The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	299962	307947	4248134		Caulobacter_phage(50.0%)	9	NA	NA
WP_024120122.1|299962_300658_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.1	6.0e-18
WP_095714473.1|300615_301458_+	zinc ABC transporter permease ZnuB	NA	NA	NA	NA	NA
WP_106021218.1|301498_302494_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010332925.1|302781_303381_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.5	9.7e-25
WP_010332926.1|303403_303985_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.4	3.3e-30
WP_010332927.1|304020_304599_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.0	6.2e-29
WP_010332928.1|304650_305424_+	TerC family protein	NA	S5MAL1	Bacillus_phage	64.8	2.2e-82
WP_106021220.1|305486_306647_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_106021256.1|306636_307947_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.4	2.1e-08
>prophage 2
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	682847	691213	4248134		Synechococcus_phage(50.0%)	8	NA	NA
WP_101861356.1|682847_684143_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.8	2.9e-18
WP_106021510.1|684217_684943_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.2	6.0e-45
WP_010333246.1|684935_685190_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_106021511.1|685186_685870_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_106021512.1|685853_688082_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.3e-159
WP_106021513.1|688057_689488_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.0	9.0e-53
WP_101861353.1|689588_690629_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	7.5e-65
WP_106021514.1|690625_691213_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	4.8e-29
>prophage 3
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	1219656	1253524	4248134	protease,tRNA,coat	Planktothrix_phage(20.0%)	39	NA	NA
WP_010333741.1|1219656_1220649_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024120913.1|1221390_1223028_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_024120914.1|1223135_1224071_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_024120915.1|1224074_1224992_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_081638274.1|1224996_1226073_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.9	6.0e-17
WP_106020545.1|1226074_1226992_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.1	5.3e-06
WP_106020544.1|1227101_1228319_+	MFS transporter	NA	NA	NA	NA	NA
WP_010333747.1|1228485_1229064_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024120919.1|1229243_1229639_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_044156385.1|1229681_1230338_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	40.0	1.9e-29
WP_120698858.1|1230524_1230650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024120921.1|1230616_1231273_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_106020543.1|1231430_1232582_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_174754411.1|1232811_1234641_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_024120925.1|1234676_1234844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024120926.1|1235157_1236057_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_010333756.1|1236053_1236452_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_095713633.1|1236708_1237251_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	72.9	2.5e-40
WP_106020540.1|1237454_1238027_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_095713617.1|1238150_1238519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024120930.1|1238547_1239183_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_010333761.1|1239202_1240003_+	NAD kinase	NA	NA	NA	NA	NA
WP_174754412.1|1240017_1240917_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_024120932.1|1240934_1241672_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	23.2	7.7e-08
WP_106020539.1|1241854_1243699_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_044156371.1|1243950_1244658_+	thiaminase II	NA	NA	NA	NA	NA
WP_095713613.1|1244635_1245253_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_106020538.1|1245236_1246346_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_081638285.1|1246345_1246546_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_081638278.1|1246542_1247313_+	thiazole synthase	NA	NA	NA	NA	NA
WP_106020537.1|1247309_1248320_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_024120940.1|1248338_1249154_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_024120941.1|1249290_1250067_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_081638279.1|1250167_1250893_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_106020536.1|1250979_1251429_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_003239243.1|1251556_1252045_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_044156363.1|1252196_1252688_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_044156361.1|1252776_1253097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106020535.1|1253137_1253524_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	1264454	1302068	4248134	plate,tRNA,head,capsid,holin,terminase,protease,integrase,portal,tail	Bacillus_phage(40.91%)	45	1264343:1264387	1301533:1301577
1264343:1264387	attL	CCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
