.8	1.9e-15
>prophage 392
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5446044	5448509	6393895		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_110897762.1|5446044_5447532_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.8	1.4e-08
WP_110897761.1|5447564_5448509_+	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	28.0	5.3e-17
>prophage 393
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5464651	5468679	6393895		Bacillus_phage(66.67%)	4	NA	NA
WP_110897746.1|5464651_5465329_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	45.7	1.4e-56
WP_110897745.1|5465325_5466702_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	41.1	7.1e-47
WP_110897744.1|5466769_5468005_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_110897743.1|5468001_5468679_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	3.0e-38
>prophage 394
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5487373	5487829	6393895		Paenibacillus_phage(100.0%)	1	NA	NA
WP_110897717.1|5487373_5487829_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	49.3	1.6e-35
>prophage 395
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5495802	5496345	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110897707.1|5495802_5496345_+	acetyltransferase	NA	A0A0N9SKF6	Staphylococcus_phage	44.2	1.3e-39
>prophage 396
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5500693	5501914	6393895		Cronobacter_phage(100.0%)	1	NA	NA
WP_110897699.1|5500693_5501914_+	RtcB family protein	NA	K4F7X0	Cronobacter_phage	30.8	5.2e-33
>prophage 397
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5539133	5543530	6393895		uncultured_Mediterranean_phage(50.0%)	6	NA	NA
WP_110897677.1|5539133_5540063_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.1	1.0e-33
WP_110897676.1|5540279_5541068_+	DUF3891 family protein	NA	NA	NA	NA	NA
WP_110897815.1|5541310_5541817_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_110897675.1|5541846_5542215_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_110897674.1|5542332_5542767_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110897673.1|5543044_5543530_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	46.6	1.3e-32
>prophage 398
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5548659	5552316	6393895		Tanapox_virus(50.0%)	4	NA	NA
WP_110897670.1|5548659_5549634_-	alpha/beta fold hydrolase	NA	A7XCB7	Tanapox_virus	37.1	2.7e-08
WP_110897669.1|5549730_5550708_-	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_110897668.1|5550777_5551362_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_110897667.1|5551362_5552316_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	66.7	1.5e-48
>prophage 399
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5564272	5568772	6393895		Agrobacterium_phage(50.0%)	5	NA	NA
WP_110897658.1|5564272_5564767_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.6	8.8e-16
WP_062320217.1|5564791_5564992_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_017689664.1|5565070_5565430_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_110897657.1|5565996_5567037_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110897656.1|5567233_5568772_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	4.1e-11
>prophage 400
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5572412	5577620	6393895		Micromonas_sp._RCC1109_virus(100.0%)	4	NA	NA
WP_110897651.1|5572412_5574164_+	biosynthetic-type acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.9	1.1e-63
WP_110897650.1|5574160_5574643_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_090922211.1|5574970_5575963_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_110897649.1|5576078_5577620_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	33.9	8.3e-12
>prophage 401
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5589366	5595591	6393895	tRNA	Tupanvirus(66.67%)	3	NA	NA
WP_110893994.1|5589366_5591493_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	26.5	1.6e-05
WP_110893992.1|5592233_5594129_+	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	30.1	3.2e-50
WP_110893990.1|5594556_5595591_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.3	5.9e-30
>prophage 402
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5602346	5604713	6393895		Lactobacillus_phage(100.0%)	1	NA	NA
WP_110893980.1|5602346_5604713_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	33.0	2.4e-10
>prophage 403
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5615143	5616648	6393895		Streptococcus_phage(50.0%)	2	NA	NA
WP_110893956.1|5615143_5615509_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	47.6	2.0e-20
WP_110893954.1|5615754_5616648_+	5'-3' exonuclease	NA	A0A2P1JXG8	Rhodococcus_phage	28.6	5.1e-22
>prophage 404
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5625890	5627027	6393895		Mamastrovirus(100.0%)	1	NA	NA
WP_110893937.1|5625890_5627027_+	dehypoxanthine futalosine cyclase	NA	A9ZMK9	Mamastrovirus	47.9	1.6e-23
>prophage 405
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5634542	5637464	6393895	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_110893922.1|5634542_5636480_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.8	9.8e-119
WP_167433581.1|5636816_5637464_+	murein transglycosylase	NA	A0A127AW72	Bacillus_phage	40.2	9.8e-15
>prophage 406
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5640913	5652536	6393895	tRNA	Bacillus_phage(28.57%)	10	NA	NA
WP_110893914.1|5640913_5642557_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	3.0e-20
WP_110893912.1|5642730_5643420_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.1	1.2e-39
WP_110893910.1|5643421_5644882_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	1.3e-27
WP_110893908.1|5644948_5645902_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_110893906.1|5646208_5647273_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	27.8	5.7e-12
