The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	707522	763178	6930600	tRNA,holin,plate,tail	uncultured_Caudovirales_phage(28.0%)	56	NA	NA
WP_046602637.1|707522_708548_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	4.9e-109
WP_003085061.1|708626_709196_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|709279_709633_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_022580736.1|709623_710166_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|710138_711371_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|711414_711921_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|712015_713569_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|713565_714837_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|714937_716860_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|717138_717471_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|717514_718366_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|718365_718746_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|718782_719589_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085089.1|719704_720691_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|720687_721980_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|721960_724762_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109031.1|724894_726607_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_010793494.1|727879_728896_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010793493.1|728892_729567_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|729568_730327_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_058176535.1|730327_731389_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003129201.1|731540_733934_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|733979_734612_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023092355.1|734740_735775_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|736008_737118_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|737173_738220_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003123930.1|738334_739582_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|739687_740518_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_034005248.1|740641_741316_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085124.1|741315_742134_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|742206_743685_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003137378.1|743870_744185_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003085129.1|744284_745055_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085132.1|745512_745713_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|745760_746120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|746482_746932_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|746953_747469_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|747465_748023_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|748175_748502_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_058176534.1|748498_749386_+|plate	baseplate J/gp47 family protein	plate	S4TNY7	Salmonella_phage	59.5	9.1e-88
WP_003137385.1|749378_749912_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_015502281.1|749913_752022_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|752030_752471_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003109051.1|752513_753674_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|753686_754190_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|754204_754549_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058176533.1|754718_756956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|756965_757838_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|757812_758019_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_021263054.1|758076_759066_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	3.7e-106
WP_033985525.1|759098_759728_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	2.9e-88
WP_003142810.1|759724_760087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|760083_760341_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|760688_761294_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|761295_762345_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|762341_763178_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	1516603	1525632	6930600		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1516603_1517239_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_017148388.1|1517284_1518178_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1518282_1519287_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1519713_1520037_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003122151.1|1520103_1522671_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_058176081.1|1522796_1523804_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1523951_1524458_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_058176080.1|1524591_1525632_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	3.9e-114
>prophage 3
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	2468136	2497455	6930600	transposase,holin,terminase,tRNA,integrase,tail	Pseudomonas_phage(66.67%)	38	2468423:2468437	2471873:2471887
WP_079760566.1|2468136_2469117_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2468423:2468437	attL	TCGCGACCGAGCATC	NA	NA	NA	NA
WP_003130858.1|2469260_2470415_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	59.5	1.6e-121
