The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	1229744	1243181	5507715	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1229744_1230356_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230352_1231018_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231014_1231638_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231890_1232634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232719_1232887_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1233294_1235148_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235297_1235513_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235517_1235862_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236218_1236599_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236595_1236943_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237560_1237830_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1237990_1238413_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238542_1239601_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239679_1240330_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240512_1241103_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241604_1241853_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242698_1243181_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	1520759	1526185	5507715	integrase	Enterobacteria_phage(50.0%)	6	1509747:1509763	1528381:1528397
1509747:1509763	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1520759_1521329_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521328_1521796_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1521782_1522463_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522472_1523609_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1523783_1524941_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525252_1526185_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528381:1528397	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	1770294	1874418	5507715	tail,portal,protease,holin,transposase,tRNA,integrase,terminase,capsid,head	Enterobacteria_phage(46.91%)	118	1855875:1855934	1871722:1871791
WP_000569336.1|1770294_1771221_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1771225_1771957_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1771937_1772045_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1772104_1772806_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1772826_1774113_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1774146_1774401_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1774419_1774554_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1774557_1774800_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1774887_1775250_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1775246_1775603_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1775936_1776113_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1776114_1777062_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1777058_1777280_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1777378_1777660_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1777670_1777862_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1777834_1778017_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_174845211.1|1778016_1778694_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.6	1.3e-131
WP_000100847.1|1778690_1779476_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1779481_1779778_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1779853_1780144_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1780647_1782255_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1782361_1783054_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182877.1|1783417_1783957_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147238.1|1783953_1784973_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_000788902.1|1784969_1785671_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000152742.1|1785875_1786223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|1786610_1787824_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_001415151.1|1788288_1788897_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|1789196_1789613_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|1789591_1789993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|1790116_1790218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|1790214_1790670_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|1790669_1790840_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|1790832_1791123_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|1791119_1791482_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1791478_1791619_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1791704_1792139_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1792387_1792540_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142933.1|1793343_1795290_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143458.1|1795426_1795606_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1795646_1795892_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1795969_1796185_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1796189_1796723_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1796993_1797563_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1797562_1797709_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1797936_1798122_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1798634_1799111_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_054484186.1|1799107_1801231_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102414.1|1801227_1801440_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_021500194.1|1801439_1802942_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.8	1.2e-289
WP_001114424.1|1802886_1804911_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1804998_1805325_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1805317_1805599_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1805601_1806225_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_021500195.1|1806237_1806636_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	3.8e-70
WP_000235090.1|1806643_1807396_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|1807409_1807832_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000533450.1|1807858_1808167_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_174845212.1|1808210_1810856_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|1810852_1811182_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1811181_1811880_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1811890_1812634_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1812579_1813209_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_072608496.1|1813449_1816923_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001228289.1|1816990_1817590_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268980.1|1817654_1818968_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001023455.1|1818969_1819239_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001261937.1|1819606_1819855_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1820369_1822055_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1822051_1822771_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1822817_1823288_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1823329_1823791_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021500269.1|1823915_1825919_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1825915_1827052_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1827044_1827776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1827794_1829324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1829334_1830423_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1831663_1831981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1832042_1835672_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1842629_1844663_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1844794_1845904_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1846165_1846447_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1846738_1847281_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1847368_1848043_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1848058_1850539_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1850549_1851584_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1851665_1852004_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1852221_1853073_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1853193_1853466_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1853575_1853890_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1853899_1854247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1855297_1855537_-	hypothetical protein	NA	NA	NA	NA	NA
1855875:1855934	attL	TTGTTTGTTATTGTTCGTCGTTGTTCGTAGAGCTTCAACGAAATGTGTGGTCAGTTGTGT	NA	NA	NA	NA
WP_021500177.1|1855977_1857198_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.0	1.5e-133
WP_000775337.1|1857194_1857968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|1858059_1858284_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_107127644.1|1858294_1859341_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|1859333_1859519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748511.1|1859518_1859710_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	3.8e-07
WP_032253774.1|1859699_1859942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748509.1|1859947_1860247_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021500345.1|1860243_1862376_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	3.4e-173
WP_024165893.1|1862748_1863000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294169.1|1862996_1863302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|1863311_1863722_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024165864.1|1863734_1864007_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021500171.1|1864294_1865452_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	65.1	5.6e-138
WP_000987369.1|1865506_1866064_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	3.5e-61
WP_000267609.1|1866065_1867277_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	5.6e-189
WP_001020665.1|1867273_1867612_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	6.6e-31
WP_000134113.1|1867608_1867905_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|1867904_1868345_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174067.1|1868328_1868511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021500172.1|1868633_1868990_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_021500173.1|1868973_1870635_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	3.2e-275
