The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050330	Pseudomonas aeruginosa strain DVT779 chromosome, complete genome	6386887	640212	692993	6386887	plate,tRNA,tail	uncultured_Caudovirales_phage(29.17%)	55	NA	NA
WP_023113352.1|640212_641238_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	6.3e-109
WP_003085061.1|641316_641886_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|641969_642323_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_023121890.1|642313_642856_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_058137485.1|642828_644061_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_058170467.1|644104_644611_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|644705_646259_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|646255_647527_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|647627_649550_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|649828_650161_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|650204_651056_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|651055_651436_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|651472_652279_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|652394_653381_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|653377_654670_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_012613530.1|654650_657440_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010793494.1|657566_658583_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012613531.1|658579_659254_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|659255_660014_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012613533.1|660014_661076_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_009875783.1|661227_663621_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|663666_664299_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|664427_665462_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|665695_666805_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_033957310.1|666860_667907_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|668021_669269_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|669374_670205_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|670328_671003_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|671002_671821_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003113204.1|671893_673372_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|673688_674003_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|674102_674873_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_033957307.1|675330_675531_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_003118907.1|675578_675938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|676301_676751_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003113200.1|676772_677288_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003085141.1|677284_677842_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_058342934.1|677994_678321_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	59.3	9.2e-30
WP_003085151.1|678317_679205_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_010895511.1|679197_679731_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.0e-62
WP_058342933.1|679732_681838_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.6	5.1e-222
WP_016852415.1|681845_682286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019681189.1|682328_683489_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.2	2.0e-188
WP_003085175.1|683501_684005_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|684019_684364_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_114231332.1|684533_686771_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_003085182.1|686780_687653_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|687627_687834_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003113193.1|687891_688881_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	7.5e-107
WP_003113192.1|688913_689543_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|689539_689902_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|689898_690156_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003117978.1|690503_691109_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|691110_692160_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003459446.1|692156_692993_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.5	6.2e-70
>prophage 2
NZ_CP050330	Pseudomonas aeruginosa strain DVT779 chromosome, complete genome	6386887	1381496	1443755	6386887	portal,terminase,capsid,integrase,holin,head,protease,tail,tRNA	Pseudomonas_phage(88.89%)	78	1402060:1402078	1451385:1451403
WP_029610720.1|1381496_1382177_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003098661.1|1382250_1382598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098658.1|1382616_1383483_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	50.8	8.8e-27
WP_003117473.1|1383555_1384380_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_003453661.1|1384384_1385080_+	extensin family protein	NA	NA	NA	NA	NA
WP_003453660.1|1385135_1385921_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033944923.1|1385949_1387227_+	cytochrome P450	NA	NA	NA	NA	NA
WP_003092468.1|1387233_1387872_-	efflux system transcriptional repressor MexL	NA	NA	NA	NA	NA
WP_003113855.1|1387967_1389071_+	multidrug efflux RND transporter periplasmic adaptor subunit MexJ	NA	NA	NA	NA	NA
WP_003117477.1|1389075_1392153_+	multidrug efflux RND transporter permease subunit MexK	NA	S5VL66	Leptospira_phage	20.0	1.3e-27
WP_003098644.1|1392193_1392874_-	DUF4197 domain-containing protein	NA	NA	NA	NA	NA
WP_003098642.1|1393010_1393409_-	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_003113856.1|1393552_1396057_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_003119338.1|1396340_1397264_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	1.2e-21
WP_003117479.1|1397260_1397995_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003143238.1|1398005_1399853_+	GldG family protein	NA	NA	NA	NA	NA
WP_003143240.1|1399856_1400837_+	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_003092439.1|1400843_1401266_-	SufE family protein	NA	NA	NA	NA	NA
WP_003159443.1|1401262_1402468_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	39.2	3.0e-73
1402060:1402078	attL	CCAGGCCGCGGCGCAGGGC	NA	NA	NA	NA
WP_003092431.1|1402562_1403597_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_004345492.1|1403626_1404250_-	LysE family translocator	NA	NA	NA	NA	NA