WP_003130859.1|2470388_2470664_-	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_174818285.1|2470966_2471305_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_086937300.1|2471224_2472386_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
2471873:2471887	attR	TCGCGACCGAGCATC	NA	NA	NA	NA
WP_003130870.1|2472720_2473080_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_031637682.1|2473797_2474448_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.2	1.6e-121
WP_023088260.1|2474581_2475154_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	91.7	1.9e-86
WP_071549877.1|2475530_2475749_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	1.1e-18
WP_033990714.1|2475780_2476353_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.4	1.3e-100
WP_003103373.1|2477289_2477898_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_023083722.1|2477890_2478334_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	69.2	1.4e-52
WP_034008243.1|2478362_2479232_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	84.4	4.1e-141
WP_034008242.1|2479291_2479600_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_023101093.1|2479574_2479850_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A0A1IU40	Pseudomonas_phage	64.9	2.7e-06
WP_031685794.1|2480150_2480450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103377.1|2480557_2480938_+	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	67.5	4.8e-38
WP_003103378.1|2480912_2481260_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.9e-25
WP_003103379.1|2481326_2481782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023101096.1|2481839_2482436_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	3.3e-49
WP_023115880.1|2482422_2483718_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	58.5	1.4e-145
WP_058176454.1|2483720_2485076_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	4.8e-96
WP_023115882.1|2485072_2486152_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.7	3.8e-197
WP_031637687.1|2486134_2486650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033990719.1|2486802_2487546_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	74.5	8.4e-87
WP_003103391.1|2487555_2488527_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	9.3e-110
WP_023088300.1|2488568_2489054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033990709.1|2489037_2489502_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	4.0e-10
WP_023101103.1|2489501_2489891_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.8e-33
WP_023087397.1|2489894_2490569_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	1.0e-115
WP_003451667.1|2490565_2490976_+	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	2.5e-24
WP_058176455.1|2491043_2491697_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	1.0e-59
WP_023115887.1|2491706_2492087_+|tail	phage tail assembly chaperone	tail	A0A1B0VMH4	Pseudomonas_phage	44.9	4.8e-22
WP_049246843.1|2492149_2492413_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	2.7e-16
WP_034008239.1|2492409_2495601_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	40.4	2.5e-156
WP_058176456.1|2495606_2495945_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	98.2	8.9e-60
WP_033946795.1|2495941_2496691_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	99.6	3.9e-148
WP_058176457.1|2496693_2497455_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	93.5	2.0e-139
>prophage 4
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	2775306	2784231	6930600	tRNA	uncultured_Caudovirales_phage(71.43%)	14	NA	NA
WP_003097631.1|2775306_2776587_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003113366.1|2776588_2777986_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2777990_2778965_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_009314043.1|2779052_2780036_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.2e-141
WP_003090393.1|2780032_2780368_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2780364_2780670_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2780669_2781029_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_023099506.1|2781025_2781421_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2781531_2782200_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_033989174.1|2782584_2783016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989176.1|2783125_2783335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033989177.1|2783352_2783544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033989178.1|2783546_2783753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052155988.1|2783745_2784231_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	D5LH05	Escherichia_phage	44.0	2.7e-09
>prophage 5
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	3241095	3280364	6930600	plate,tail	Planktothrix_phage(33.33%)	33	NA	NA
WP_003122677.1|3241095_3242379_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_058176392.1|3242401_3243748_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003139293.1|3243963_3245598_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_012614140.1|3245646_3247071_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003139295.1|3247076_3249068_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	41.9	1.2e-34
WP_003089547.1|3249067_3250243_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_012614142.1|3250343_3251339_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|3251502_3251982_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003114509.1|3252114_3253446_+	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_003139299.1|3253567_3255856_+	acylase	NA	NA	NA	NA	NA