WP_021500174.1|1870649_1870931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1871949_1872738_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
1871722:1871791	attR	TTGTTTGTTATTGTTCGTCGTTGTTCGTAGAGCTTCAACGAAATGTGTGGTCAGTTGTGTGGTCAGTTTT	NA	NA	NA	NA
WP_000822268.1|1872734_1873535_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1873599_1874418_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
>prophage 4
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	1886367	1923341	5507715	tail,portal,plate,head,holin,capsid,integrase,terminase,lysis,tRNA	Escherichia_phage(54.17%)	50	1888148:1888175	1919015:1919042
WP_000807362.1|1886367_1887267_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1887672_1887990_+	hypothetical protein	NA	NA	NA	NA	NA
1888148:1888175	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985262.1|1888254_1889268_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
WP_001306384.1|1889383_1889683_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1889797_1890073_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005164.1|1890083_1890254_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.8e-24
WP_001475191.1|1890250_1890751_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	6.5e-91
WP_000557703.1|1890814_1891039_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_021500267.1|1891038_1891338_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	1.9e-45
WP_001113269.1|1891340_1891565_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_000027664.1|1891561_1891837_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_021500266.1|1891826_1894124_+	replication endonuclease	NA	M1SV59	Escherichia_phage	97.3	0.0e+00
WP_000825551.1|1894199_1894745_-	cytolethal distending toxin type V subunit CdtC	NA	M1SNM4	Escherichia_phage	99.4	4.1e-99
WP_000759934.1|1894759_1895569_-	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_001284793.1|1895565_1896342_-	cytolethal distending toxin type V subunit CdtA	NA	G1BEM3	Escherichia_phage	100.0	7.9e-136
WP_000038190.1|1897120_1898155_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.4e-201
WP_000156847.1|1898154_1899927_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_021500264.1|1900100_1900955_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_021500263.1|1901013_1902087_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.4	3.3e-201
WP_024165882.1|1902090_1902834_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	7.3e-123
WP_000988633.1|1902933_1903443_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1903442_1903646_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|1903649_1903931_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144096.1|1903930_1904428_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	5.3e-93
WP_021500261.1|1904442_1904868_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.7	2.5e-59
WP_021500260.1|1904855_1905281_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_072178672.1|1905252_1905426_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.0e-23
WP_000917186.1|1905388_1905856_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_021500258.1|1905848_1906301_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.8e-76
WP_001093753.1|1906367_1907003_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	96.7	7.9e-110
WP_000127164.1|1906999_1907347_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121463.1|1907351_1908260_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	5.7e-162
WP_021500257.1|1908252_1908864_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	8.4e-117
WP_021500256.1|1908860_1910180_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.3	2.1e-181
WP_000367937.1|1910179_1910782_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.6e-99
WP_054484219.1|1910753_1911197_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	96.6	2.7e-80
WP_072608494.1|1911217_1911628_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	7.7e-66
WP_021500253.1|1911658_1912252_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	3.6e-104
WP_021500252.1|1912311_1913502_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|1913514_1914033_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_016235448.1|1914089_1914365_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
WP_000785970.1|1914397_1914517_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021500251.1|1914509_1916957_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	92.6	0.0e+00
WP_000978879.1|1916971_1917451_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	99.4	5.6e-84
WP_021500250.1|1917450_1918614_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|1918695_1918914_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1919186_1920548_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1919015:1919042	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1920695_1921028_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1921218_1921941_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1921937_1923341_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	2006565	2082514	5507715	tail,portal,protease,holin,transposase,integrase,capsid,lysis,terminase,head	Stx2-converting_phage(41.46%)	96	1997516:1997530	2012934:2012948
1997516:1997530	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_021500246.1|2006565_2007744_+|integrase	site-specific integrase	integrase	B6ET93	Enterobacteria_phage	100.0	1.1e-232
WP_000132739.1|2007724_2007916_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2007993_2008338_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2008525_2008876_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2009737_2010685_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2010681_2010903_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2011001_2011283_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548544.1|2011293_2011485_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|2011457_2011640_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|2011636_2012317_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|2012313_2013099_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2012934:2012948	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2013104_2013401_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2013475_2013619_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2013587_2013752_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2013824_2014193_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2014375_2014627_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2014685_2014958_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2014935_2015118_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2015686_2016208_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2016709_2017405_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2017481_2017697_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2017838_2018135_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2018167_2018329_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2018315_2019137_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2019133_2020510_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2020580_2020859_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2020991_2021207_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2021217_2021454_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2021410_2021857_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2021853_2022381_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2022377_2022560_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_174845214.1|2022834_2023590_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_162829202.1|2023629_2024843_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000849633.1|2025161_2025842_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2025916_2026639_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2026638_2027244_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2027240_2027912_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2027902_2028391_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2029040_2030000_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_162829202.1|2030167_2031381_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_009643165.1|2031447_2031594_+	Shiga-like toxin beta subunit	NA	Q5TJL5	Enterobacteria_phage	97.9	2.9e-20
WP_001303568.1|2031890_2032214_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143458.1|2034531_2034711_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2034751_2035024_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2035100_2035316_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2035315_2035813_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2035809_2036247_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2036449_2036947_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2036943_2037201_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|2037663_2037891_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2037932_2038298_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|2038590_2039154_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2039150_2040812_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2040875_2042813_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2042857_2043079_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2043024_2045604_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125988.1|2045606_2045933_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2045942_2046293_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2046289_2046736_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2046732_2047077_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2047142_2047859_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2047873_2048248_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2048343_2048553_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212829.1|2048600_2051843_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	100.0	0.0e+00
WP_000807954.1|2051835_2052177_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2052176_2052875_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2052891_2053212_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2053319_2053493_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2053563_2054487_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|2054540_2055278_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_115445438.1|2055223_2055856_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_072608489.1|2056115_2059610_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.6	0.0e+00
