The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	883319	890721	5431628	transposase	Enterobacteria_phage(16.67%)	9	NA	NA
WP_001016257.1|883319_884066_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001359388.1|884080_885622_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	6.4e-129
WP_001285587.1|886461_886830_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|886903_887125_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|887187_887664_-	RadC family protein	NA	NA	NA	NA	NA
WP_100089151.1|887679_888165_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.1e-13
WP_001234731.1|888255_889074_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.3e-45
WP_001323397.1|889228_889387_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_085959019.1|889507_890721_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
>prophage 2
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	1586545	1591971	5431628	integrase	Enterobacteria_phage(50.0%)	6	1575533:1575549	1594167:1594183
1575533:1575549	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_174846731.1|1586545_1587115_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	1.4e-68
WP_000403518.1|1587114_1587582_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000960724.1|1587568_1588249_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1588258_1589395_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1589569_1590727_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1591038_1591971_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1594167:1594183	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	1837669	1918969	5431628	protease,lysis,tRNA,holin,tail,terminase,head,capsid	Escherichia_phage(40.24%)	89	NA	NA
WP_000569336.1|1837669_1838596_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1838600_1839332_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1839312_1839420_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|1839479_1840181_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_000063648.1|1840201_1841488_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1841521_1841776_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001030159.1|1841794_1841929_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
WP_000457735.1|1841932_1842175_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_000208043.1|1842262_1842766_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.0	1.0e-56
WP_001289950.1|1842767_1843454_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	85.2	1.9e-117
WP_000763383.1|1843450_1843672_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001386642.1|1843770_1844052_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|1844062_1844254_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682317.1|1844226_1844409_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.8e-28
WP_174846732.1|1844405_1845086_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.8e-131
WP_000995439.1|1845869_1846166_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001484321.1|1846241_1846385_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_001198861.1|1846353_1846518_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065357.1|1846590_1846959_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_000167599.1|1847109_1847580_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	8.2e-88
WP_000387877.1|1847643_1847967_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	98.1	2.5e-59
WP_000198436.1|1848026_1848410_-	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_001278658.1|1848916_1849537_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.0	6.9e-50
WP_001207140.1|1849533_1849968_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_000885926.1|1850038_1850380_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000428098.1|1850440_1851145_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1851258_1851492_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438529.1|1851630_1851930_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	98.0	6.9e-48
WP_000185523.1|1851962_1852901_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.0	5.3e-171
WP_000788841.1|1852897_1853599_+	Replication protein P	NA	H6WZI3	Escherichia_phage	99.6	9.9e-130
WP_000145935.1|1853595_1853886_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000124.1|1853956_1854235_+	hypothetical protein	NA	H6WZI5	Escherichia_phage	98.9	2.9e-48
WP_000103678.1|1854367_1854583_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001484315.1|1854593_1854830_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	98.7	6.0e-39
WP_001484314.1|1854786_1855233_+	recombination protein NinB	NA	H6WZI6	Escherichia_phage	100.0	3.2e-81
WP_000153280.1|1855229_1855757_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1855753_1855936_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000235318.1|1856213_1856918_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	90.6	3.2e-120
WP_001004032.1|1856992_1857715_+	phage antirepressor KilAC domain-containing protein	NA	H6WZJ2	Escherichia_phage	99.6	4.2e-131
WP_001107997.1|1857714_1858320_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	100.0	3.3e-97
WP_001028866.1|1858316_1858988_+	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	99.6	2.4e-133
WP_000512812.1|1858978_1859467_+	late gene antiterminator protein	NA	H6WZJ5	Escherichia_phage	100.0	5.3e-90
WP_001484313.1|1859959_1860391_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	100.0	7.1e-70
WP_000216690.1|1860387_1860552_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_171879517.1|1860927_1862781_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	100.0	0.0e+00
WP_000284515.1|1862930_1863146_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075147.1|1863145_1863643_+	lysozyme	NA	H6WZK1	Escherichia_phage	100.0	3.4e-92
WP_000092250.1|1863639_1864107_+|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	100.0	5.0e-77
WP_000839224.1|1864308_1864806_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1864802_1865060_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000828068.1|1865497_1865824_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001484168.1|1865955_1866156_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	100.0	8.7e-31
WP_000829188.1|1866197_1866563_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	94.2	5.1e-61
WP_000958416.1|1866853_1867417_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001372135.1|1867413_1869075_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	100.0	0.0e+00
WP_000173031.1|1869138_1871076_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063096.1|1871120_1871342_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1873868_1874195_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007911.1|1874204_1874555_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1874551_1874998_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1874994_1875339_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275464.1|1875405_1876122_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710945.1|1876136_1876511_+|tail	phage tail assembly chaperone	tail	H6WZL9	Escherichia_phage	100.0	3.5e-65
WP_001513217.1|1876606_1876816_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807959.1|1880098_1880440_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	99.1	2.5e-62
WP_040061900.1|1880439_1881138_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.6	3.6e-132
WP_001302649.1|1881154_1881475_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1881582_1881756_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1881826_1882750_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_100089178.1|1882804_1883542_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	99.6	1.2e-149
WP_174846760.1|1883487_1884120_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.3	9.3e-103
WP_174846733.1|1884364_1887841_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.6	0.0e+00
WP_001230309.1|1887907_1888507_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	3.0e-111
WP_053896501.1|1888571_1889885_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001023417.1|1889886_1890156_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_001131652.1|1890268_1890844_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	100.0	6.7e-100
WP_001419933.1|1893068_1894277_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	100.0	2.4e-232
WP_001261971.1|1894481_1894730_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_001359340.1|1895244_1896930_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_000598641.1|1896926_1897646_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1897692_1898163_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001359339.1|1898204_1898666_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001087225.1|1898790_1900794_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359586.1|1900790_1901927_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001294376.1|1901919_1904199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000636923.1|1905929_1906247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356845.1|1906307_1909940_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000860780.1|1909949_1912982_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1916935_1918969_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	1954079	1991599	5431628	lysis,plate,tRNA,integrase,holin,tail,terminase,head,portal,capsid	Escherichia_phage(46.81%)	52	1955860:1955887	1986525:1986552
WP_000807374.1|1954079_1954979_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001418632.1|1955384_1955702_+	hypothetical protein	NA	NA	NA	NA	NA
1955860:1955887	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|1955966_1956980_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|1957095_1957395_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1957516_1957792_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1957802_1957973_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217675.1|1957969_1958470_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.0e-91
WP_000557703.1|1958533_1958758_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277966.1|1958757_1959060_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	99.0	1.7e-46