WP_003098619.1|1404262_1404610_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_012613678.1|1404676_1405780_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A0U4JIT5	Pseudomonas_phage	98.9	7.3e-204
WP_012613679.1|1405760_1406003_-	excisionase	NA	NA	NA	NA	NA
WP_171946297.1|1406219_1406510_-	hypothetical protein	NA	A0A1B0Z2L6	Pseudomonas_phage	95.8	5.7e-47
WP_003105603.1|1406581_1406887_-	hypothetical protein	NA	A0A125RNQ5	Pseudomonas_phage	84.0	7.5e-42
WP_049950255.1|1406879_1407062_-	hypothetical protein	NA	A0A0S2SY76	Pseudomonas_phage	81.7	7.4e-21
WP_174817294.1|1407568_1408066_-	hypothetical protein	NA	A0A125RNQ6	Pseudomonas_phage	69.1	8.5e-35
WP_174817340.1|1408058_1409813_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	34.3	6.3e-56
WP_174817341.1|1409979_1410228_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	98.8	1.2e-40
WP_174817342.1|1410522_1411059_-	DUF4406 domain-containing protein	NA	A0A0U4IBL4	Pseudomonas_phage	92.7	1.8e-94
WP_174817343.1|1411055_1412153_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	68.4	1.0e-136
WP_174817344.1|1412218_1412521_-	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	95.0	9.1e-40
WP_174817345.1|1412728_1412977_-	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	91.5	4.2e-35
WP_043087936.1|1412987_1413374_-	LuxR family transcriptional regulator	NA	A0A1B0YZX7	Pseudomonas_phage	98.4	6.8e-64
WP_116818425.1|1413683_1414550_-	ParB N-terminal domain-containing protein	NA	A0A0U4JP11	Pseudomonas_phage	97.2	1.1e-154
WP_174817346.1|1414626_1415268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079389484.1|1415414_1416185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023118800.1|1416986_1417748_-	LexA family transcriptional regulator	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	58.3	7.9e-40
WP_023118799.1|1417829_1418069_+	hypothetical protein	NA	A0A2H4J0V8	uncultured_Caudovirales_phage	53.2	3.6e-15
WP_174817347.1|1418311_1419073_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	84.7	6.2e-77
WP_033940327.1|1419069_1419753_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	96.0	1.8e-120
WP_033940326.1|1419749_1419956_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	92.6	1.2e-30
WP_033940325.1|1419952_1420534_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	91.7	1.2e-99
WP_023118794.1|1420530_1420827_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	79.6	2.2e-38
WP_023118793.1|1420828_1421203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547434.1|1421413_1421953_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	77.7	1.8e-70
WP_016561975.1|1422132_1422447_+|holin	phage holin, lambda family	holin	A0A0A0YUH2	Pseudomonas_phage	99.0	1.3e-52
WP_134230606.1|1422446_1423064_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	94.1	1.4e-106
WP_174817348.1|1423081_1423513_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	2.5e-51
WP_058180826.1|1423649_1424054_+	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	51.8	1.1e-27
WP_014602593.1|1424135_1424618_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	74.4	1.4e-61
WP_023127397.1|1424621_1426349_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	76.3	5.4e-270
WP_023092517.1|1426348_1427572_+|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	81.0	1.9e-189
WP_023092518.1|1427549_1428203_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2D1GNL2	Pseudomonas_phage	82.6	2.6e-100
WP_023092519.1|1428213_1429416_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	76.8	9.9e-178
WP_023092520.1|1429461_1429740_+	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	40.9	4.2e-15
WP_023092521.1|1429732_1430053_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	57.1	4.1e-30
WP_023127395.1|1430075_1430258_+	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	54.2	2.6e-10
WP_034056998.1|1430267_1430819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034056997.1|1430815_1431409_+	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	97.5	1.1e-100
WP_023120270.1|1431421_1431859_+	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	96.6	9.1e-73
WP_003098508.1|1431882_1432668_+	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	99.2	1.7e-146
WP_023092526.1|1432723_1433089_+	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	98.3	3.1e-58
WP_003098505.1|1433133_1433283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174817349.1|1433272_1435414_+	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	99.0	0.0e+00
WP_023118122.1|1435423_1435927_+	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	99.4	9.1e-93
WP_079389493.1|1435928_1437632_+	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	96.5	0.0e+00
WP_174817350.1|1437634_1438045_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	90.4	4.9e-52
WP_046094892.1|1438044_1438587_+	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	95.6	1.3e-92
WP_174817351.1|1438599_1439004_+	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	97.8	4.5e-66
WP_174817352.1|1439000_1440659_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	95.4	0.0e+00
WP_012613717.1|1440688_1441276_+	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	95.4	1.5e-102
WP_003159082.1|1441268_1441460_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_174817353.1|1441464_1442025_+	hypothetical protein	NA	A0A1W6JT84	Pseudomonas_phage	96.8	3.0e-97
WP_023103825.1|1442025_1442307_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	98.9	1.8e-45
WP_023132545.1|1443231_1443531_+	hypothetical protein	NA	A0A1B0YZW1	Pseudomonas_phage	97.0	1.1e-48
WP_077447211.1|1443527_1443755_+	hypothetical protein	NA	A0A0U3DK06	Pseudomonas_phage	71.0	5.4e-21
1451385:1451403	attR	CCAGGCCGCGGCGCAGGGC	NA	NA	NA	NA
>prophage 3
NZ_CP050330	Pseudomonas aeruginosa strain DVT779 chromosome, complete genome	6386887	1488777	1497806	6386887		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1488777_1489413_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1489458_1490352_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1490456_1491461_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1491887_1492211_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_114231190.1|1492277_1494845_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	5.4e-24
WP_003113874.1|1494970_1495978_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1496125_1496632_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1496765_1497806_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP050330	Pseudomonas aeruginosa strain DVT779 chromosome, complete genome	6386887	2570337	2629071	6386887	plate,portal,lysis,terminase,capsid,integrase,tail,protease,holin,head,tRNA	Pseudomonas_virus(63.27%)	63	2593845:2593874	2630820:2630849