WP_110893904.1|5647687_5649112_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_174812263.1|5649329_5650439_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	7.9e-89
WP_110893900.1|5650607_5651072_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_090919903.1|5651241_5651487_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	44.3	4.1e-14
WP_110893898.1|5651618_5652536_-	serine hydrolase	NA	A0A0B5A4V6	Mycobacterium_phage	26.7	5.3e-06
>prophage 407
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5661106	5662171	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110893885.1|5661106_5662171_-	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	27.0	1.1e-07
>prophage 408
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5667212	5670347	6393895		Thermus_phage(50.0%)	2	NA	NA
WP_110893874.1|5667212_5669108_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	35.5	4.2e-98
WP_110893873.1|5669345_5670347_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.3e-07
>prophage 409
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5688980	5690810	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110893846.1|5688980_5690810_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	4.0e-29
>prophage 410
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5699563	5708329	6393895		Clostridium_phage(20.0%)	10	NA	NA
WP_110893825.1|5699563_5700025_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.6	1.3e-37
WP_110893823.1|5700090_5700669_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_110893821.1|5701105_5701888_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.3	4.1e-07
WP_110893819.1|5701912_5703217_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_110893816.1|5703213_5704434_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.1	4.3e-112
WP_110893814.1|5704423_5704855_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	33.1	4.0e-12
WP_110893812.1|5704875_5706273_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_110893810.1|5706411_5706981_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_110893808.1|5707105_5707447_+	Darcynin 2	NA	NA	NA	NA	NA
WP_110893806.1|5707594_5708329_+	M23 family metallopeptidase	NA	A0A1D6X855	Bacillus_phage	33.2	1.6e-16
>prophage 411
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5725471	5727217	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110893766.1|5725471_5727217_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	5.7e-17
>prophage 412
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5748423	5748915	6393895		Bacillus_virus(100.0%)	1	NA	NA
WP_110893739.1|5748423_5748915_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	4.8e-38
>prophage 413
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5755882	5822998	6393895	integrase,holin,portal,capsid,tail,plate,terminase,head,protease	Paenibacillus_phage(27.78%)	116	5755796:5755811	5826299:5826314
5755796:5755811	attL	TTATCGCACCGATAAA	NA	NA	NA	NA
WP_110893729.1|5755882_5757070_-|integrase	site-specific integrase	integrase	A0A0N9SGH8	Paenibacillus_phage	38.0	3.2e-64
WP_167433577.1|5757088_5757442_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	45.0	6.7e-10
WP_110893725.1|5757597_5757831_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_146236094.1|5757876_5758056_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110893721.1|5758039_5758759_+	ORF6C domain-containing protein	NA	S5MP04	Brevibacillus_phage	45.1	2.2e-23
WP_167433576.1|5759028_5759187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893717.1|5759183_5759606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893715.1|5759621_5759996_+	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	55.3	5.8e-28
WP_110893713.1|5759988_5760942_+	DnaD domain protein	NA	A0A0K2CZ53	Paenibacillus_phage	48.8	1.8e-57
WP_110893711.1|5760962_5761463_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	55.2	3.8e-43
WP_167433575.1|5761492_5761858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433574.1|5761854_5762253_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_110893707.1|5762258_5762471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110894072.1|5762626_5762848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893703.1|5763073_5763316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893701.1|5763316_5763682_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	58.0	1.1e-31
WP_110893699.1|5763775_5764171_+	hypothetical protein	NA	R9TLR7	Paenibacillus_phage	77.3	6.1e-52
WP_110893697.1|5764182_5764422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893695.1|5764418_5764649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893693.1|5764645_5764849_+	hypothetical protein	NA	R9TQL0	Paenibacillus_phage	49.0	1.2e-06
WP_110893691.1|5764863_5765265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893689.1|5765644_5766190_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	56.7	3.1e-54
WP_146236093.1|5766554_5766908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893685.1|5766911_5767268_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	53.2	1.8e-31
WP_110893683.1|5767373_5767961_+|terminase	P27 family phage terminase small subunit	terminase	A0A2I7SBY3	Paenibacillus_phage	53.3	1.6e-48
WP_110894070.1|5767953_5769717_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	57.1	5.5e-185
WP_146236092.1|5769807_5771085_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.9	4.2e-86
WP_167433573.1|5771014_5771635_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXB1	Streptomyces_phage	39.5	1.9e-23
WP_167433572.1|5771649_5772879_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	23.3	7.1e-14