WP_001113264.1|1959059_1959284_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|1959280_1959556_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_000268597.1|1959545_1961831_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_032242139.1|1961830_1962283_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	94.0	8.8e-79
WP_001484278.1|1962712_1963444_+	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	78.4	1.6e-106
WP_001764709.1|1963542_1964241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038193.1|1964552_1965587_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_000156861.1|1965586_1967359_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085975.1|1967532_1968387_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_001248564.1|1968445_1969519_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	3.3e-201
WP_000203466.1|1969522_1970266_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	99.2	4.0e-121
WP_000988633.1|1970365_1970875_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1970874_1971078_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1971081_1971363_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1971362_1971860_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736595.1|1971874_1972300_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.7	6.1e-58
WP_000040629.1|1972287_1972713_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	1.5e-64
WP_072141527.1|1972684_1972858_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	8.9e-24
WP_000917190.1|1972820_1973288_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001001780.1|1973280_1973733_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093699.1|1973799_1974435_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	5.0e-112
WP_000127163.1|1974431_1974779_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121476.1|1974783_1975692_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_001285337.1|1975684_1976296_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_096929299.1|1976292_1977573_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	89.3	1.1e-153
WP_001089536.1|1977575_1978019_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	51.0	1.6e-37
WP_001030523.1|1977990_1978593_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	7.3e-97
WP_050555109.1|1978592_1979138_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.1	3.7e-55
WP_000905108.1|1979168_1979762_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001286717.1|1979821_1981012_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251403.1|1981024_1981543_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	5.5e-93
WP_001031303.1|1981599_1981875_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1981907_1982027_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069908.1|1982019_1984467_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.3	0.0e+00
WP_000978908.1|1984481_1984961_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882965.1|1984960_1986124_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	7.0e-205
WP_000468308.1|1986205_1986424_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476027.1|1986696_1988058_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
1986525:1986552	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220184.1|1988160_1988457_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000124651.1|1988458_1988710_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1988953_1989286_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1989476_1990199_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675144.1|1990195_1991599_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	2093629	2169691	5431628	protease,integrase,transposase,holin,tail,terminase,head,portal,capsid	Enterobacteria_phage(34.15%)	68	2103618:2103632	2127419:2127433
WP_085959019.1|2093629_2094843_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000502860.1|2095269_2095908_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_000966626.1|2096278_2098426_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973176.1|2100097_2100643_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2100639_2101383_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2101394_2102474_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986329.1|2102535_2103471_+	L,D-transpeptidase	NA	NA	NA	NA	NA
2103618:2103632	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_001011474.1|2103927_2104845_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2104946_2105897_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2108283_2109000_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2109342_2110797_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2110898_2112215_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480499.1|2112529_2113582_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2122315_2123113_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533608.1|2123348_2124374_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
WP_000094838.1|2124373_2124577_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000990641.1|2124635_2127053_-	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	6.0e-174
WP_000199480.1|2127145_2127334_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449169.1|2127330_2127519_-	cell division inhibitor	NA	NA	NA	NA	NA
2127419:2127433	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000559929.1|2128060_2128576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379559.1|2128688_2128841_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001003381.1|2129033_2129441_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|2129518_2129746_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705361.1|2129729_2130251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054513.1|2130231_2131197_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_001151172.1|2131237_2131645_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000101550.1|2132085_2133045_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000813254.1|2133416_2133572_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001004956.1|2133737_2134388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2134368_2135472_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000975564.1|2135626_2135887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2135956_2136235_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265287.1|2136236_2137286_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	5.3e-111
WP_001217436.1|2137298_2137670_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2137659_2138031_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265268.1|2138183_2139002_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261910.1|2139622_2140336_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874327.1|2141103_2142954_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411813.1|2143246_2143453_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|2143457_2144447_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092850.1|2144489_2145023_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|2145577_2145664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2145885_2146071_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_000347012.1|2146757_2146895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2147031_2147217_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|2147618_2148128_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_174846734.1|2148099_2150028_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	7.9e-262
WP_000259002.1|2150011_2150218_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_100089172.1|2150214_2151807_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	5.5e-184
WP_001253898.1|2151796_2153302_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.3e-99
WP_000256840.1|2153338_2153686_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_100089170.1|2153743_2154772_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.9e-113
WP_000201512.1|2154823_2155207_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2155199_2155553_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974985.1|2155568_2156102_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|2156098_2156494_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|2156501_2157254_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479105.1|2157267_2157699_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533417.1|2157725_2158139_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_174846735.1|2158119_2160699_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.0	0.0e+00
WP_000847304.1|2160695_2161025_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001357740.1|2161024_2161723_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194791.1|2161728_2162472_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.8	2.7e-149
WP_050546863.1|2162417_2163050_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|2163240_2163768_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001253753.1|2167442_2168042_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	6.7e-111
WP_174846736.1|2168106_2169420_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.4	1.3e-74
WP_174846737.1|2169421_2169691_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
>prophage 6
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	2255344	2349887	5431628	protease,lysis,tRNA,holin,tail,terminase,portal	Enterobacteria_phage(40.32%)	103	NA	NA
WP_001025322.1|2255344_2257078_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001295504.1|2257293_2257860_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185748.1|2257873_2258620_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214274.1|2259007_2260108_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176809.1|2260132_2262562_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564723.1|2262726_2263698_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2263694_2264438_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2264478_2264874_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_069190626.1|2264926_2265703_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000063651.1|2265707_2266994_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.5	1.7e-252