WP_106020529.1|1264454_1265585_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	37.3	4.0e-56
WP_106020528.1|1265612_1266206_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106020527.1|1266395_1266605_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106020647.1|1266798_1267500_+	phage antirepressor KilAC domain-containing protein	NA	A0A1P8CWY0	Bacillus_phage	50.0	8.0e-55
WP_106020526.1|1267665_1268838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017695707.1|1268885_1269014_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_174754413.1|1269207_1269363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106020525.1|1271237_1271423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020524.1|1271702_1271957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020523.1|1272154_1272409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020522.1|1272398_1272830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020521.1|1272833_1273217_+	HNH endonuclease	NA	A0A2H4JI60	uncultured_Caudovirales_phage	35.2	9.6e-10
WP_106020646.1|1273799_1274057_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	65.4	5.8e-27
WP_013353333.1|1274329_1274803_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_106020520.1|1274799_1276503_+|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	35.0	2.1e-93
WP_017696959.1|1276514_1276718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020519.1|1276722_1277967_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	38.6	8.6e-68
WP_106020518.1|1277959_1278556_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	3.0e-42
WP_106020517.1|1278593_1279787_+|capsid	phage major capsid protein	capsid	A0A2H4J3W9	uncultured_Caudovirales_phage	49.0	1.8e-70
WP_106020516.1|1279843_1280146_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	36.6	1.1e-08
WP_106020515.1|1280126_1280450_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_106020514.1|1280449_1280833_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.2	8.1e-09
WP_106020645.1|1280919_1281315_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_106020513.1|1281341_1281923_+|tail	major tail protein	tail	A0A2H4JA75	uncultured_Caudovirales_phage	38.6	2.7e-24
WP_017696952.1|1282004_1282358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020512.1|1282369_1282558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020511.1|1282618_1286389_+|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	60.7	1.1e-102
WP_106020510.1|1286401_1287235_+|tail	phage tail family protein	tail	A0A0U4B037	Exiguobacterium_phage	30.8	3.2e-10
WP_106020509.1|1287246_1289121_+|tail	phage tail protein	tail	D6R400	Bacillus_phage	28.8	7.2e-50
WP_106020508.1|1289131_1291027_+	teichoic acid biosynthesis protein	NA	D6R401	Bacillus_phage	37.6	7.1e-13
WP_106020507.1|1291040_1292810_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	47.2	2.4e-55
WP_106020506.1|1292822_1293188_+	hypothetical protein	NA	O64053	Bacillus_phage	51.5	5.9e-17
WP_106020505.1|1293188_1293383_+	XkdX family protein	NA	NA	NA	NA	NA
WP_017696943.1|1293462_1293870_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	65.6	3.6e-39
WP_106020504.1|1293910_1294705_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	72.2	4.4e-65
WP_106020503.1|1295169_1295409_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	59.0	7.7e-18
WP_106020502.1|1295439_1295805_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_106020644.1|1295854_1297270_+	lipase	NA	NA	NA	NA	NA
WP_076457838.1|1297282_1297588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020501.1|1297625_1298000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106020500.1|1298236_1298521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106020499.1|1298635_1298860_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC34	Paenibacillus_phage	43.3	5.4e-05
WP_106020498.1|1299043_1299358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020497.1|1299372_1299765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020495.1|1301720_1302068_-|tRNA	tRNA-Val4	tRNA	NA	NA	NA	NA
1301533:1301577	attR	CCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
>prophage 5
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	1322302	1400815	4248134	plate,capsid,holin,terminase,coat,protease,portal,tail	Bacillus_phage(31.58%)	91	NA	NA
WP_142389212.1|1322302_1322551_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_099042818.1|1322828_1324229_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_106020481.1|1324279_1324753_-	YjfA family protein	NA	NA	NA	NA	NA
WP_010333849.1|1324880_1325048_-	YjfB family protein	NA	NA	NA	NA	NA
WP_106020480.1|1325173_1326073_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_106020479.1|1326087_1326480_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_024121019.1|1326580_1327147_-	YjgB family protein	NA	NA	NA	NA	NA
WP_106020478.1|1327293_1330251_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_106020477.1|1330243_1330804_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_101860778.1|1331001_1331643_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_103671650.1|1331719_1332346_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024121023.1|1332377_1332656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095713522.1|1333045_1334236_+	cytochrome P450	NA	NA	NA	NA	NA
WP_024121025.1|1334259_1335438_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	31.8	3.9e-09