WP_022580995.1|3256036_3256360_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003114511.1|3256401_3257322_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|3257418_3258570_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|3258636_3258879_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|3259173_3259410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|3259675_3260146_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_058176393.1|3260142_3262458_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_174818292.1|3262874_3264080_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|3264280_3264922_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|3265198_3265594_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003131532.1|3265616_3266153_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_058152541.1|3266163_3268170_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	2.2e-41
WP_003124577.1|3268206_3269274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089506.1|3269312_3269846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033958552.1|3269919_3272469_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	5.5e-77
WP_009316134.1|3272470_3273487_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_023114404.1|3273450_3275244_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003089496.1|3275227_3275653_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|3275665_3276163_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|3276236_3277721_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|3277743_3278289_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003089492.1|3278496_3278973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023094023.1|3279032_3280364_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 6
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	4441792	4481281	6930600	tail,integrase,head,transposase	Pseudomonas_phage(92.45%)	54	4439037:4439053	4483650:4483666
4439037:4439053	attL	GATCAGCGCCGGGTCGA	NA	NA	NA	NA
WP_003094179.1|4441792_4442152_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_031642110.1|4442154_4442718_-	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	98.9	9.5e-99
WP_015649398.1|4442717_4442930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078464300.1|4442913_4443711_-	HNH endonuclease	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	33.0	2.8e-19
WP_003094188.1|4443634_4444324_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_031642108.1|4444325_4444949_-	DUF3164 family protein	NA	A0A0S4L2U9	Pseudomonas_phage	100.0	3.5e-110
WP_031642107.1|4444941_4445142_-	bacteriophage protein	NA	A0A0S4L5A8	Pseudomonas_phage	100.0	4.6e-32
WP_031642106.1|4445134_4445746_-	hypothetical protein	NA	A0A0S4L050	Pseudomonas_phage	99.5	4.8e-120
WP_031642105.1|4445745_4446051_-	hypothetical protein	NA	A0A0S4L2V0	Pseudomonas_phage	100.0	6.4e-49
WP_031642104.1|4446047_4446389_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	96.5	4.3e-54
WP_023102419.1|4446390_4447560_-	AAA family ATPase	NA	A0A0S4L1G1	Pseudomonas_phage	100.0	3.2e-213
WP_031642103.1|4447559_4449338_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0S4L2U5	Pseudomonas_phage	100.0	0.0e+00
WP_174818296.1|4449351_4450299_-	hypothetical protein	NA	A0A0S4L093	Pseudomonas_phage	93.0	1.5e-152
WP_031642102.1|4450356_4450656_-	helix-turn-helix domain-containing protein	NA	A0A0S4L7B4	Pseudomonas_phage	100.0	1.7e-46
WP_023442738.1|4450652_4450913_-	hypothetical protein	NA	A0A0S4L062	Pseudomonas_phage	100.0	6.0e-40
WP_023442737.1|4450905_4451394_-	hypothetical protein	NA	A0A0S4L5L2	Pseudomonas_phage	100.0	8.8e-93
WP_124214277.1|4451519_4452200_-	hypothetical protein	NA	A0A0S4L0N5	Pseudomonas_phage	99.5	9.7e-106
WP_023442735.1|4452226_4452547_+	hypothetical protein	NA	A0A0S4L532	Pseudomonas_phage	99.1	2.2e-52
WP_023657070.1|4452592_4452802_-	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	100.0	9.7e-33
WP_172907857.1|4452900_4453338_+	helix-turn-helix transcriptional regulator	NA	A0A0S4L3B5	Pseudomonas_phage	71.3	9.1e-41
WP_003152183.1|4453357_4453561_+	hypothetical protein	NA	A0A0S4L2S2	Pseudomonas_phage	68.7	1.1e-20
WP_003094222.1|4453533_4454289_-	hypothetical protein	NA	J9SWJ3	Pseudomonas_phage	77.4	1.5e-70
WP_003094225.1|4454501_4454759_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_003094227.1|4454761_4454920_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_003094230.1|4454916_4455546_+	transglycosylase SLT domain-containing protein	NA	A0A0S4L2W4	Pseudomonas_phage	98.1	4.6e-118
WP_003094232.1|4455732_4456344_+	hypothetical protein	NA	J9RWN0	Pseudomonas_phage	100.0	1.3e-96
WP_034018927.1|4456347_4456737_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	99.2	1.2e-63
WP_003094236.1|4456726_4457035_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	1.7e-54
WP_003094238.1|4457040_4457616_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|4457617_4459321_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_134592911.1|4459320_4460799_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	99.6	1.2e-286
WP_031630688.1|4460798_4462049_+|head	phage head morphogenesis protein	head	J9SWK6	Pseudomonas_phage	100.0	1.5e-240