WP_001193437.1|2267027_2267282_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001484100.1|2267473_2267845_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_000720006.1|2267885_2268713_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001365075.1|2269082_2269655_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000553977.1|2269660_2269843_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_000147364.1|2270041_2270242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387836.1|2270238_2270940_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000800139.1|2271087_2271777_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	1.2e-114
WP_000944728.1|2271933_2272167_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090253.1|2272248_2272956_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	5.3e-115
WP_000587261.1|2273063_2273726_+	ash family protein	NA	Q8W643	Enterobacteria_phage	96.3	6.1e-113
WP_000621231.1|2273722_2273956_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_001247844.1|2273942_2274851_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000988196.1|2274861_2275740_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_000203852.1|2275736_2277137_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_001065352.1|2277133_2277391_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_001202271.1|2277442_2278432_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001204809.1|2278450_2278831_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917741.1|2279046_2279244_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000483504.1|2279395_2280454_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	9.8e-206
WP_000649750.1|2280838_2281798_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	99.7	3.6e-175
WP_000738080.1|2281809_2282079_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000874522.1|2282589_2284536_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.4	0.0e+00
WP_000143458.1|2284671_2284851_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2284891_2285137_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2285214_2285430_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087707.1|2285434_2285968_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	96.6	6.2e-100
WP_001255337.1|2285964_2286432_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
WP_000735655.1|2286455_2286680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373407.1|2287098_2287575_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077608.1|2287571_2289695_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2289691_2289904_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974563.1|2289903_2291406_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_001365078.1|2291395_2293375_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|2293462_2293789_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|2293781_2294063_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974966.1|2294065_2294689_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2294701_2295100_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2295107_2295860_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479061.1|2295873_2296296_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_000532075.1|2296322_2296631_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000918262.1|2296674_2299320_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.0	0.0e+00
WP_000847308.1|2299316_2299646_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	9.6e-59
WP_001484085.1|2299645_2300344_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	6.8e-131
WP_001443526.1|2300349_2301093_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	3.6e-146
WP_072141513.1|2301038_2301671_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_174846738.1|2301917_2305409_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.4	0.0e+00
WP_001230382.1|2305479_2306079_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	8.2e-109
WP_174846739.1|2306143_2307457_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.0e-78
WP_025380479.1|2307458_2307728_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_122988840.1|2307839_2307917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993326.1|2308131_2309145_+	peptidase M85	NA	NA	NA	NA	NA
WP_001261931.1|2309516_2309765_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_000891621.1|2310082_2310649_-	hydrolase	NA	NA	NA	NA	NA
WP_001258685.1|2310959_2312732_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|2312849_2313302_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2313330_2314071_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2314105_2314627_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024953.1|2314628_2315231_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|2315301_2315367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2315505_2316117_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2316125_2317136_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|2317381_2318167_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2318163_2318919_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001417981.1|2318997_2319930_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2319945_2321268_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448391.1|2321387_2322359_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|2322489_2323932_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|2324059_2324929_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301727.1|2325266_2326742_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|2326976_2328788_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2328824_2329466_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173471.1|2329521_2330700_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2330833_2331124_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2331190_2331547_+	protein YebF	NA	NA	NA	NA	NA
WP_000024742.1|2331873_2332533_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936921.1|2332741_2334802_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|2334798_2335461_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011661.1|2335484_2336141_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2336242_2336473_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2336611_2336986_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2336989_2337862_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2337874_2338216_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|2338611_2339268_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_001296140.1|2339268_2339460_-	YebW family protein	NA	NA	NA	NA	NA
WP_001359800.1|2339564_2339801_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001302304.1|2339918_2341358_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001358625.1|2341438_2344072_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2344040_2345324_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2345453_2345951_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431368.1|2346047_2346746_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2346765_2348814_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2349005_2349887_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	2545144	2675175	5431628	protease,lysis,tRNA,integrase,transposase,tail,terminase,head,portal,capsid	Escherichia_phage(30.0%)	147	2563098:2563114	2681810:2681826
WP_001295400.1|2545144_2546419_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001359791.1|2546480_2547341_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2547384_2547990_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100942.1|2548095_2549598_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2550208_2550844_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2550843_2551539_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920789.1|2551542_2552163_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231928.1|2552166_2553225_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915704.1|2553225_2555544_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991814.1|2555536_2556115_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2556114_2556696_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001302052.1|2556772_2557213_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2557298_2557514_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|2557786_2557912_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282518.1|2558154_2559195_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567507.1|2559230_2560232_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459374.1|2560335_2561508_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125634.1|2561517_2563110_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
2563098:2563114	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_000179513.1|2563284_2564313_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|2564424_2565192_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|2565420_2566011_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000945916.1|2566401_2568213_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075838.1|2568209_2569583_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001043344.1|2570930_2572439_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170658.1|2572539_2573715_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066619.1|2573913_2575560_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099104.1|2575702_2577106_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001322334.1|2577102_2578032_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732491.1|2578107_2579409_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
WP_001092508.1|2579412_2580132_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2580260_2580596_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|2580592_2581315_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412375.1|2581351_2582734_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769309.1|2582919_2583864_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001358903.1|2584387_2585920_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2585930_2587319_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085279.1|2588425_2589655_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	7.1e-131
WP_000953272.1|2590021_2590210_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|2590267_2591011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032340239.1|2591036_2591237_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336139.1|2591226_2591451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551752.1|2591443_2592022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|2592262_2592562_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761840.1|2592558_2594313_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	5.4e-92