WP_110893674.1|5772932_5773184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110894068.1|5773158_5773701_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_110893672.1|5773710_5774178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893670.1|5774180_5774528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893668.1|5774514_5775003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433571.1|5774974_5776000_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	46.8	8.4e-77
WP_076326872.1|5776016_5776412_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	50.8	4.0e-27
WP_110893664.1|5776444_5776753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893660.1|5776742_5776928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893658.1|5776973_5779346_+|tail	phage tail tape measure protein	tail	F6K8S0	Clostridium_phage	44.2	2.6e-41
WP_110893656.1|5779345_5779900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893655.1|5779909_5780233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893653.1|5780222_5781014_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	41.6	5.3e-55
WP_110893651.1|5781010_5781406_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	35.6	6.4e-09
WP_110893649.1|5781387_5781753_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_110893647.1|5781742_5782930_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	45.4	5.5e-88
WP_110893645.1|5782913_5783555_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	49.0	8.1e-54
WP_110893643.1|5783570_5783948_+|tail	tail fiber protein	tail	A8ATI4	Listeria_phage	52.8	4.7e-09
WP_110893641.1|5783947_5784553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893639.1|5784556_5785006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433570.1|5785061_5785199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893633.1|5785762_5786230_+|holin	phage holin family protein	holin	R9TMD4	Paenibacillus_phage	64.0	8.8e-42
WP_110893630.1|5786255_5786984_+	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	50.8	1.1e-41
WP_110893628.1|5787265_5787766_-	hypothetical protein	NA	D2XR34	Bacillus_phage	44.9	9.6e-10
WP_110893626.1|5787928_5788261_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_174812266.1|5788348_5788975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433569.1|5788971_5789511_+	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_110893619.1|5789643_5790015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433568.1|5790245_5790455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110893729.1|5791153_5792341_-|integrase	site-specific integrase	integrase	A0A0N9SGH8	Paenibacillus_phage	38.0	3.2e-64
WP_167433577.1|5792359_5792713_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	45.0	6.7e-10
WP_110893725.1|5792868_5793102_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_146236094.1|5793147_5793327_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110893721.1|5793310_5794030_+	ORF6C domain-containing protein	NA	S5MP04	Brevibacillus_phage	45.1	2.2e-23
WP_167433576.1|5794299_5794458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893717.1|5794454_5794877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893715.1|5794892_5795267_+	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	55.3	5.8e-28
WP_110893713.1|5795259_5796213_+	DnaD domain protein	NA	A0A0K2CZ53	Paenibacillus_phage	48.8	1.8e-57
WP_110893711.1|5796233_5796734_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	55.2	3.8e-43
WP_167433575.1|5796763_5797129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433574.1|5797125_5797524_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_110893707.1|5797529_5797742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110894072.1|5797897_5798119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893703.1|5798344_5798587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893701.1|5798587_5798953_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	58.0	1.1e-31
WP_110893699.1|5799046_5799442_+	hypothetical protein	NA	R9TLR7	Paenibacillus_phage	77.3	6.1e-52
WP_110893697.1|5799453_5799693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893695.1|5799689_5799920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893693.1|5799916_5800120_+	hypothetical protein	NA	R9TQL0	Paenibacillus_phage	49.0	1.2e-06
WP_110893691.1|5800134_5800536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893689.1|5800915_5801461_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	56.7	3.1e-54
WP_146236093.1|5801825_5802179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893685.1|5802182_5802539_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	53.2	1.8e-31
WP_174812267.1|5805068_5805440_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.5	7.3e-23
WP_174812337.1|5805554_5805878_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	52.4	1.0e-20
WP_174812268.1|5805874_5806141_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	47.5	3.4e-14
WP_174812269.1|5806172_5806340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812270.1|5806370_5806727_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	44.6	1.2e-19
WP_174812271.1|5807186_5807690_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_174812338.1|5807578_5808100_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_174812272.1|5808187_5808421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110894068.1|5808395_5808938_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_110893672.1|5808947_5809415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812273.1|5809417_5809624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812274.1|5809602_5809764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812275.1|5809973_5810237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433571.1|5810208_5811234_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	46.8	8.4e-77
WP_076326872.1|5811250_5811646_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	50.8	4.0e-27