WP_003139982.1|4462045_4462615_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|4462902_4464072_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|4464075_4464453_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|4464464_4465394_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|4465440_4465635_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|4465634_4465961_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|4465968_4466478_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|4466479_4466935_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|4466931_4467141_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|4467144_4467897_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_174818297.1|4467898_4468405_+	hypothetical protein	NA	J9STK7	Pseudomonas_phage	97.6	6.8e-88
WP_174818298.1|4468631_4472477_+|tail	phage tail length tape measure family protein	tail	A0A0S4L7E6	Pseudomonas_phage	93.4	0.0e+00
WP_174818299.1|4472484_4473441_+	hypothetical protein	NA	I6PCB0	Pseudomonas_phage	96.9	2.4e-187
WP_174818300.1|4473442_4474366_+	hypothetical protein	NA	A0A0A1IX02	Pseudomonas_phage	98.4	1.3e-182
WP_174818301.1|4474365_4476069_+	hypothetical protein	NA	A0A0A7DJE1	Pseudomonas_phage	97.9	0.0e+00
WP_023126635.1|4476058_4476880_+	phage BR0599 family protein	NA	A0A0U5KNA7	unidentified_phage	99.6	1.5e-164
WP_003094581.1|4476888_4477128_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	100.0	3.6e-39
WP_003094583.1|4477124_4477343_+	hypothetical protein	NA	L7P837	Pseudomonas_phage	100.0	4.4e-36
WP_042180146.1|4477332_4479540_+	hypothetical protein	NA	L7P7P6	Pseudomonas_phage	98.9	0.0e+00
WP_174818302.1|4479536_4480688_+	hypothetical protein	NA	A0A125RNJ7	Pseudomonas_phage	97.9	4.3e-223
WP_012613806.1|4480684_4480978_+	hypothetical protein	NA	A0A0U5KPN8	unidentified_phage	100.0	8.8e-48
WP_010791890.1|4481056_4481281_+	hypothetical protein	NA	A0A0A1IX79	Pseudomonas_phage	100.0	2.5e-34
4483650:4483666	attR	GATCAGCGCCGGGTCGA	NA	NA	NA	NA
>prophage 7
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	4923371	4962200	6930600	transposase,lysis,protease,head,integrase	Pseudomonas_phage(100.0%)	51	4925530:4925544	4935120:4935134
WP_003127781.1|4923371_4923740_-	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_033946020.1|4923736_4923946_-	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	92.5	1.4e-18
WP_033946019.1|4923945_4924512_-	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	98.9	1.7e-100
WP_033946017.1|4924498_4924966_-	hypothetical protein	NA	J9STM8	Pseudomonas_phage	79.4	1.8e-55
WP_016852434.1|4924965_4925157_-	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_033946016.1|4925158_4925848_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	100.0	2.7e-127
4925530:4925544	attL	CCGGCGCCGCCGCGC	NA	NA	NA	NA
WP_015649401.1|4925849_4926473_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	99.5	1.0e-109
WP_033946013.1|4926619_4927150_-	hypothetical protein	NA	J9STN6	Pseudomonas_phage	99.4	5.8e-90
WP_033946010.1|4927139_4927820_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	97.8	4.5e-127
WP_014603990.1|4927819_4928104_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_003127823.1|4928100_4928442_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	95.6	5.6e-54
WP_003127825.1|4928443_4929616_-	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	94.4	1.9e-202
WP_079381453.1|4929615_4931397_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	99.2	0.0e+00
WP_033946007.1|4931399_4932326_-	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	90.9	1.9e-149
WP_015649409.1|4932336_4932645_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	100.0	5.4e-48
WP_003127832.1|4932637_4933123_-	hypothetical protein	NA	Q5ZR01	Pseudomonas_phage	100.0	7.4e-92
WP_015649394.1|4933246_4933471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142304.1|4933755_4933986_-	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	100.0	2.5e-37
WP_157783244.1|4934170_4934431_+	hypothetical protein	NA	J9SH16	Pseudomonas_phage	82.6	1.8e-12
WP_003094225.1|4935141_4935399_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
4935120:4935134	attR	CCGGCGCCGCCGCGC	NA	NA	NA	NA
WP_003094227.1|4935401_4935560_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_010791818.1|4935556_4936186_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	99.5	2.2e-120
WP_019485965.1|4936387_4937011_+|lysis	Rz lysis protein	lysis	J9SVX5	Pseudomonas_phage	99.0	1.0e-109
WP_003117315.1|4937010_4937331_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_003121465.1|4937327_4937630_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	99.0	4.1e-48
WP_003121466.1|4937632_4938181_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	98.9	6.4e-76
WP_003126996.1|4938182_4939856_+	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.3	0.0e+00
WP_010791816.1|4939849_4941424_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.4	2.0e-287
WP_003126992.1|4941413_4942652_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	99.5	1.0e-241
WP_015649417.1|4942653_4943229_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	99.0	1.7e-103
WP_003129234.1|4943439_4944549_+|protease	phage protease	protease	J9SH47	Pseudomonas_phage	99.7	5.3e-202
WP_003121593.1|4944554_4944959_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_003127513.1|4944973_4945870_+|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_015649419.1|4945882_4946317_+	hypothetical protein	NA	J9STT1	Pseudomonas_phage	99.0	1.1e-49