WP_001260556.1|2594601_2594859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126685.1|2594855_2595266_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|2595276_2595549_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|2595673_2595898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137344.1|2596190_2597348_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	1.1e-136
WP_000504049.1|2597387_2597960_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	9.4e-62
WP_000267604.1|2597961_2599173_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	9.6e-189
WP_001020668.1|2599169_2599508_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	5.6e-30
WP_000134113.1|2599504_2599801_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|2599800_2600241_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|2600224_2600407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2600530_2600887_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127888.1|2600870_2602532_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000133423.1|2602545_2602827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2604140_2604506_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2604492_2604822_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260837.1|2604860_2605682_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2605781_2605865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2605957_2606293_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2606689_2607943_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2608049_2608943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2609077_2610298_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2610422_2611118_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2611070_2612363_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148719.1|2612520_2613135_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2613177_2614032_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2614033_2614651_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072141521.1|2614661_2617085_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041706.1|2617145_2619572_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
WP_000778147.1|2619770_2620076_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2620183_2620894_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2620896_2621457_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2621491_2621833_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001358609.1|2621967_2622294_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001358608.1|2622499_2623714_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_000836042.1|2623725_2624745_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001360138.1|2624802_2624913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|2624932_2626213_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_000005552.1|2626247_2626499_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021535042.1|2626571_2629043_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2629135_2629327_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2629323_2629512_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|2629911_2630076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2630079_2630298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2630457_2630613_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2630779_2631187_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2631270_2631501_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|2631484_2632006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2631986_2632952_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2632992_2633415_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2633411_2633768_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|2635074_2635257_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2635434_2636748_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2637184_2637517_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2637719_2638025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2638049_2638289_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2638288_2638576_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2638647_2638803_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2639019_2639271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2639337_2639616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2639617_2640667_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2640680_2641433_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2641710_2641800_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2641854_2642067_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2642367_2642583_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2643336_2643552_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2643556_2643868_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2643864_2644398_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2644394_2644892_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2645254_2645467_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2645477_2645666_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2645668_2645734_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2645813_2645969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2646140_2646314_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2646465_2646876_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2646933_2647167_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453576.1|2647555_2648101_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027321.1|2648075_2650001_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|2649997_2650204_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001345555.1|2650200_2651802_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000123242.1|2651782_2653102_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001358225.1|2653111_2653444_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063254.1|2653499_2654525_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_000158875.1|2654566_2654962_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|2654973_2655327_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|2655338_2655917_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|2655913_2656309_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001317730.1|2656316_2657057_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479195.1|2657072_2657495_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	4.5e-61
WP_000459457.1|2657476_2657911_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840299.1|2657903_2660465_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.3	0.0e+00
WP_000847351.1|2660461_2660791_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.8e-57
WP_001152612.1|2660790_2661489_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_001484131.1|2661494_2662238_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_000090849.1|2662174_2662777_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	1.6e-88
WP_000515566.1|2662837_2666317_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_053292719.1|2666384_2666984_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	2.3e-103
WP_000290871.1|2667048_2669745_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	61.3	1.5e-80
WP_000885616.1|2669744_2670320_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2670417_2671008_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2671324_2671558_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2671626_2671740_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527772.1|2673714_2675175_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
2681810:2681826	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	2938880	3007457	5431628	protease,integrase,transposase,holin,tail,terminase,head,capsid	Stx2-converting_phage(30.61%)	76	2961013:2961026	3008110:3008123
WP_000422068.1|2938880_2939930_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559265.1|2940149_2940908_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278896.1|2940904_2941495_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2941534_2942407_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2942619_2944203_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2944230_2944851_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2944847_2945729_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2945866_2945911_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194629.1|2946002_2947565_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2947564_2949160_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2949160_2950522_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2950533_2951727_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443044.1|2951726_2952533_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2952913_2953093_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2953178_2953679_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079491.1|2953724_2954231_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000938104.1|2956690_2957260_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2957325_2958237_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2958343_2958466_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106423857.1|2960475_2960670_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|2960614_2961157_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
2961013:2961026	attL	TTAACCAGGATTCT	NA	NA	NA	NA
WP_001358682.1|2961377_2961560_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.3	9.1e-27
WP_174846740.1|2961648_2962809_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	98.2	2.8e-81
WP_029783341.1|2962873_2963512_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_085959019.1|2963530_2964743_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_174846741.1|2964825_2968302_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.4	0.0e+00
WP_077775224.1|2968542_2969172_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_001371725.1|2969117_2969861_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	8.6e-148