WP_105953680.1|1335501_1336041_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_024121027.1|1336108_1336294_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	74.1	1.7e-20
WP_095713520.1|1336472_1337291_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_106020476.1|1337366_1338119_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_024121030.1|1338118_1338871_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.8	3.2e-17
WP_024121031.1|1338992_1339964_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_024121032.1|1340096_1340606_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010333866.1|1340980_1341397_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_024121033.1|1341436_1342615_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106020475.1|1342815_1344237_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_106020474.1|1344315_1345695_+	MFS transporter	NA	NA	NA	NA	NA
WP_106020473.1|1345800_1346814_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_106020472.1|1346818_1347838_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_106020471.1|1347861_1348941_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_106020470.1|1348937_1349774_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	31.1	3.2e-10
WP_106020469.1|1349819_1351088_+	MFS transporter	NA	NA	NA	NA	NA
WP_106020468.1|1351175_1352177_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_106020467.1|1352255_1353695_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_106020466.1|1353691_1355185_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_044156273.1|1355223_1355988_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_024121045.1|1356322_1356787_-	DinB family protein	NA	NA	NA	NA	NA
WP_081638280.1|1356989_1358126_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.6	1.7e-94
WP_024121047.1|1358115_1358250_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_044156268.1|1358291_1358546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106020465.1|1358655_1359603_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.5	4.2e-67
WP_024121050.1|1359851_1360079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024121051.1|1360488_1361112_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	46.7	2.2e-43
WP_024121052.1|1361166_1362003_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_095713506.1|1362047_1362644_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	2.1e-40
WP_024121054.1|1362804_1363146_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	4.5e-19
WP_095713505.1|1363325_1363505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020464.1|1363491_1364328_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	28.7	1.8e-21
WP_082687928.1|1364227_1365028_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.9	5.5e-60
WP_106020463.1|1365027_1365195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020462.1|1365288_1365639_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_010333893.1|1365625_1365832_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.3e-12
WP_024121061.1|1365948_1366458_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
WP_106020461.1|1366575_1367367_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.0	1.4e-58
WP_106020460.1|1367363_1368665_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.7	2.6e-152
WP_024121064.1|1368665_1370156_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.6e-140
WP_024121065.1|1370175_1371003_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.5	1.4e-53
WP_106020459.1|1371027_1371963_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.1	6.6e-105
WP_106020458.1|1371986_1372370_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.2	4.4e-15
WP_106020457.1|1372366_1372723_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_095713498.1|1372719_1373208_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	42.4	5.8e-36
WP_106020456.1|1373220_1373661_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_059336109.1|1373663_1373876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095713496.1|1373875_1375276_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	38.8	5.1e-77
WP_003220592.1|1375277_1375721_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	1.1e-25
WP_003232676.1|1375810_1376257_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003239113.1|1376286_1376436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020455.1|1376437_1380463_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	5.7e-44
WP_106020454.1|1380455_1381115_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	2.8e-25
WP_106020453.1|1381130_1382108_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.7	1.2e-37
WP_106020452.1|1382107_1382374_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	8.4e-05
WP_024121077.1|1382432_1382858_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	36.6	6.6e-12
WP_106020451.1|1382850_1383897_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	5.4e-71
WP_106020450.1|1383880_1384459_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	32.4	8.7e-15
WP_095713489.1|1384455_1384728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020449.1|1384730_1386845_+|terminase	terminase	terminase	A0A1P8CWR7	Bacillus_phage	56.1	2.1e-45
WP_106020448.1|1386856_1387186_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.4	1.9e-14