WP_001230550.1|2059680_2060280_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268885.1|2060344_2061658_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6ETG6	Enterobacteria_phage	100.0	2.6e-78
WP_001023452.1|2061659_2061929_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2062069_2062945_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_021500197.1|2063169_2063820_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	100.0	6.4e-123
WP_001303036.1|2065143_2066310_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2066428_2066902_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2067100_2068159_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2068330_2068660_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2068760_2068943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2069431_2069545_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2069557_2069752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2070210_2070579_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2070652_2070874_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2070936_2071413_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2071427_2071907_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2071988_2072810_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2073030_2073441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2073456_2074140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102658.1|2074275_2075346_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2075342_2076248_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|2076244_2077099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021500238.1|2077380_2079528_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2080975_2082514_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 6
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	2106899	2148189	5507715	tail,portal,holin,head,transposase,integrase,terminase,capsid	Escherichia_phage(37.21%)	53	2087170:2087184	2111024:2111038
2087170:2087184	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2106899_2107922_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2107921_2108125_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2108183_2110655_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2110750_2110939_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2110935_2111124_-	cell division inhibitor	NA	NA	NA	NA	NA
2111024:2111038	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2111604_2111757_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2112031_2112676_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2112773_2113001_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2112997_2113423_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2113491_2114529_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2114440_2114983_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2115017_2115716_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2115737_2115962_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2115958_2116315_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2116347_2116500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2116496_2116808_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2116934_2117498_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2117607_2117712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2117898_2118111_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2118278_2118557_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2118558_2119608_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2119620_2119980_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2119976_2120666_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2121299_2121728_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2122205_2124056_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2124137_2125351_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2125661_2125877_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2125881_2126226_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2126276_2126810_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2126965_2127148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2127160_2127292_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2127519_2127705_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2128231_2128546_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2128627_2128852_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2129246_2129756_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2131640_2131847_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2131843_2133436_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2133425_2134931_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2134967_2135315_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2135372_2135639_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2135620_2136361_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2136374_2136806_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2136832_2137246_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_174845215.1|2137226_2139806_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.3	0.0e+00
WP_000847298.1|2139802_2140132_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_107164806.1|2140131_2140830_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	5.8e-130
WP_174845216.1|2140835_2141579_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	2.3e-145
WP_143189873.1|2141524_2142154_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	94.3	1.5e-100
WP_001413764.1|2142394_2143570_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_174845239.1|2143521_2145873_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_072608461.1|2145940_2146540_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.0e-110
WP_072608474.1|2146604_2147918_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	5.3e-76
WP_001023407.1|2147919_2148189_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 7
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	2205707	2225690	5507715	tail,transposase,integrase	Enterobacteria_phage(75.0%)	28	2218826:2218839	2228832:2228845
WP_032161728.1|2205707_2206841_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2206791_2207115_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2207272_2208457_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2208456_2208969_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2209023_2209389_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2209397_2209553_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2212355_2212844_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2213000_2213573_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2213616_2214147_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2215238_2215553_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2215557_2216517_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2216593_2219416_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2218826:2218839	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2219422_2219788_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2219784_2220402_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2220413_2220713_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2220709_2220976_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2220972_2221176_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2221199_2221616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2221708_2221822_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2221818_2222061_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2222072_2222351_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2222361_2222712_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2222733_2222937_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2223008_2223146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2223235_2223640_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2223655_2224306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2224335_2224683_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2224688_2225690_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2228832:2228845	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	2546236	2661169	5507715	tail,portal,protease,holin,head,capsid,transposase,terminase	Escherichia_phage(29.09%)	138	NA	NA
WP_001260835.1|2546236_2547058_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2547157_2547241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2547333_2547669_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2548065_2549319_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2549425_2550319_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2550453_2551674_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2551798_2552494_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2552446_2553739_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2553896_2554511_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2554553_2555408_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2555409_2556027_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2556037_2558461_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2558521_2560948_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2561146_2561452_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2561559_2562270_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2562272_2562833_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2562867_2563209_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2563343_2563670_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2564658_2564910_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2564982_2567454_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2567546_2567738_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2567734_2567923_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2568323_2568488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2568491_2568710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2568781_2569081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2569433_2569712_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2569713_2569905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2569925_2570297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2570394_2570697_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000095669.1|2571140_2572103_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2572109_2572850_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2573660_2574056_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2574112_2574697_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2574812_2574917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2