WP_003121492.1|4946319_4946835_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_003127511.1|4946831_4947284_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	100.0	5.5e-81
WP_003127509.1|4947280_4947484_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_010791812.1|4947490_4948231_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	100.0	1.2e-136
WP_023086241.1|4948233_4948716_+	hypothetical protein	NA	J9STT8	Pseudomonas_phage	100.0	1.3e-83
WP_049967619.1|4948670_4948853_-	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_031655034.1|4948969_4952602_+	tape measure protein	NA	J9SH65	Pseudomonas_phage	96.3	0.0e+00
WP_023123676.1|4952601_4953558_+	hypothetical protein	NA	L7P7S3	Pseudomonas_phage	94.3	1.9e-184
WP_023127652.1|4953559_4954483_+	hypothetical protein	NA	J9SVR7	Pseudomonas_phage	96.1	3.8e-177
WP_023123220.1|4954485_4956192_+	hypothetical protein	NA	Q5ZQW3	Pseudomonas_phage	96.7	0.0e+00
WP_023123221.1|4956178_4956997_+	phage BR0599 family protein	NA	J9SN93	Pseudomonas_phage	99.3	3.8e-165
WP_023117665.1|4957019_4957250_+	hypothetical protein	NA	J9SHJ9	Pseudomonas_phage	100.0	2.7e-36
WP_033946000.1|4957463_4959674_+	bacteriophage protein	NA	A0A0S4L2V2	Pseudomonas_phage	97.3	0.0e+00
WP_003094288.1|4959670_4960819_+	hypothetical protein	NA	J9SP76	Pseudomonas_phage	92.9	9.0e-213
WP_003094290.1|4960815_4961106_+	hypothetical protein	NA	A0A0A7DJU8	Pseudomonas_phage	95.7	2.6e-44
WP_015649444.1|4961244_4961436_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	73.0	6.6e-20
WP_031800187.1|4961405_4962200_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	90.5	2.3e-143
>prophage 8
NZ_CP050332	Pseudomonas aeruginosa strain DVT413 chromosome, complete genome	6930600	5208036	5293427	6930600	portal,integrase,capsid,protease,holin,terminase,tRNA,head,plate,tail	Pseudomonas_virus(69.57%)	103	5255946:5255990	5293595:5293639
WP_003085581.1|5208036_5208441_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_031686480.1|5208539_5209292_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085577.1|5209423_5209996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031686481.1|5210100_5210841_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	26.4	4.9e-10
WP_003085573.1|5210837_5211806_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_016263845.1|5211896_5212643_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003085569.1|5212635_5213337_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|5213397_5214315_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|5214307_5214997_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_003085562.1|5214993_5215371_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003085558.1|5215539_5216394_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003085555.1|5216399_5218199_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	1.5e-20
WP_003114183.1|5218348_5219773_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.4	2.6e-28
WP_003110245.1|5219812_5220268_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_003085548.1|5220264_5221215_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|5221223_5221808_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|5221839_5222421_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003110247.1|5222829_5224446_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003085534.1|5224414_5224867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|5224850_5225105_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_021264284.1|5225377_5226322_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|5226422_5227259_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003085526.1|5227266_5228649_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|5228641_5229313_-	response regulator	NA	NA	NA	NA	NA
WP_023101501.1|5229523_5230807_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|5230836_5231820_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_021264282.1|5231868_5232339_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003085514.1|5232349_5233867_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003134364.1|5233859_5234897_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085510.1|5235022_5235718_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	7.7e-50
WP_021264281.1|5235817_5236639_-	VanW family protein	NA	NA	NA	NA	NA
WP_003106441.1|5236695_5237577_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003116510.1|5237709_5239218_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003085499.1|5239229_5240393_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003085498.1|5240458_5241277_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003120788.1|5241335_5242439_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010793850.1|5242550_5243447_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|5243503_5244148_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_034049236.1|5244263_5244905_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058176143.1|5244939_5246916_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.9	3.6e-161