WP_106020447.1|1387182_1387347_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.2	1.2e-14
WP_106020446.1|1387390_1388230_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_106020445.1|1388282_1388552_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.9	3.3e-25
WP_106020444.1|1388563_1388827_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	62.1	8.0e-24
WP_101860749.1|1388839_1389733_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.2	2.3e-83
WP_142396753.1|1389769_1389907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024121090.1|1389990_1390161_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_024121091.1|1390160_1390907_-	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_024121092.1|1391015_1392017_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_010333926.1|1392029_1392647_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_099042852.1|1392923_1394240_-	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_024121094.1|1394634_1395585_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_106020443.1|1395832_1398007_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_106020442.1|1398019_1398991_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	2.5e-62
WP_174754414.1|1399126_1399303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106020441.1|1399459_1400815_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	7.5e-25
>prophage 6
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	1915029	1922145	4248134		Bacillus_phage(50.0%)	6	NA	NA
WP_024121498.1|1915029_1915422_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.0	1.0e-30
WP_106020805.1|1915381_1917484_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_044155791.1|1917501_1918491_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.2	1.9e-155
WP_106020806.1|1918539_1919160_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	49.8	1.7e-48
WP_106020808.1|1919221_1919989_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	2.8e-53
WP_049809927.1|1921176_1922145_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	42.9	6.1e-53
>prophage 7
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	2206004	2264447	4248134	integrase	Bacillus_phage(91.76%)	96	2234633:2234649	2264462:2264478
WP_106021322.1|2206004_2206472_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	36.1	4.6e-14
WP_164914266.1|2206463_2206634_-	hypothetical protein	NA	O64196	Bacillus_phage	59.6	4.7e-09
WP_106021324.1|2206634_2207225_-	Holliday junction resolvase RecU	NA	O64195	Bacillus_phage	93.8	8.7e-103
WP_106021430.1|2207299_2207542_+	helix-turn-helix transcriptional regulator	NA	O64194	Bacillus_phage	96.2	3.1e-38
WP_106021326.1|2207543_2207729_-	hypothetical protein	NA	O64193	Bacillus_phage	93.4	1.1e-24
WP_061891171.1|2207796_2208273_-	macro domain-containing protein	NA	A0A0H3V0V8	Geobacillus_virus	51.3	5.7e-36
WP_064814933.1|2208305_2208740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064814932.1|2208736_2208910_-	hypothetical protein	NA	O64190	Bacillus_phage	91.2	1.2e-20
WP_106021328.1|2208910_2209459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021431.1|2209439_2209772_-	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	61.4	6.1e-29
WP_106021330.1|2209836_2210388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021332.1|2210377_2210533_-	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	91.3	3.4e-14
WP_106021334.1|2210568_2210874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021336.1|2210910_2211468_-	hypothetical protein	NA	A0A140HLT6	Bacillus_phage	57.8	8.6e-60
WP_106021338.1|2211489_2211708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021340.1|2211717_2212545_-	metallophosphoesterase	NA	O64184	Bacillus_phage	95.3	4.0e-162
WP_041336474.1|2212663_2212882_+	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	97.2	3.6e-30
WP_106021344.1|2213462_2214209_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	97.1	1.6e-130
WP_106021347.1|2214221_2214575_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	60.7	1.5e-30
WP_106021349.1|2214681_2215221_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	44.7	3.2e-35
WP_106021351.1|2215220_2216060_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	95.3	2.9e-160
WP_106021353.1|2216116_2216461_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	92.1	5.0e-50
WP_106021355.1|2216603_2216897_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	91.8	9.4e-42
WP_086352591.1|2217233_2217668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106021357.1|2217767_2218196_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.7	1.8e-73
WP_106021359.1|2218269_2218632_-	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	40.2	1.1e-10
WP_106021361.1|2218674_2218917_-	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	93.8	2.9e-36
WP_106021363.1|2218913_2219918_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	82.3	2.5e-150
WP_106021365.1|2220172_2222710_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	96.2	0.0e+00
WP_106021367.1|2222860_2223544_-	HNH endonuclease	NA	L0LCB9	Bacillus_phage	57.6	2.6e-50
WP_106021433.1|2223647_2224325_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	79.1	7.9e-92
WP_142396759.1|2224332_2224728_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	92.4	2.0e-63
WP_106021369.1|2224727_2225090_-	hypothetical protein	NA	O64171	Bacillus_phage	94.2	3.4e-57