575105_2575318_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2575485_2575764_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2575765_2576815_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2576827_2577187_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2577183_2577873_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2578508_2578937_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2579415_2581266_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2581705_2581921_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2581925_2582270_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2582320_2582854_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2583124_2583694_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2583693_2583840_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2584067_2584253_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2584677_2584905_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2584946_2585312_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2585601_2586165_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2586161_2587823_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2587886_2589824_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2589868_2590090_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2590035_2592537_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2592616_2592943_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2592952_2593303_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2593299_2593746_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2593742_2594087_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2594145_2594862_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2594867_2595242_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2595337_2595547_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_072612737.1|2595599_2598680_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_000807954.1|2598672_2599014_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2599013_2599451_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_001230508.1|2603199_2603799_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2603863_2605087_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023420.1|2605088_2605358_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_001131642.1|2605471_2606047_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2606757_2607408_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2607990_2609529_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2609578_2609926_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2609922_2610303_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_162829202.1|2611502_2612715_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_009642003.1|2612893_2614138_-	exodeoxyribonuclease 8	NA	H6WRX1	Salmonella_phage	50.4	3.7e-87
WP_000199475.1|2614230_2614419_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2614415_2614604_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2615168_2615378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2615378_2616017_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2616028_2616181_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2616473_2616812_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2617203_2617446_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2617429_2617855_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2617923_2618967_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2618959_2619421_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2619454_2620171_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2620203_2620485_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2620481_2620709_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2620701_2621013_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2621140_2621359_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2621360_2621918_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2622145_2622358_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2622477_2622822_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2622943_2623216_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2623217_2624267_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2624279_2624585_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2624647_2625202_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2625426_2625624_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2625759_2626473_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2626923_2627355_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2627832_2629683_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2630121_2630337_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2630341_2630686_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992148.1|2630736_2631270_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2631541_2632111_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2632110_2632257_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2632479_2632665_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2633190_2633505_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2633586_2633811_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2634197_2634743_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027223.1|2634717_2636643_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2636639_2636846_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2636842_2638444_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2638424_2639744_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2639753_2640086_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2640141_2641167_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2641208_2641607_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2641618_2641972_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2641986_2642520_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2642516_2642912_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_044781954.1|2642919_2643672_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	6.4e-135
WP_000479045.1|2643685_2644108_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|2644134_2644548_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_174845218.1|2644528_2647141_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.7	0.0e+00
WP_000847298.1|2647137_2647467_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2647466_2648165_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_072608458.1|2648175_2648919_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	4.5e-149
WP_143189870.1|2648864_2649497_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	2.2e-104
WP_174845219.1|2649743_2650919_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.7	3.7e-230
WP_174845239.1|2650870_2653222_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_072608461.1|2653289_2653889_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.0e-110
WP_000268860.1|2653953_2655177_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023407.1|2655178_2655448_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2655561_2656137_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2656209_2656839_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2656920_2657562_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2657723_2657966_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2659469_2660930_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2660965_2661169_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	2843088	2902080	5507715	tail,holin,head,capsid,transposase,terminase,tRNA	Escherichia_phage(40.68%)	68	NA	NA
WP_001295593.1|2843088_2843523_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2844463_2845105_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2845186_2845816_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_033814039.1|2845888_2846464_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	4.1e-89
WP_001023994.1|2846576_2846846_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	1.9e-44
WP_109090116.1|2846847_2848161_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_021500147.1|2848225_2848849_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	5.6e-68
WP_174845220.1|2848917_2852394_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.8	0.0e+00
WP_122995720.1|2852629_2853262_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	3.8e-96
WP_045904127.1|2853207_2853951_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	3.6e-146
WP_001357740.1|2853956_2854655_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|2854654_2854996_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_174845221.1|2854988_2858231_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.7	0.0e+00
WP_001453698.1|2858282_2858492_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2858587_2858962_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_086163922.1|2858967_2859684_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.1	1.5e-125
WP_000133393.1|2859752_2860097_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2860093_2860540_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2860536_2860887_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2860896_2861223_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2863749_2863971_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2864015_2865953_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2866016_2867678_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958420.1|2867674_2868238_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	1.8e-89