WP_110893664.1|5811678_5811987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893660.1|5811976_5812162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812276.1|5812207_5813470_+|tail	phage tail tape measure protein	tail	F6K8S0	Clostridium_phage	44.2	1.4e-41
WP_174812277.1|5813520_5813769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174812278.1|5813765_5814578_+	hypothetical protein	NA	D4HTW4	Vibrio_phage	34.8	9.4e-07
WP_110893656.1|5814577_5815132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893655.1|5815141_5815465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893653.1|5815454_5816246_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	41.6	5.3e-55
WP_110893651.1|5816242_5816638_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	35.6	6.4e-09
WP_110893649.1|5816619_5816985_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_110893647.1|5816974_5818162_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	45.4	5.5e-88
WP_110893645.1|5818145_5818787_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	49.0	8.1e-54
WP_110893643.1|5818802_5819180_+|tail	tail fiber protein	tail	A8ATI4	Listeria_phage	52.8	4.7e-09
WP_110893641.1|5819179_5819785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893639.1|5819788_5820238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167433570.1|5820293_5820431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893633.1|5820994_5821462_+|holin	phage holin family protein	holin	R9TMD4	Paenibacillus_phage	64.0	8.8e-42
WP_110893630.1|5821487_5822216_+	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	50.8	1.1e-41
WP_110893628.1|5822497_5822998_-	hypothetical protein	NA	D2XR34	Bacillus_phage	44.9	9.6e-10
5826299:5826314	attR	TTATCGCACCGATAAA	NA	NA	NA	NA
>prophage 414
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5830742	5847246	6393895		Bacillus_phage(62.5%)	15	NA	NA
WP_110893606.1|5830742_5832302_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	1.7e-17
WP_110893604.1|5832670_5833039_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_110893602.1|5833039_5834869_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	37.2	4.5e-41
WP_110893600.1|5835073_5835802_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	3.0e-36
WP_110893598.1|5835950_5837315_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_110893596.1|5837535_5838291_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	3.9e-15
WP_110893594.1|5838355_5839015_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_110893592.1|5839301_5841956_+	DNA polymerase I	NA	A0A060AM05	Listeria_phage	27.2	8.0e-47
WP_110893590.1|5842016_5842868_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.7	5.8e-23
WP_174812279.1|5843003_5843825_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_110893588.1|5843857_5844454_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_110893587.1|5844450_5845014_+	lytic transglycosylase domain-containing protein	NA	A0A097PAR3	Delftia_phage	34.2	7.7e-08
WP_110893586.1|5845110_5845329_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_110893585.1|5845444_5845912_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_110893584.1|5846280_5847246_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.7	4.4e-11
>prophage 415
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5854496	5857548	6393895		Lactobacillus_phage(100.0%)	2	NA	NA
WP_110893573.1|5854496_5855111_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.9	4.9e-56
WP_110893570.1|5855124_5857548_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	63.0	1.5e-294
>prophage 416
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5863526	5864885	6393895		Pandoravirus(100.0%)	1	NA	NA
WP_110893557.1|5863526_5864885_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	33.6	1.2e-33
>prophage 417
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5872165	5872912	6393895		Escherichia_phage(100.0%)	1	NA	NA
WP_110893539.1|5872165_5872912_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.0	8.3e-26
>prophage 418
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5878741	5885064	6393895	holin	uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_110893529.1|5878741_5879650_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	29.5	8.9e-06
WP_110893527.1|5879753_5880488_+	fused MFS/spermidine synthase	NA	NA	NA	NA	NA
WP_110893525.1|5880653_5882291_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.5	2.9e-15
WP_110893523.1|5882987_5883185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110893521.1|5883430_5884018_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110893519.1|5884488_5885064_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	45.2	2.3e-23
>prophage 419
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5891211	5892042	6393895		Staphylococcus_phage(100.0%)	1	NA	NA
WP_110893507.1|5891211_5892042_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	49.1	1.9e-71
>prophage 420
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5897147	5897810	6393895		Mycobacterium_phage(100.0%)	1	NA	NA
WP_174812283.1|5897147_5897810_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	35.3	3.1e-24
>prophage 421
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5907455	5913119	6393895		Acanthocystis_turfacea_Chlorella_virus(50.0%)	6	NA	NA
WP_110893485.1|5907455_5908208_+	glycerophosphodiester phosphodiesterase	NA	M1HJV8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.8e-26
WP_110893483.1|5908268_5908901_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_110893481.1|5909043_5909466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110893480.1|5909694_5910504_+	DUF92 domain-containing protein	NA	NA	NA	NA	NA
WP_110893478.1|5910518_5911097_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110893476.1|5911175_5913119_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.3	5.5e-45