WP_106021371.1|2225170_2225353_-	hypothetical protein	NA	F8WPL1	Bacillus_phage	71.7	2.2e-20
WP_106021373.1|2225393_2225588_-	hypothetical protein	NA	O64169	Bacillus_phage	100.0	2.2e-31
WP_004399476.1|2225608_2225743_-	hypothetical protein	NA	O64168	Bacillus_phage	100.0	2.5e-18
WP_072183738.1|2225774_2226041_-	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	96.6	4.7e-40
WP_106021375.1|2226057_2226270_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	92.9	5.8e-33
WP_041056314.1|2226285_2226477_-	hypothetical protein	NA	U5PY38	Bacillus_phage	43.5	6.2e-10
WP_106021377.1|2226521_2226818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021379.1|2226848_2226974_-	hypothetical protein	NA	O64165	Bacillus_phage	82.9	1.4e-10
WP_106021381.1|2226987_2227335_-	hypothetical protein	NA	O64164	Bacillus_phage	97.4	3.0e-55
WP_106021383.1|2227349_2227745_-	hypothetical protein	NA	O64163	Bacillus_phage	90.1	2.8e-65
WP_106021385.1|2227944_2228418_-	hypothetical protein	NA	O64162	Bacillus_phage	67.9	2.1e-59
WP_154019766.1|2228516_2228690_-	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	94.7	5.2e-24
WP_106021387.1|2228724_2228937_-	hypothetical protein	NA	O64159	Bacillus_phage	90.0	7.1e-31
WP_106021389.1|2229004_2229187_-	hypothetical protein	NA	O64158	Bacillus_phage	98.3	2.0e-26
WP_106021391.1|2229199_2229427_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	97.3	1.5e-34
WP_106021393.1|2229466_2229832_-	hypothetical protein	NA	O64156	Bacillus_phage	94.2	7.3e-60
WP_106021394.1|2229835_2230054_-	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	97.2	4.7e-30
WP_106021434.1|2230097_2231537_-	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	64.4	4.8e-187
WP_106021395.1|2231607_2232255_-	HNH endonuclease	NA	O64121	Bacillus_phage	40.5	9.1e-29
WP_072692910.1|2232307_2232535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021396.1|2232563_2233061_-	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	90.9	1.8e-80
WP_106021397.1|2233060_2233216_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	4.4e-22
WP_019712328.1|2233208_2233424_-	YorP family protein	NA	O64150	Bacillus_phage	98.6	3.0e-37
WP_019712327.1|2233456_2233654_-	hypothetical protein	NA	O64149	Bacillus_phage	98.5	7.3e-30
WP_106021398.1|2233654_2233840_-	hypothetical protein	NA	O64148	Bacillus_phage	100.0	9.9e-21
WP_106021399.1|2233957_2234674_-	3D domain-containing protein	NA	O64147	Bacillus_phage	84.0	1.3e-105
2234633:2234649	attL	ATATACATATTTTTTAT	NA	NA	NA	NA
WP_106021400.1|2234701_2238619_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.2	0.0e+00
WP_106021401.1|2238631_2240362_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	97.0	0.0e+00
WP_106021402.1|2240361_2241498_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	99.2	1.1e-223
WP_106021403.1|2241513_2243028_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	99.0	2.6e-284
WP_101502259.1|2243042_2243513_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	97.4	5.9e-86
WP_004399537.1|2243555_2244527_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_072692914.1|2244609_2245524_-	hypothetical protein	NA	O64140	Bacillus_phage	89.5	3.6e-156
WP_033885449.1|2245545_2245917_-	hypothetical protein	NA	O64139	Bacillus_phage	96.7	3.2e-63
WP_106021404.1|2246233_2246614_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	97.6	4.2e-66
WP_106021405.1|2246678_2246972_-	hypothetical protein	NA	O64136	Bacillus_phage	94.8	6.3e-46
WP_106021406.1|2247057_2248818_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	96.4	0.0e+00
WP_106021407.1|2248814_2249639_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	93.4	8.6e-141
WP_106021408.1|2249737_2250169_-	hypothetical protein	NA	A0A2I7RP21	Vibrio_phage	32.1	9.7e-11
WP_019712316.1|2250174_2250321_-	hypothetical protein	NA	A0A1P8CWZ9	Bacillus_phage	77.1	8.6e-12
WP_106021409.1|2250387_2250609_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	97.3	1.4e-34
WP_106021410.1|2250679_2251354_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	98.6	4.5e-79
WP_106021411.1|2251423_2252236_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	92.6	8.8e-146
WP_106021412.1|2252301_2252715_-	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	89.8	2.6e-69
WP_106021413.1|2252840_2253221_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	48.4	3.6e-25
WP_106021414.1|2253309_2253660_-	hypothetical protein	NA	O64127	Bacillus_phage	84.5	7.1e-52
WP_071581193.1|2253661_2254018_-	hypothetical protein	NA	O64126	Bacillus_phage	97.5	1.8e-50
WP_106021415.1|2254010_2254319_-	hypothetical protein	NA	O64125	Bacillus_phage	90.2	5.4e-48
WP_161792529.1|2254336_2254492_-	URC4/urg3 family protein	NA	NA	NA	NA	NA
WP_106021416.1|2254506_2254722_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	84.5	7.4e-28
WP_106021417.1|2254921_2257120_-	metallophosphoesterase	NA	Q4Z932	Staphylococcus_phage	43.0	2.0e-160
WP_106021418.1|2257381_2257573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106021419.1|2257572_2258136_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	51.6	3.4e-40
WP_003231036.1|2258721_2258916_-	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_017697045.1|2259027_2259225_-	hypothetical protein	NA	O64104	Bacillus_phage	98.5	6.8e-28
WP_017697044.1|2259295_2259514_-	YopT family protein	NA	O64103	Bacillus_phage	98.6	2.5e-31
WP_004399410.1|2259696_2259921_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_003231032.1|2260109_2261087_-	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