WP_025380422.1|2868526_2868892_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_001448509.1|2868933_2869158_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2869239_2869554_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2870079_2870265_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|2870492_2870642_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056883.1|2870641_2871211_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|2871485_2872019_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|2872023_2872239_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2872316_2872562_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2872602_2872782_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|2872917_2874855_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2875332_2875764_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2876325_2876880_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2876876_2877167_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2877166_2877766_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2878265_2879657_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|2879656_2880646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2880613_2881765_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2882196_2882442_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2882520_2882682_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2882692_2882956_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2883207_2883420_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2883525_2883948_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2883963_2884725_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2884747_2885494_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2885500_2886289_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2886366_2886789_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2886785_2887040_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2887119_2887539_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2887781_2887961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373334.1|2888221_2888668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2889371_2889560_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2889556_2889748_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_162829202.1|2890095_2891309_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000166313.1|2893850_2894660_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2894715_2894865_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2894902_2895091_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2895190_2895406_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2895407_2896643_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2896694_2897630_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2897758_2899132_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2899164_2899335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2899609_2900593_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2900847_2902080_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 10
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	2985713	3061246	5507715	tail,portal,protease,head,transposase,capsid,holin,terminase,integrase	Stx2-converting_phage(35.09%)	85	3001215:3001242	3061383:3061410
WP_000422055.1|2985713_2986763_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2986982_2987741_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2987737_2988328_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2988367_2989240_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2989452_2991036_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2991063_2991684_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2991680_2992562_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2992699_2992744_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2992835_2994398_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2994397_2995993_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2995993_2997355_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2997366_2998560_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2998559_2999366_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2999746_2999926_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3000011_3000512_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3000557_3001064_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3001215:3001242	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|3002377_3003028_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3004534_3005125_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3005308_3005956_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3006092_3006239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3006666_3006945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3007284_3007665_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3007661_3008009_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_174845222.1|3008058_3009597_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	7.6e-300
WP_000938103.1|3010562_3011132_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3011197_3012109_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3012215_3012338_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3013935_3015261_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3016287_3016557_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3016558_3017872_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3018023_3018623_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3018690_3021036_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3020987_3022163_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3022505_3023138_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3023083_3023827_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|3023837_3024536_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|3024535_3024877_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212922.1|3024869_3028112_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_001453698.1|3028164_3028374_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3028469_3028844_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|3028849_3029566_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|3029624_3029969_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3029965_3030412_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3030408_3030759_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3030768_3031095_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3031174_3033676_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3033621_3033843_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3033887_3035825_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3035888_3037550_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958360.1|3037546_3038110_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_000279786.1|3038399_3038765_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3038806_3039034_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3039458_3039644_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3039871_3040018_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3040017_3040587_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3040857_3041391_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3041441_3041786_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3041790_3042006_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3042155_3044009_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3044805_3045864_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3046014_3046212_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3046453_3046984_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_174845223.1|3046992_3047352_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	2.3e-34
WP_174845224.1|3047364_3048414_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	5.5e-108
WP_010917803.1|3048415_3048694_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3048763_3049021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3049241_3049454_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3049732_3050491_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3051189_3051354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3051350_3051932_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3052118_3052661_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3052572_3053613_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3053584_3054136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3054119_3054347_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3054423_3054831_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3055094_3055394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3055466_3055685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3055707_3056115_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3056092_3056326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3056319_3056487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3056884_3057073_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3057069_3057261_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_072608456.1|3057353_3059825_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3059889_3060138_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3060115_3061246_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3061383:3061410	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 11
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	3107942	3212435	5507715	tail,portal,protease,head,transposase,tRNA,capsid,terminase,lysis,holin,integrase	Enterobacteria_phage(44.44%)	109	3140620:3140635	3206338:3206353
WP_001299679.1|3107942_3109199_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3109412_3110036_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3110035_3110887_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3111037_3111985_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3112109_3113789_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3113843_3114122_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3114399_3114984_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3115100_3116192_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3119013_3120084_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3120094_3120727_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3120737_3122156_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3124187_3124388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3124495_3125518_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3125517_3126498_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3126494_3127253_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3128071_3128926_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3128951_3130922_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3130971_3131226_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020151.1|3131426_3132158_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|3132159_3132771_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3132870_3133785_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3133880_3135617_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3135774_3136988_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3137325_3138396_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3138405_3139704_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3140033_3141566_+	SpoVR family protein	NA	NA	NA	NA	NA