>prophage 422
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5917684	5917882	6393895		Lactococcus_phage(100.0%)	1	NA	NA
WP_095288023.1|5917684_5917882_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	66.1	1.7e-18
>prophage 423
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5924959	5927666	6393895		Streptococcus_phage(50.0%)	2	NA	NA
WP_110893458.1|5924959_5925781_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.7	3.7e-27
WP_110893456.1|5926085_5927666_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.5	7.8e-66
>prophage 424
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5933438	5934839	6393895		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_110893444.1|5933438_5934839_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	35.7	1.4e-61
>prophage 425
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5940187	5941886	6393895		Bacillus_phage(100.0%)	2	NA	NA
WP_110893434.1|5940187_5941525_+	DNA polymerase IV	NA	O64031	Bacillus_phage	33.1	2.8e-40
WP_110893432.1|5941643_5941886_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	50.6	2.4e-14
>prophage 426
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5957520	5957985	6393895		Lactobacillus_phage(100.0%)	1	NA	NA
WP_110893398.1|5957520_5957985_-	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	28.4	4.6e-06
>prophage 427
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5966363	5967299	6393895		Moumouvirus(100.0%)	1	NA	NA
WP_110893385.1|5966363_5967299_+	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	31.5	4.4e-24
>prophage 428
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5972780	5981053	6393895		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_110893377.1|5972780_5974553_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	29.0	1.8e-55
WP_110893375.1|5974898_5977667_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A0K2CP92	Brevibacillus_phage	46.9	7.1e-171
WP_110893373.1|5977928_5978489_+	flavin reductase	NA	NA	NA	NA	NA
WP_110893371.1|5978962_5981053_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.8	1.3e-39
>prophage 429
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	5984590	5986411	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110893363.1|5984590_5986411_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.3	2.0e-17
>prophage 430
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6019144	6021506	6393895		Pandoravirus(50.0%)	3	NA	NA
WP_110893321.1|6019144_6019837_+	HD domain-containing protein	NA	S4W232	Pandoravirus	30.7	2.2e-12
WP_110893320.1|6019953_6020550_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110893318.1|6020744_6021506_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.6e-19
>prophage 431
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6038662	6042364	6393895		Tupanvirus(100.0%)	1	NA	NA
WP_110893296.1|6038662_6042364_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	8.5e-63
>prophage 432
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6047234	6049001	6393895		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_110893289.1|6047234_6049001_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.6	7.0e-47
>prophage 433
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6072519	6074292	6393895		Enterobacteria_phage(100.0%)	1	NA	NA
WP_110893258.1|6072519_6074292_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.6	2.3e-18
>prophage 434
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6077943	6084843	6393895		Herpes_simplex_virus(33.33%)	7	NA	NA
WP_110893251.1|6077943_6080994_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	33.0	1.9e-156
WP_110893249.1|6081227_6081533_+	hypothetical protein	NA	F8WQ63	Bacillus_phage	44.4	9.6e-13
WP_110893247.1|6081668_6081989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893245.1|6082043_6082349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893243.1|6082556_6083447_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_110893241.1|6083726_6084335_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_110894027.1|6084336_6084843_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.2	1.1e-26
>prophage 435
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6094319	6097580	6393895		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
WP_110893224.1|6094319_6095069_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.1e-15
WP_024630176.1|6095220_6095454_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	3.5e-07
WP_110893222.1|6095629_6096868_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_110893220.1|6096881_6097580_+	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	32.3	6.0e-26
>prophage 436
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6111513	6112224	6393895		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_110893196.1|6111513_6112224_+	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	39.5	2.6e-21
>prophage 437
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6122519	6128070	6393895	tRNA,protease	Catovirus(50.0%)	4	NA	NA
WP_110893175.1|6122519_6124619_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.4	1.1e-104
WP_110894023.1|6124644_6125979_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_110893173.1|6126003_6126546_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_110893171.1|6126663_6128070_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.2	5.0e-40
>prophage 438
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6164054	6182734	6393895	tRNA,protease	Tupanvirus(33.33%)	15	NA	NA
WP_110893103.1|6164054_6164822_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.8	4.0e-23
WP_110893101.1|6164838_6165633_+	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	30.9	2.3e-05