WP_022579822.1|5247018_5247933_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085482.1|5247936_5248125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|5248247_5248493_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003085474.1|5248611_5249061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073665963.1|5249152_5249329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023096061.1|5249561_5250638_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_023096062.1|5250634_5251450_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_073700288.1|5251470_5251743_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003085458.1|5251742_5252435_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003134392.1|5252570_5253614_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003124252.1|5253693_5254431_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_058176142.1|5254882_5255785_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
5255946:5255990	attL	TTCCCAAGCTCATGACGAGGGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
WP_023093061.1|5256792_5257554_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	72.0	4.0e-108
WP_023127745.1|5257709_5258765_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	98.0	2.3e-199
WP_031299630.1|5258764_5260525_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_015967183.1|5260680_5261502_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	100.0	8.9e-130
WP_023127746.1|5261537_5262554_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.7	3.5e-192
WP_022580432.1|5262559_5263261_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	8.1e-124
WP_022580431.1|5263364_5263826_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.7	1.1e-79
WP_003098378.1|5263825_5264038_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_023127747.1|5264062_5264416_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	99.1	1.7e-58
WP_015967189.1|5264417_5264690_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	100.0	2.4e-39
WP_023127748.1|5264686_5265493_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	99.3	9.0e-151
WP_023127413.1|5265489_5265951_+	hypothetical protein	NA	Q9ZXL5	Pseudomonas_virus	98.7	4.7e-72
WP_022580427.1|5266031_5266568_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	3.6e-95
WP_023127414.1|5266560_5267019_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	88.2	3.5e-67
WP_023127749.1|5267088_5267661_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	91.1	2.7e-93
WP_022580424.1|5267657_5268002_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	98.2	1.6e-56
WP_023127750.1|5267998_5268916_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	87.5	4.9e-145
WP_023127751.1|5268912_5269530_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	76.3	3.1e-87
WP_023127753.1|5271353_5271788_+	hypothetical protein	NA	A0A291LAV4	Bordetella_phage	51.9	4.0e-28
WP_023127754.1|5271888_5273064_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.0	1.1e-216
WP_023127755.1|5273120_5273636_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	98.2	1.2e-92
WP_023127421.1|5273690_5274020_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	95.4	2.6e-48
WP_003098394.1|5274028_5274148_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023127756.1|5274137_5276852_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	96.0	0.0e+00
WP_015967206.1|5276857_5277298_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
WP_023127757.1|5277294_5278569_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	96.9	6.0e-234
WP_023127758.1|5278610_5279447_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_023127759.1|5279446_5280187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023127760.1|5280241_5280886_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	58.2	4.3e-71
WP_049262809.1|5281097_5281550_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020750421.1|5281594_5281825_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_031637512.1|5281854_5282328_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
WP_023091244.1|5282335_5282554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023876137.1|5282552_5282744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023127762.1|5282746_5283040_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	97.9	3.2e-50
WP_023127763.1|5283036_5283387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|5283457_5283691_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_023127764.1|5283687_5286408_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	99.2	0.0e+00
WP_023127765.1|5286452_5286725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023127766.1|5286784_5287138_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	95.7	1.4e-60
WP_023127767.1|5287149_5287356_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	95.6	4.0e-31
WP_023127768.1|5287415_5287856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852055.1|5287852_5288029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023127769.1|5288021_5289932_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	92.6	4.3e-284
WP_023127210.1|5289942_5290119_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	76.5	1.1e-05
WP_023127770.1|5290115_5290742_+	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	64.1	1.8e-66
WP_023127771.1|5290738_5291596_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	76.3	1.1e-125
WP_031293860.1|5291589_5291826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031759401.1|5291818_5292022_+	hypothetical protein	NA	A0A2H4J958	uncultured_Caudovirales_phage	46.6	1.4e-07
WP_003098423.1|5292014_5292218_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023127772.1|5292224_5293427_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	2.6e-37
5293595:5293639	attR	TTCCCAAGCTCATGACGAGGGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