3140620:3140635	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3141617_3142337_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3142558_3144100_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3144245_3144776_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3144821_3146090_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3146089_3146509_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3146881_3147793_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3147999_3148461_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3148537_3149197_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3149268_3149562_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3149573_3149732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3149802_3150204_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3150306_3150675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3151194_3151890_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3151913_3152726_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3152729_3152996_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3154161_3155375_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3155548_3156133_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3156631_3157585_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3157771_3159256_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3159558_3161097_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3161146_3161494_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3161490_3161871_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3161946_3162195_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3162251_3162920_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3163417_3163600_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3163678_3164179_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3164215_3164722_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3164740_3165631_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3165750_3166332_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000268883.1|3166331_3169247_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3169311_3169911_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3169977_3173376_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3173436_3174069_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3174005_3174749_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3174754_3175453_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3175452_3175782_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_174845225.1|3175778_3178328_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000459457.1|3178320_3178755_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3178736_3179159_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3179174_3179915_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3179922_3180318_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3180314_3180893_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3180904_3181258_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3181269_3181668_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3181709_3182735_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3182790_3183123_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3183132_3184452_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3184432_3186034_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3186030_3186237_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3186233_3188159_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3188133_3188679_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3189067_3189262_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3189426_3189633_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3189918_3190329_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3190620_3190914_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3191004_3191187_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000544528.1|3191865_3192171_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_021500141.1|3192492_3193182_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	48.5	6.5e-57
WP_000971093.1|3193178_3193319_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3193315_3193678_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3193674_3193965_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3193957_3194128_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3194127_3194583_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3195084_3196611_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3196668_3196791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3196855_3197188_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3197255_3197558_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3197554_3198256_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3199180_3199417_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3199406_3200549_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3200662_3201913_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3202084_3202738_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3202747_3203209_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3203262_3204369_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3204404_3205046_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3205049_3206420_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3206338:3206353	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3206588_3207260_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3207259_3208720_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3209320_3209602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3209857_3210400_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3210605_3211019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3211031_3211367_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3211379_3212435_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 12
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	3218527	3275874	5507715	tail,portal,head,holin,capsid,integrase,terminase	Enterobacteria_phage(26.79%)	71	3261441:3261461	3282531:3282551
WP_000085256.1|3218527_3219757_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3220005_3221127_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3221175_3222402_-	peptidase T	NA	NA	NA	NA	NA
WP_021500167.1|3222651_3223788_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3223771_3224635_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3224998_3226360_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3226420_3226696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3229004_3232406_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3232996_3235345_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3235364_3235454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3235466_3235703_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3235648_3236386_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3236439_3237318_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3237620_3237731_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3237840_3238095_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3238111_3238810_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|3238809_3239151_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212829.1|3239143_3242386_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	100.0	0.0e+00
WP_001453746.1|3242433_3242643_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3242738_3243113_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3243127_3243844_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3243909_3244254_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3244250_3244697_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3244693_3245044_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3245053_3245380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|3245382_3247962_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3247907_3248129_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3248173_3250111_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3250174_3251836_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3251832_3252396_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3252685_3253051_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3253092_3253278_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3253407_3253548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3253904_3254129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3254193_3254400_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3254627_3254774_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3254773_3255343_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3255613_3256147_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3256197_3256542_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3256546_3256762_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3256837_3257107_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3257144_3257327_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3257474_3259412_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3259726_3259894_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3260490_3261312_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3261308_3261683_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3261441:3261461	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3261695_3262745_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3262746_3263025_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3263192_3263405_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3263593_3263698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3263813_3264401_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3264403_3264595_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3264596_3265034_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3265020_3265338_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3265291_3265609_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3265598_3265901_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3265897_3266179_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3266211_3266928_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3266961_3267504_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3267415_3268453_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3268521_3268947_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3268930_3269254_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3269378_3269855_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3270170_3270323_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3270437_3270953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3271085_3271475_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3271536_3271806_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3271774_3272893_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3273059_3273854_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3273850_3274897_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3275052_3275874_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3282531:3282551	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 13