WP_003231030.1|2261110_2262493_-	hypothetical protein	NA	O64100	Bacillus_phage	99.3	3.7e-261
WP_019712297.1|2262599_2263676_-|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	99.7	2.0e-198
WP_041054507.1|2263665_2263878_-	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	97.1	9.6e-28
WP_009967507.1|2263926_2264244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399418.1|2264246_2264447_-	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
2264462:2264478	attR	ATATACATATTTTTTAT	NA	NA	NA	NA
>prophage 8
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	2272797	2328440	4248134	integrase,holin,protease,tail	Bacillus_phage(95.74%)	56	2291338:2291353	2311983:2311998
WP_106021721.1|2272797_2273700_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_064814716.1|2273844_2274024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072692936.1|2274046_2274271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106019954.1|2274447_2276049_-	DUF4942 domain-containing protein	NA	A0A0U4JGM1	Vibrio_phage	36.0	4.7e-10
WP_106019955.1|2276103_2277972_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_106019956.1|2278298_2279516_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.2	2.4e-200
WP_106019957.1|2279597_2279786_-	hypothetical protein	NA	O64081	Bacillus_phage	58.1	6.1e-10
WP_106019958.1|2279830_2280046_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	4.6e-30
WP_017696861.1|2280099_2280276_-	hypothetical protein	NA	O64080	Bacillus_phage	92.3	4.4e-10
WP_106019959.1|2280509_2280731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106019960.1|2280811_2281417_-	hypothetical protein	NA	O64079	Bacillus_phage	73.3	5.7e-57
WP_106019961.1|2281636_2281963_-	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	97.2	1.8e-54
WP_072692657.1|2282914_2283109_+	hypothetical protein	NA	O64077	Bacillus_phage	95.3	8.7e-28
WP_106019962.1|2283148_2285656_+	hypothetical protein	NA	O64076	Bacillus_phage	92.5	0.0e+00
WP_042976245.1|2285918_2286197_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	94.5	7.1e-39
WP_003230977.1|2287877_2288078_+	YonK family protein	NA	NA	NA	NA	NA
WP_061891091.1|2288089_2289277_+	metallophosphoesterase	NA	W5RV85	Staphylococcus_phage	41.3	1.5e-69
WP_019712266.1|2289302_2289758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106019963.1|2289860_2290385_+	hypothetical protein	NA	U5J9P3	Bacillus_phage	37.8	9.7e-21
WP_106019964.1|2290487_2291408_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	99.3	7.8e-175
2291338:2291353	attL	AAGAAATGAATAAGCA	NA	NA	NA	NA
WP_003230970.1|2291394_2293164_+	hypothetical protein	NA	O64069	Bacillus_phage	99.8	0.0e+00
WP_106019965.1|2293181_2294702_+	hypothetical protein	NA	O64068	Bacillus_phage	99.2	5.1e-280
WP_106019966.1|2294732_2296169_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	91.8	5.9e-246
WP_019712260.1|2296193_2296730_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	98.9	3.0e-94
WP_061891083.1|2296768_2297785_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.4	8.3e-186
WP_019712890.1|2297820_2298291_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
WP_004399452.1|2298305_2298701_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_009967519.1|2298697_2298952_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_106019967.1|2298935_2299586_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	99.5	3.5e-121
WP_004399477.1|2299582_2300089_+	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
WP_003230954.1|2300085_2300796_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_041054450.1|2300838_2301636_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	99.2	3.0e-90
WP_106019968.1|2301653_2302265_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	99.0	2.2e-64
WP_009967521.1|2302264_2302492_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_106019969.1|2302555_2302912_+	hypothetical protein	NA	O64055	Bacillus_phage	85.6	7.9e-51
WP_174754428.1|2302912_2304079_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	29.0	2.5e-29
WP_106019970.1|2304095_2304434_+	hypothetical protein	NA	O64053	Bacillus_phage	43.8	1.9e-17
WP_106019971.1|2304430_2304628_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	72.7	4.6e-16
WP_106019972.1|2304692_2305193_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	97.0	1.7e-83
WP_106019973.1|2305176_2305596_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	92.8	6.7e-65
WP_106020324.1|2305609_2306611_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	98.8	7.6e-192
WP_106019974.1|2306834_2307284_+	hypothetical protein	NA	O64047	Bacillus_phage	96.6	1.3e-74
WP_106019975.1|2307362_2308046_+	immunity protein	NA	Q37974	Bacillus_phage	93.0	2.7e-108
WP_106019976.1|2308099_2314990_+	transglycosylase CwlP	NA	A0A1P8CWQ1	Bacillus_phage	71.6	0.0e+00
2311983:2311998	attR	AAGAAATGAATAAGCA	NA	NA	NA	NA
WP_106019977.1|2315033_2315795_+|tail	phage tail family protein	tail	A0A1P8CWP8	Bacillus_phage	96.6	4.1e-129
WP_106019978.1|2315807_2318450_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	96.7	0.0e+00
WP_106020325.1|2318465_2319284_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	65.6	8.7e-101
WP_106019979.1|2319299_2321336_+|tail	tail fiber domain-containing protein	tail	A0A0A0RUQ7	Bacillus_phage	40.1	1.1e-75