WP_115446892.1|2969871_2970570_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	4.4e-130
WP_000807954.1|2970569_2970911_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_174846742.1|2970903_2974170_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.6	0.0e+00
WP_138976860.1|2974221_2974431_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.6	7.4e-33
WP_001030057.1|2974526_2974901_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275469.1|2974906_2975623_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	8.6e-129
WP_000141141.1|2975689_2976034_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_000573390.1|2976030_2976477_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007889.1|2976473_2976824_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125971.1|2976834_2977161_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	98.1	4.5e-53
WP_001063105.1|2979687_2979909_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000173067.1|2979953_2981891_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.4	0.0e+00
WP_001417827.1|2981954_2983616_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_001359495.1|2983612_2984176_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	1.2e-85
WP_001358663.1|2984680_2985877_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_072141526.1|2985890_2986274_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	95.2	2.0e-63
WP_000074669.1|2986315_2986540_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2986621_2986936_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2987462_2987648_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|2987864_2988362_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|2988361_2988577_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023144.1|2989015_2990866_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000216644.1|2991180_2991348_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_001059384.1|2992384_2993074_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|2993070_2993436_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|2993436_2994492_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|2994493_2994772_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|2994841_2995102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2995320_2995533_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2995811_2996570_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2997268_2997433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|2997429_2998164_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157825328.1|2998197_2998740_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001369565.1|2998651_2999152_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.2	4.5e-84
WP_001359739.1|2999202_2999670_-	helix-turn-helix domain-containing protein	NA	Q3HQZ6	Burkholderia_phage	39.0	1.2e-14
WP_000705622.1|2999641_3000193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3000176_3000404_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3000480_3000888_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3001152_3001452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3001524_3001743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3001765_3002173_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3002150_3002384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3002377_3002545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3002942_3003131_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3003127_3003319_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_174846743.1|3003411_3005883_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.6e-57
WP_000113189.1|3005947_3006196_+	excisionase	NA	NA	NA	NA	NA
WP_000113678.1|3006173_3007457_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
3008110:3008123	attR	AGAATCCTGGTTAA	NA	NA	NA	NA
>prophage 9
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	3120798	3198156	5431628	tRNA,integrase,holin,tail,terminase,head,capsid	Escherichia_phage(27.59%)	92	3164233:3164248	3207880:3207895
WP_001301861.1|3120798_3121905_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3121940_3122582_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3122585_3123956_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3124124_3124796_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735413.1|3124795_3126256_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3126857_3127139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3127394_3127937_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224606.1|3128142_3128556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3128568_3128904_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3128916_3129972_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000796963.1|3129971_3130178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|3130429_3130654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|3130780_3131053_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|3131063_3131474_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|3131470_3131722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|3131922_3133323_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770178.1|3133319_3133619_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204985.1|3133624_3133858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|3133850_3134084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551679.1|3134076_3134316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|3134305_3134518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|3134510_3134708_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|3135512_3135701_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085256.1|3136065_3137295_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3137543_3138665_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3138713_3139940_-	peptidase T	NA	NA	NA	NA	NA
WP_000531595.1|3140189_3141326_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799400.1|3141309_3142173_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3142536_3143898_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3143958_3144234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3146542_3149944_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001484040.1|3150534_3152883_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3152902_3152992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|3153098_3153368_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_174846744.1|3153369_3154683_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001230309.1|3154747_3155347_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	3.0e-111
WP_174846741.1|3155413_3158890_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.4	0.0e+00
WP_077775224.1|3159130_3159760_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_100089178.1|3159705_3160443_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	99.6	1.2e-149
WP_000835327.1|3160496_3161375_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	76.8	7.1e-93
WP_000410309.1|3161638_3161791_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3161900_3162155_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001358317.1|3162171_3162870_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807954.1|3162869_3163211_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_174846745.1|3163203_3166446_-|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	96.8	0.0e+00
3164233:3164248	attL	CAGTTCACCCAGCGCT	NA	NA	NA	NA
WP_001453746.1|3166493_3166703_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3166798_3167173_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3167187_3167904_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3167969_3168314_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3168310_3168757_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3168753_3169104_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3169113_3169440_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_174846746.1|3171965_3172187_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	5.8e-36
WP_032284581.1|3172231_3174169_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001299337.1|3174232_3175894_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_000958416.1|3175890_3176454_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_032340339.1|3176742_3177108_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	2.9e-64
WP_001302977.1|3177149_3177335_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3177464_3177605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3177961_3178186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3178250_3178457_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3178684_3178831_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3178830_3179400_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3179670_3180204_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731259.1|3180254_3180599_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284518.1|3180603_3180819_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_174846747.1|3180968_3182822_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000941328.1|3183618_3183807_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	4.3e-24
WP_000917750.1|3183952_3184150_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3184391_3184922_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3184930_3185290_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001265076.1|3185302_3186352_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_032313142.1|3186353_3186632_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_000902687.1|3186799_3187012_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3187198_3187303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3187412_3187976_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001273106.1|3188102_3188414_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_050555107.1|3188410_3188563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3188595_3188952_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3188948_3189173_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3189194_3189893_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3189927_3190350_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262408.1|3190381_3191419_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000693816.1|3191487_3191913_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3191909_3192137_-	cell division protein	NA	NA	NA	NA	NA