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	3526788	3582033	5507715	tail,portal,protease,head,transposase,capsid,holin,terminase,integrase	Escherichia_phage(25.58%)	62	3528723:3528738	3583798:3583813
WP_000003653.1|3526788_3527376_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3527372_3528080_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3528098_3529892_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3528723:3528738	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3529888_3531007_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3533139_3533409_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3533410_3534724_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_174845228.1|3534788_3535388_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_000515110.1|3535454_3538928_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3539061_3539589_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3539779_3540412_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3540357_3541101_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3541111_3541810_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3541809_3542139_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_010904726.1|3542135_3542900_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_000533402.1|3544693_3545107_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3545133_3545565_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3545578_3546319_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3546300_3546567_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3546624_3546972_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3547008_3548514_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3548503_3550096_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3550092_3550299_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3550282_3552211_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3552474_3554013_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3554062_3554410_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3554406_3554787_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_070081091.1|3554862_3555138_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3555888_3556095_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3556350_3556623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3556782_3557316_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3557536_3557650_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3557871_3558057_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3558584_3558899_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3560255_3562106_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3562873_3563587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3564207_3565026_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3565177_3565549_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3565538_3565910_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3565922_3566972_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3566973_3567252_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3567419_3567575_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3567676_3567814_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3568179_3568953_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3569304_3569718_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3569733_3570504_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3570525_3571272_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3571278_3572370_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3572448_3572904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3573110_3573536_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3573519_3573792_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3573900_3574302_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3574329_3574521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3574520_3574808_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3575085_3575241_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3575382_3575772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3575958_3576144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3576717_3576906_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3576902_3577094_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3577187_3579659_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3579726_3579969_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3579946_3580966_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3581373_3582033_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3583798:3583813	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 14
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	3822484	3860581	5507715	tail,portal,protease,holin,integrase,lysis,terminase	Enterobacteria_phage(51.16%)	50	3822069:3822083	3860655:3860669
3822069:3822083	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3822484_3823183_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3823413_3824295_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3824464_3824626_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3825122_3826142_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3826175_3827156_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3827332_3827602_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3827603_3828920_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3828979_3829579_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3829649_3833063_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3833123_3833732_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3833668_3834412_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3834417_3835116_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3835125_3835455_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3835454_3838520_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3838491_3838821_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3838829_3839216_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3839276_3840020_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3840030_3840432_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3840428_3841007_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3841018_3841294_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3841286_3841610_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3841696_3843724_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3843668_3844004_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3844125_3845250_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3845177_3845390_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3845386_3847489_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3847488_3847980_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3848654_3848807_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3848794_3849262_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3849258_3849756_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3849755_3849971_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3850113_3850512_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3850592_3850751_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3850836_3851580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3851763_3852453_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3852467_3852590_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3852927_3853887_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3854098_3854764_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3854760_3855381_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3855373_3855544_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3855540_3855723_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3856420_3857101_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3857097_3857280_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3857252_3857444_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3857454_3857736_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3857834_3858056_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3858266_3858869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3859111_3859279_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3859318_3859537_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_089625990.1|3859642_3860581_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
3860655:3860669	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	4405058	4503315	5507715	plate,tail,transposase,integrase	Enterobacteria_phage(26.67%)	97	4407127:4407186	4453924:4455233
WP_000998048.1|4405058_4406597_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4406646_4406994_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
4407127:4407186	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|4407180_4408393_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_149025613.1|4408396_4408705_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	1.0e-46
WP_000803998.1|4408947_4409211_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4409210_4409351_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4409420_4409612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4410436_4410979_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4411053_4411641_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4411698_4412367_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001265657.1|4414907_4416551_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4416519_4417230_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4417542_4417872_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4418119_4418734_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4419151_4419841_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4419837_4420794_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4420790_4422989_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4422998_4423955_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4424133_4425261_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4425402_4426461_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4426706_4427609_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4428311_4428590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4428756_4429479_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4429577_4430477_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174845235.1|4431152_4432109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4432241_4434575_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4434588_4434912_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4434911_4435133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4435129_4435687_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4435683_4435944_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4436877_4437630_+	septation initiation protein	NA	NA	NA	NA	NA