WP_106019980.1|2321503_2322607_+	N-acetylmuramoyl-L-alanine amidase BlyA	NA	A0A1P8CWN6	Bacillus_phage	95.9	1.3e-179
WP_017696898.1|2322722_2323115_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	100.0	2.2e-62
WP_017696899.1|2323135_2323387_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	97.6	2.1e-37
WP_106019982.1|2323543_2324704_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	25.5	4.9e-33
WP_106019983.1|2324866_2326117_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	97.4	6.3e-236
WP_106019984.1|2326109_2326442_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	96.4	7.1e-54
WP_106019985.1|2326607_2328092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082786706.1|2328356_2328440_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 9
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	2477979	2484185	4248134		Staphylococcus_phage(50.0%)	9	NA	NA
WP_044154877.1|2477979_2478573_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.8	4.5e-14
WP_106020336.1|2478562_2479318_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	1.4e-07
WP_024121909.1|2479532_2479622_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_106020042.1|2479709_2480234_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2480247_2480622_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_106020043.1|2480733_2481198_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.7	9.4e-44
WP_024121912.1|2481230_2482427_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_106020044.1|2482441_2483089_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	46.4	3.8e-43
WP_106020045.1|2483099_2484185_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.2	1.4e-50
>prophage 10
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	2834223	2888288	4248134	protease,tRNA,coat	uncultured_Mediterranean_phage(14.29%)	55	NA	NA
WP_024122326.1|2834223_2835369_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	7.6e-87
WP_106020188.1|2835395_2836424_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2836450_2836651_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_024122329.1|2836643_2837648_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.8	8.9e-07
WP_024122330.1|2837658_2838264_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_103672529.1|2838402_2838912_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_106020189.1|2838959_2840264_-	MFS transporter	NA	NA	NA	NA	NA
WP_024122333.1|2840347_2841373_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_106020190.1|2841610_2842261_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_127696699.1|2842302_2842425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174754449.1|2842554_2842953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020191.1|2843218_2844673_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_106020192.1|2844721_2845441_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024122340.1|2845544_2846156_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_106020193.1|2846302_2847466_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_106020194.1|2847581_2848685_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_106020195.1|2848671_2849541_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_106020196.1|2849494_2851090_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_106020197.1|2851192_2852374_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	31.3	8.3e-28
WP_095714293.1|2852339_2852882_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_106020198.1|2852903_2853761_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_010335153.1|2853778_2854222_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_024122348.1|2854276_2855563_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_106020199.1|2855597_2856176_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_125825434.1|2856253_2856376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2856495_2856780_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_069487111.1|2856792_2857134_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003222620.1|2857136_2857445_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_044154177.1|2857593_2858460_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_024122352.1|2858452_2859247_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024122353.1|2859396_2860203_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024122354.1|2860204_2860885_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_010335162.1|2860937_2861456_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_010335163.1|2861452_2862325_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_010335164.1|2862355_2863369_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_024122357.1|2863460_2864156_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_024122358.1|2864193_2864763_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_106020200.1|2864913_2865912_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_106020201.1|2866044_2866791_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_106020202.1|2866931_2868224_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_106020203.1|2868283_2870926_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.8	3.7e-161