WP_110893099.1|6165722_6166862_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_110893097.1|6166975_6168247_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_110893095.1|6168309_6169764_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	42.1	2.5e-103
WP_110893093.1|6169914_6174237_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	39.1	9.8e-26
WP_110893091.1|6174538_6175000_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_090923835.1|6175123_6176221_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_110893089.1|6176247_6176556_+	YlxR family protein	NA	NA	NA	NA	NA
WP_110893088.1|6176548_6176878_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_110893086.1|6176870_6179426_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	29.8	4.7e-20
WP_110893083.1|6179451_6179811_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_110893081.1|6179830_6180808_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_110893079.1|6180801_6181725_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_110893077.1|6181789_6182734_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	30.3	1.7e-07
>prophage 439
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6186823	6188513	6393895		Bacillus_virus(50.0%)	2	NA	NA
WP_110893073.1|6186823_6188104_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	32.7	2.5e-46
WP_174812288.1|6188060_6188513_+	dUTP diphosphatase	NA	V5L6Y7	Insectomime_virus	57.3	4.5e-35
>prophage 440
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6196069	6202549	6393895		Mycobacterium_phage(25.0%)	4	NA	NA
WP_110893056.1|6196069_6198844_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.0	4.7e-90
WP_110893054.1|6199024_6199855_+	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	37.9	2.1e-22
WP_110893052.1|6199985_6201266_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	25.8	9.3e-33
WP_110893050.1|6201268_6202549_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	29.7	3.5e-08
>prophage 441
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6209431	6210496	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_110893037.1|6209431_6210496_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.8	2.2e-128
>prophage 442
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6214494	6214755	6393895		Bacillus_phage(100.0%)	1	NA	NA
WP_007430104.1|6214494_6214755_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	43.8	3.8e-10
>prophage 443
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6220531	6223444	6393895		Bacillus_virus(100.0%)	3	NA	NA
WP_110894007.1|6220531_6221293_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	51.0	3.5e-56
WP_110893020.1|6221341_6221899_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_110893018.1|6221989_6223444_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.4	2.2e-115
>prophage 444
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6228959	6235280	6393895	tRNA	Orpheovirus(33.33%)	4	NA	NA
WP_110894005.1|6228959_6230657_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.1	1.4e-73
WP_110893002.1|6230784_6231327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110893000.1|6231428_6233522_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	21.6	9.9e-16
WP_110892998.1|6233534_6235280_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.9	7.4e-41
>prophage 445
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6244335	6248340	6393895		Mycobacterium_phage(100.0%)	1	NA	NA
WP_110892976.1|6244335_6248340_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.3	1.8e-45
>prophage 446
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6254207	6257873	6393895		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_110892962.1|6254207_6255014_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.9	1.3e-16
WP_110892960.1|6255350_6257873_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	29.3	4.5e-31
>prophage 447
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6279045	6279333	6393895		Cellulophaga_phage(100.0%)	1	NA	NA
WP_110896200.1|6279045_6279333_+	hypothetical protein	NA	S0A0H1	Cellulophaga_phage	43.5	6.1e-09
>prophage 448
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6306513	6311390	6393895		Enterobacteria_phage(50.0%)	3	NA	NA
WP_110895931.1|6306513_6308325_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.3	4.4e-20
WP_110895932.1|6308576_6309596_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_110895933.1|6309854_6311390_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.5e-18
>prophage 449
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6338590	6340332	6393895		Bacillus_phage(50.0%)	2	NA	NA
WP_110895960.1|6338590_6339295_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	1.6e-42
WP_110895961.1|6339291_6340332_+	HAMP domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.5	1.4e-15
>prophage 450
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6353097	6354900	6393895		Streptococcus_phage(100.0%)	1	NA	NA
WP_110895977.1|6353097_6354900_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.2	3.1e-119
>prophage 451
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6361486	6364660	6393895		Mycobacterium_phage(100.0%)	1	NA	NA
WP_110895983.1|6361486_6364660_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	35.9	1.9e-79
>prophage 452
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6376869	6380999	6393895		Streptococcus_phage(50.0%)	3	NA	NA
WP_110895993.1|6376869_6378819_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.2	2.8e-49
WP_110895994.1|6379122_6380130_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_110895995.1|6380252_6380999_+	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	39.2	1.5e-38
>prophage 453
NZ_CP054614	Paenibacillus barcinonensis strain KACC11450 chromosome, complete genome	6393895	6385049	6386939	6393895		Hokovirus(100.0%)	1	NA	NA
WP_110896000.1|6385049_6386939_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	35.4	1.4e-56