WP_032164392.1|4437626_4438178_+	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4438183_4438456_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4438865_4439432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4439431_4440022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4440052_4440685_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4440677_4441136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4441135_4441753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4441725_4442142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4442145_4443327_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4444289_4445033_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021500093.1|4445856_4446630_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	6.6e-50
WP_000904979.1|4446687_4447242_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4447271_4447766_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4447765_4448359_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4448330_4448774_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000844960.1|4448794_4449190_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000788819.1|4449504_4449816_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4450767_4451061_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4451179_4451380_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4451480_4452194_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_162829202.1|4452715_4453929_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4454264_4454510_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4455579_4456833_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4453924:4455233	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCACCAATTGTATTTATTTTAAAATTAATAGGTGCAACTCACTAAACAACGCAATTCTGATCTCTCGATCACCTCCCAAGCCACACAACCCTGCAAAAAATAAATCTATATAAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTATTGACACAAATACCACTAGCGGTGATACTAAGCACATCAGCAGGACGCACTAACCACCATGAAGGTGATGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGTGTGTGTGATACGAAACGAAGCATTGGCCGGAAGTGCGAATCCGGATTAGCAGCCAATGTGCCATTGCGGGGTGTTTTCGTTCAGGACTACGACTCCCACACACAACCAAAGCTAACTAACAGGAGAATCCAGATGGATGCACAAACACGCCGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGATCGGATTCTGGCTTCAACATTTCGCAGGAATGCAACTAAGAGACATTACTGAATCAAAAATTTATTCAGCAATGCAGAAAATGACGAACCGGCGTCATGAGGAAAACTGGAAACTCAGGGCAGAAGCATGCAGAAAAAAAGGGAAACCTGTTCCAGAATACACGCCAAAACCAGCGTCCGTTGCAACGAAGGCTACGCATCTTTCATTTATAAAGGCCCTGCTAAGAGCCGCAGAGCGTGAATGGAAAATGCTCGATAAGGCACCAATTATTAAAGTGCCTCAACCAAAGAATAAACGGCTCCGCTGGCTGGAGCCCCATGAAGCACAAAGGCTGATTGATGAATGTCCGGAGCCATTAAAGTCTGTTGTTGAATTTGCACTGGCAACAGGCTTAAGACGCTCGAACATCATCAACCTTGAATGGCAACAAATAGATATGCAGCGCCGGGTGGCATGGATAAACCCGGAAGAGAGTAAATCAAACCGCGCAATTGGCGTTGCGCTGAATGATACTGCATGTCGCGTATTGAAAAAACAAATCGGTAATCATCACCGTTGGGTATTTGTGTACAAGGAAAGCTGTACCAAACCAGACGGAACGAAAGCGCCAACAGTAAGGAAGATGCGGTATGACGCAAACACAGCCTGGAAAGCGGCGCTGAGACGGGCTGGTATTGATGATTTCAGATTTCACGACTTGAGACACACCTGGGCAAGTTGGCTGGTTCAAGCCGGAGTCCCGTTGTCAGTGTTACAGGAAATGGGAGGCTGGGA	NA	NA	NA	NA
WP_001285288.1|4456844_4457948_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4458235_4459291_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4459329_4459731_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4459788_4461033_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4461124_4461583_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4461843_4463301_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4463357_4463915_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4463826_4464093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4464399_4464852_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4464861_4465260_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4465262_4465556_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4465607_4466663_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4466733_4467519_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4467463_4469203_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4470020_4470794_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4470979_4471240_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4471258_4471519_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4471674_4472415_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4472385_4473153_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4473257_4473836_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4474075_4476520_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4476562_4477036_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4477189_4477960_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4478077_4479250_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4479330_4479516_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4479430_4479694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4479895_4481656_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4481658_4482795_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001475373.1|4483540_4484062_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4484130_4485639_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000936899.1|4485820_4486582_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509129.1|4486675_4490908_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|4490983_4493125_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4493334_4493853_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4494549_4495050_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4495084_4495309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4495359_4496751_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4496841_4497255_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4497258_4499109_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4499072_4500155_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4500179_4501460_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4501456_4501981_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4501983_4503315_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 16
NZ_CP039834	Escherichia coli O157:H7 strain MB41-1 chromosome, complete genome	5507715	5136196	5150861	5507715	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5132037:5132052	5149566:5149581
5132037:5132052	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5136196_5137612_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5137694_5138678_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5138843_5139086_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5139219_5140257_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5140345_5141443_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5141504_5141753_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5141913_5142555_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5142636_5143266_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5143338_5143911_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5144022_5144292_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5144293_5145607_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5145671_5146271_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5147592_5148129_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5148119_5148470_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5148466_5148751_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5149086_5149284_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5149628_5149910_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5149566:5149581	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5149957_5150131_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5150327_5150861_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP039835	Escherichia coli O157:H7 strain MB41-1 plasmid pMB41_1, complete sequence	93704	8213	55561	93704	integrase,transposase,protease	Stx2-converting_phage(55.56%)	30	40122:40136	60975:60989
WP_001034100.1|8213_12116_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001171540.1|12442_12823_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|12819_13167_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|13426_13807_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|13803_14151_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|14200_15739_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_174845241.1|15772_15886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000487302.1|16014_16179_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	83.3	1.9e-15
WP_000975743.1|18546_19653_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|19742_21464_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001358886.1|23405_26102_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|26188_27064_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|27064_29032_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_151343231.1|29060_30536_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|30537_31761_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000082929.1|32221_32776_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|32790_33138_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|33134_33734_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|33730_34708_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|34746_35919_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000096786.1|36474_37308_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|37399_37801_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|39691_40207_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
40122:40136	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001213545.1|45375_46815_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|47557_47788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|47908_48649_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000708307.1|50337_50538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|52291_52510_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|52511_52817_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_162829202.1|54347_55561_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
60975:60989	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