WP_024122364.1|2871374_2871566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020204.1|2871585_2872611_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_106020205.1|2872643_2874986_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059293481.1|2875120_2876413_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_024122369.1|2876442_2877417_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_106020206.1|2877413_2878202_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_106020207.1|2878191_2879133_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_010335178.1|2879169_2880000_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_106020208.1|2880007_2881375_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_106020209.1|2881605_2882103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106020210.1|2882126_2882714_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024122375.1|2882710_2885035_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	5.7e-182
WP_024122376.1|2885214_2886873_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_024122377.1|2887025_2888288_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.7e-148
>prophage 11
NZ_CP054584	Bacillus subtilis strain KKD1 chromosome, complete genome	4248134	3848035	3901564	4248134	bacteriocin,protease,tRNA,coat	Bacillus_phage(20.0%)	52	NA	NA
WP_106019730.1|3848035_3849706_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024123211.1|3849702_3850131_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3850442_3850574_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_044159802.1|3850708_3852055_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_059292334.1|3852067_3852229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106019731.1|3852225_3852945_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	2.8e-18
WP_106019732.1|3852937_3854251_+|bacteriocin	bacteriocin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_106019944.1|3854240_3855404_+	insulinase family protein	NA	NA	NA	NA	NA
WP_106019733.1|3855409_3856687_+	insulinase family protein	NA	NA	NA	NA	NA
WP_106019734.1|3856683_3857385_+|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_106019735.1|3857947_3859306_-	YncE family protein	NA	NA	NA	NA	NA
WP_024123222.1|3859534_3860680_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.2	3.3e-82
WP_024123223.1|3860663_3860783_+	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_106019736.1|3860889_3861762_-	agmatinase	NA	NA	NA	NA	NA
WP_064815948.1|3861822_3862653_-	spermidine synthase	NA	NA	NA	NA	NA
WP_106019737.1|3862853_3864929_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_106019738.1|3865536_3866055_-	YwhD family protein	NA	NA	NA	NA	NA
WP_101864913.1|3866067_3866727_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3866835_3867024_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_024123229.1|3867066_3867486_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106019739.1|3867604_3869521_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	41.6	1.9e-143
WP_106019740.1|3870366_3871764_-	MFS transporter	NA	NA	NA	NA	NA
WP_106019741.1|3871760_3872234_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024123233.1|3872345_3872846_-	YwgA family protein	NA	NA	NA	NA	NA
WP_059335166.1|3872882_3874184_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.3	5.5e-25
WP_024123235.1|3874345_3874570_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_024123236.1|3874784_3875561_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	34.5	6.5e-05
WP_095712780.1|3875701_3876592_-	DMT family transporter	NA	NA	NA	NA	NA
WP_024123239.1|3876741_3877587_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_106019742.1|3877634_3878534_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_095712778.1|3878663_3879635_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003235942.1|3879904_3880669_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_105954423.1|3880801_3881581_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_024123243.1|3881595_3882795_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024123244.1|3882807_3883989_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_106019743.1|3883985_3885404_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_024123246.1|3885426_3886188_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	3.7e-21
WP_106019744.1|3886187_3886898_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_095712765.1|3886887_3887502_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_106019745.1|3887652_3888891_-	MFS transporter	NA	NA	NA	NA	NA
WP_174754437.1|3889152_3889485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106019746.1|3889568_3890981_-	amino acid permease	NA	NA	NA	NA	NA
WP_106019747.1|3890980_3892681_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_106019748.1|3892752_3894300_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024123255.1|3894528_3895803_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_024123256.1|3895985_3896450_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_010332322.1|3896777_3897233_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_095712760.1|3897225_3898077_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.1	1.5e-39
WP_024123258.1|3898090_3899038_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.5	2.2e-71
WP_106019749.1|3899040_3899778_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_106019750.1|3899802_3900822_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_106019751.1|3900823_3901564_-|coat	spore coat protein	coat	NA	NA	NA	NA