WP_000444615.1|3192234_3192879_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3193154_3193307_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449192.1|3193797_3193986_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3193982_3194174_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_174846748.1|3194266_3196738_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	3.2e-58
WP_000003742.1|3196799_3197069_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3197037_3198156_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
3207880:3207895	attR	AGCGCTGGGTGAACTG	NA	NA	NA	NA
>prophage 10
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	3335081	3350868	5431628	transposase,protease	Stx2-converting_phage(25.0%)	10	NA	NA
WP_000555411.1|3335081_3336215_-|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_001034019.1|3337179_3341271_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	4.4e-310
WP_114077732.1|3341867_3343068_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	5.4e-160
WP_085949854.1|3343087_3343782_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.0	1.2e-130
WP_001529927.1|3344602_3345061_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	30.7	4.6e-11
WP_001423524.1|3345536_3345734_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	72.2	2.0e-16
WP_001420502.1|3347193_3347598_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	93.3	2.4e-64
WP_001440936.1|3347594_3347858_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.8	4.1e-44
WP_000035067.1|3348301_3348490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233440.1|3348507_3350868_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	6.9e-34
>prophage 11
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	3443128	3496229	5431628	protease,integrase,holin,tail,terminase,head,portal,capsid	Escherichia_phage(36.73%)	66	3445063:3445078	3497994:3498009
WP_000003653.1|3443128_3443716_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3443712_3444420_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3444438_3446232_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3445063:3445078	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001359719.1|3446228_3447347_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023432.1|3449763_3450033_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_174846749.1|3450034_3451348_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001216293.1|3451412_3452036_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_174846750.1|3452103_3455580_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_000649829.1|3455713_3456241_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_072280596.1|3456431_3457064_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_000194770.1|3457009_3457753_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.0e-146
WP_001152201.1|3457763_3458462_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	4.0e-131
WP_000847304.1|3458461_3458791_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_053893773.1|3458787_3461367_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.7	0.0e+00
WP_000533425.1|3461347_3461761_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|3461787_3462219_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_053893793.1|3462232_3462985_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000683079.1|3462992_3463388_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974994.1|3463384_3463960_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204534.1|3463975_3464329_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	4.3e-41
WP_000201501.1|3464321_3464705_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|3464756_3465785_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256824.1|3465842_3466190_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_001530579.1|3466226_3467732_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	1.2e-100
WP_001441018.1|3467721_3469314_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.7e-185
WP_000259010.1|3469310_3469517_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	2.3e-10
WP_137537931.1|3469500_3471429_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_024174699.1|3471400_3471907_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.5	1.6e-33
WP_001329960.1|3472341_3472527_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347012.1|3472663_3472801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000736383.1|3473157_3473382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|3473467_3473653_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_032340356.1|3473874_3473961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029793082.1|3474515_3475049_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	8.1e-100
WP_000731241.1|3475099_3475444_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024164617.1|3475448_3475664_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_174846751.1|3475948_3477799_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000024311.1|3478578_3479637_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.8	4.6e-187
WP_000917751.1|3479787_3479985_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000640035.1|3480210_3480765_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000140023.1|3480773_3481139_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_053893804.1|3481139_3482195_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.0	6.1e-91
WP_001417850.1|3482196_3482475_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001302544.1|3482415_3482601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902684.1|3482642_3482855_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	2.0e-25
WP_001278454.1|3483043_3483148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|3483263_3484133_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|3484143_3484407_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935428.1|3484658_3484871_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.1e-31
WP_000004319.1|3484983_3485244_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	51.2	3.0e-15
WP_001266144.1|3485236_3485536_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	9.6e-50
WP_001435489.1|3485532_3485925_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	53.2	1.4e-32
WP_072164687.1|3485954_3486497_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	3.4e-85
WP_000729526.1|3486408_3487428_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	95.3	4.7e-189
WP_000273724.1|3487506_3487962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693953.1|3488168_3488594_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3488590_3488806_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|3488855_3489572_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|3489844_3489997_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|3490008_3490383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3490914_3491103_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3491099_3491291_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_174846752.1|3491383_3493855_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	2.9e-59
WP_000273151.1|3493922_3494165_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001563016.1|3494142_3495162_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	3.7e-85
WP_000375136.1|3495569_3496229_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3497994:3498009	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	3727064	3772595	5431628	protease,lysis,integrase,holin,tail,terminase	Enterobacteria_phage(43.4%)	62	3726649:3726663	3772669:3772683
3726649:3726663	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3727064_3727763_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3727993_3728875_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3729043_3729205_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_122995187.1|3729701_3730721_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3730754_3731735_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|3731911_3732181_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_174846754.1|3732182_3733499_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	2.0e-70
WP_001233141.1|3733558_3734158_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090855.1|3737701_3738310_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000140753.1|3738246_3738990_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152341.1|3738995_3739694_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.7e-134
WP_000447253.1|3739703_3740033_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371991.1|3740032_3743098_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|3743069_3743399_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3743407_3743794_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3743854_3744598_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3744608_3745010_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3745006_3745585_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3745596_3745872_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3745864_3746188_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001072975.1|3749753_3749966_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934092.1|3749962_3752065_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.4	0.0e+00
WP_000349509.1|3752064_3752556_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3753230_3753383_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3753370_3753838_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075155.1|3753834_3754332_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	2.4e-90
WP_000284524.1|3754331_3754547_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3754689_3755088_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3755168_3755327_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3755412_3756156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3756341_3757031_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3757045_3757168_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3757505_3758465_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3758676_3759342_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3759338_3759959_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3759951_3760122_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3760118_3760301_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3760297_3760738_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145894.1|3760811_3761102_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788870.1|3761098_3761800_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	7.6e-130
WP_000185506.1|3761796_3762696_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000438491.1|3762728_3763028_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000067727.1|3763169_3763385_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096929327.1|3763460_3764156_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	98.7	1.2e-132
WP_000854876.1|3764328_3764625_+	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_000478871.1|3764636_3764921_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000088205.1|3765353_3765626_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000392420.1|3765910_3766360_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.9	2.5e-70
WP_000065351.1|3766555_3766924_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_001198861.1|3766996_3767161_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3767129_3767273_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|3767346_3767643_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|3767648_3768434_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|3768430_3769111_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3769107_3769290_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3769262_3769454_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3769464_3769746_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763358.1|3769844_3770066_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000120060.1|3770276_3770879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3771121_3771289_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3771328_3771547_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533651.1|3771524_3772595_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	8.7e-202
3772669:3772683	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	4348750	4403009	5431628	protease,lysis,integrase,holin,tail,terminase,head,portal,capsid	Enterobacteria_phage(38.71%)	66	4350095:4350140	4399108:4399153
WP_001130501.1|4348750_4349932_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	4.8e-145
4350095:4350140	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000950786.1|4352340_4353321_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001132164.1|4354320_4354911_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144082.1|4355093_4355720_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001117988.1|4356460_4357033_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001024023.1|4357144_4357414_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_000741872.1|4357415_4358732_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001233141.1|4358791_4359391_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090854.1|4362934_4363537_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	1.2e-88
WP_000140754.1|4363473_4364217_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152567.1|4364222_4364921_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	1.5e-130
WP_000847379.1|4364920_4365250_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_100089164.1|4365246_4367826_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.6	0.0e+00
WP_000459456.1|4367818_4368253_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479189.1|4368234_4368657_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_001419284.1|4368672_4369413_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.3	1.2e-128
WP_000683050.1|4369420_4369816_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_000155463.1|4369812_4370346_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.4	2.0e-61
WP_001204539.1|4370357_4370711_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000201530.1|4370703_4371078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|4371129_4372158_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000256821.1|4372215_4372563_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_100089185.1|4372599_4374105_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	5.1e-99
WP_174846757.1|4374094_4375687_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.2e-185
WP_000259002.1|4375683_4375890_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_174846758.1|4375873_4377802_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	6.7e-261
WP_000235440.1|4377773_4378283_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	7.2e-13
WP_013009113.1|4378684_4378909_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001302717.1|4378989_4379304_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072020783.1|4379830_4380013_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_000075132.1|4380229_4380727_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|4380726_4380942_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000026511.1|4381379_4383221_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_001419325.1|4383517_4383649_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000512794.1|4384150_4384669_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	6.5e-94
WP_001028867.1|4384659_4385331_-	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	95.0	1.1e-125
WP_001107957.1|4385327_4385933_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_000566862.1|4385925_4386096_-	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001254239.1|4386092_4386275_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000153282.1|4386271_4386799_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_141079606.1|4386795_4387236_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	7.7e-80
WP_000145894.1|4387309_4387600_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788868.1|4387596_4388298_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000185433.1|4388294_4389194_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000251069.1|4389226_4389520_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|4389639_4389855_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|4389958_4390591_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618044.1|4390587_4390992_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000281856.1|4391667_4392150_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213973.1|4392416_4392617_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_001198861.1|4392840_4393005_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|4392973_4393117_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|4393190_4393487_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|4393492_4394278_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|4394274_4394955_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|4394951_4395134_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|4395106_4395298_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|4395308_4395590_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763359.1|4395688_4395910_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_001289865.1|4395906_4396413_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000103020.1|4396409_4397174_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001281200.1|4397274_4397619_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000023577.1|4397932_4399093_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.5	7.2e-226
WP_000893281.1|4399297_4400551_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
4399108:4399153	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4400562_4401666_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4401953_4403009_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 14
NZ_CP039837	Escherichia coli O157:H7 strain USDA5905 chromosome, complete genome	5431628	4421885	4479537	5431628	transposase,plate,tRNA	uncultured_Caudovirales_phage(40.0%)	44	NA	NA
WP_000027428.1|4421885_4423058_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4423138_4423324_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4423238_4423502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145880.1|4423703_4425464_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4425466_4426603_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001419315.1|4427348_4427858_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339432.1|4427926_4429435_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_071529145.1|4429616_4430267_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509138.1|4430472_4434705_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103339.1|4434780_4436922_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.2e-26
WP_001142958.1|4437131_4437650_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4438346_4438847_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4438881_4439106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611742.1|4440638_4441052_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393848.1|4441055_4442906_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348798.1|4442869_4443952_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001080153.1|4445252_4445777_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246447.1|4445779_4447111_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343294.1|4447115_4447877_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614278.1|4447885_4450657_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	2.1e-82
WP_000088854.1|4450653_4451397_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4451401_4452814_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001303798.1|4452922_4456357_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4456367_4457777_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284959.1|4457742_4458222_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001413987.1|4458242_4458404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4458541_4459138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174671.1|4459140_4459590_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001086136.1|4460067_4460868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4461404_4462136_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4462200_4462668_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001307587.1|4462664_4463387_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052716.1|4463420_4464176_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4464247_4465606_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211697.1|4465653_4466424_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4466501_4467302_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4467542_4468457_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4468453_4469257_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4475015_4475591_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4475778_4476810_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4476802_4477456_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4477495_4478311_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4478428_4478833_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4478829_4479537_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP039843	Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1	95647	0	95574	95647	plate,holin,head,terminase,integrase,transposase,tail	Escherichia_phage(62.0%)	103	24707:24723	84835:84851
WP_174846762.1|0_1620_-|tail	tail fiber protein	tail	A0A1B0V7G4	Salmonella_phage	59.7	8.5e-124
WP_001286325.1|1631_2066_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_001189832.1|2144_2981_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_000047570.1|2980_4414_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	99.6	2.4e-271
WP_000002800.1|4410_4767_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440156.1|4766_8141_-	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	86.0	0.0e+00
WP_000926345.1|8222_9104_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523975.1|9118_9730_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	98.0	2.7e-107
WP_000188920.1|9740_10307_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_024174696.1|10461_11631_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000780957.1|11632_12139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346387.1|12227_12746_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.2	3.1e-19
WP_000245708.1|13146_13368_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	98.6	2.8e-38
WP_000743162.1|13364_14408_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	94.8	3.6e-176
WP_001187871.1|14572_15373_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_023154394.1|15402_16248_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	99.3	3.8e-152
WP_001484177.1|16298_16544_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	43.8	2.9e-12
WP_001313475.1|16725_16881_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000509939.1|16997_17507_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|17518_18100_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041761.1|18135_18951_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085144.1|18960_20550_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.8	4.3e-306
WP_000067710.1|20610_22317_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|22542_23544_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|23560_24757_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
24707:24723	attL	CATTCTGTTTGCTCTTT	NA	NA	NA	NA
WP_001076427.1|25314_26175_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000458377.1|26501_26903_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
WP_001281923.1|26973_27333_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
WP_000336811.1|27344_27485_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	97.8	3.1e-19
WP_000007769.1|27510_27933_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890207.1|27972_28761_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	97.7	2.6e-118
WP_001177862.1|29222_29507_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472527.1|29499_30405_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	7.7e-159
WP_000660970.1|30401_32420_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	96.6	0.0e+00
WP_000751808.1|34394_35222_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001276603.1|35611_36976_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_001198666.1|36975_37974_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.1	2.1e-194
WP_000535202.1|38020_38653_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_000212018.1|38645_39662_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000602718.1|39663_40449_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.2	1.0e-143
WP_000896795.1|40435_41164_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	99.6	1.2e-138
WP_001141898.1|41167_42385_-	hypothetical protein	NA	Q71T88	Escherichia_phage	99.8	2.1e-223
WP_000235786.1|42394_42772_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|42918_43164_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943608.1|43166_43745_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.0	1.7e-106
WP_000096174.1|43811_43967_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|44468_45095_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_024174695.1|45091_45769_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	99.1	2.4e-133
WP_000684870.1|45765_46467_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.1	1.7e-142
WP_000633036.1|46768_48031_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	1.2e-234
WP_000021766.1|48103_48610_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_000675639.1|48804_49533_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	4.9e-140
WP_024174694.1|49536_50415_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	95.2	6.5e-171
WP_000158002.1|50411_50615_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
WP_000476205.1|50607_50847_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	91.1	4.1e-35
WP_000071058.1|50843_51488_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.6	1.4e-130
WP_000154832.1|51484_52183_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.0	7.0e-51
WP_001018057.1|52179_52470_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000672529.1|52466_53180_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	73.7	4.8e-39
WP_000215167.1|53176_53476_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
WP_000161573.1|53477_54164_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	57.2	5.4e-56
WP_001151811.1|54165_54315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208041.1|54318_55335_+	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	95.8	3.0e-127
WP_001142394.1|55318_55603_+	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_001344848.1|55587_55797_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001283837.1|55970_56222_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
WP_000506726.1|56345_56735_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|56807_57029_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216047.1|57028_57409_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.5e-63
WP_000113019.1|57413_57593_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000644103.1|57620_58664_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.8	4.3e-206
WP_001312282.1|58752_59205_+	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_000219604.1|59291_60485_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	100.0	5.7e-210
WP_000124156.1|60484_61969_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.6	3.7e-291
WP_000611656.1|61993_62845_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|62955_63165_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542332.1|63769_63991_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_000067529.1|63998_65030_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.4	1.9e-193
WP_001224241.1|65080_65392_+	hypothetical protein	NA	Q71TG4	Escherichia_phage	99.0	2.7e-47
WP_000848368.1|65639_66200_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	97.8	3.2e-99
WP_001376241.1|66387_67029_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
WP_001143775.1|67178_70184_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|70345_70903_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|71085_71946_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_050555098.1|72077_73343_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.4	3.3e-06
WP_000747846.1|73384_73633_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|73629_74070_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_001038173.1|74103_80871_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_000774697.1|80947_82657_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_000132937.1|82649_83669_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001345478.1|83960_84518_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068869.1|84687_85176_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	91.4	3.3e-79
84835:84851	attR	AAAGAGCAAACAGAATG	NA	NA	NA	NA
WP_000126782.1|85378_86167_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	1.0e-143
WP_000610387.1|86159_87254_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.3	5.7e-39
WP_001165933.1|87285_87597_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_000058813.1|87586_90574_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.7	0.0e+00
WP_000175491.1|90586_90952_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_000434689.1|90948_92868_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
WP_001345482.1|92869_93472_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|93458_93902_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|93898_94228_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|94302_94566_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_001165547.1|95001_95574_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
>prophage 1
NZ_CP039842	Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_2, complete sequence	62787	32265	42505	62787	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_000124031.1|32265_35244_+|transposase	Tn3-like element TnEc1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	2.4e-297
WP_000839179.1|35321_35726_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612624.1|35722_36070_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_000099186.1|36118_37657_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	8.2e-294
WP_072141484.1|37738_38179_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	52.5	1.2e-24
WP_001025657.1|41179_42505_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.4	3.8e-223