WP_128698196.1|2570337_2571468_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003090438.1|2571511_2571982_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003122606.1|2572068_2574294_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003090436.1|2574652_2575909_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	3.1e-17
WP_003090435.1|2575981_2576254_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.8	1.1e-15
WP_003097649.1|2576479_2576848_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_003090432.1|2576875_2579152_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
WP_002553999.1|2579233_2579452_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003108766.1|2579556_2580264_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003108768.1|2580318_2580999_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_023464802.1|2581036_2581987_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	4.1e-62
WP_003119977.1|2582214_2584650_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
WP_003090414.1|2584675_2585302_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_023464801.1|2585311_2586637_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003097631.1|2586758_2588039_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003160439.1|2588040_2589438_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2589442_2590417_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2590504_2591488_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2591484_2591820_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2591816_2592122_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2592121_2592481_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2592477_2592873_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2592983_2593652_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
2593845:2593874	attL	TGAGTTCGAATCTCACCGCCTCCGCCATAT	NA	NA	NA	NA
WP_023083436.1|2593992_2595162_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	65.8	6.9e-152
WP_023083438.1|2595382_2597293_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	91.3	7.1e-279
WP_003098417.1|2597596_2597803_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023083439.1|2597814_2598168_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	4.2e-60
WP_023083440.1|2598212_2600933_-	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	96.9	0.0e+00
WP_023083441.1|2600929_2601163_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	97.4	5.0e-38
WP_023083442.1|2601233_2601584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098408.1|2601580_2601874_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_170955108.1|2601870_2602341_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	92.3	1.6e-75
WP_049878500.1|2602645_2603098_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023083444.1|2603134_2603602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031634362.1|2603779_2604154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023083445.1|2604282_2605374_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	43.3	1.5e-68
WP_023083446.1|2605357_2606539_+	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	31.0	1.5e-53
WP_023083447.1|2606566_2607832_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.4	6.0e-234
WP_003098399.1|2607828_2608269_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_023083448.1|2608274_2611034_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	90.6	0.0e+00
WP_003098394.1|2611023_2611143_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023083449.1|2611151_2611481_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
WP_023083450.1|2611535_2612051_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	2.1e-89
WP_023083451.1|2612107_2613283_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.2	1.1e-218
WP_023083452.1|2613373_2613838_-	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	75.0	1.4e-44
WP_015967199.1|2616193_2616730_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_023083454.1|2616729_2617644_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	99.7	5.6e-165
WP_023083455.1|2617640_2617985_-	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	96.5	1.4e-55
WP_016852033.1|2617981_2618554_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.9	3.6e-93
WP_023083456.1|2618623_2619082_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	88.8	1.6e-67
WP_023083457.1|2619074_2619611_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	4.6e-95
WP_023083458.1|2619691_2620153_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	99.3	1.2e-72
WP_023083459.1|2620149_2620956_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	98.9	2.6e-150
WP_003098380.1|2620952_2621225_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_003098379.1|2621226_2621580_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098378.1|2621604_2621817_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_023083460.1|2621816_2622278_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.0	3.1e-79
WP_023083461.1|2622381_2623083_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	6.2e-124
WP_023083462.1|2623088_2624105_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	8.6e-191
WP_023083463.1|2624140_2624962_-|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	87.2	1.1e-127
WP_031634369.1|2625117_2626878_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	99.8	0.0e+00
WP_023083465.1|2626877_2627939_+|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.8	1.1e-193
WP_023083466.1|2627955_2629071_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.2	1.8e-32
2630820:2630849	attR	TGAGTTCGAATCTCACCGCCTCCGCCATAT	NA	NA	NA	NA
>prophage 5
NZ_CP050330	Pseudomonas aeruginosa strain DVT779 chromosome, complete genome	6386887	2934404	2973746	6386887	plate,tail	Planktothrix_phage(33.33%)	33	NA	NA
WP_023084238.1|2934404_2935682_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_012614138.1|2935693_2937052_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_031675447.1|2937266_2938904_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_003120134.1|2938952_2940377_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003122682.1|2940382_2942374_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	41.9	1.5e-34
WP_003089547.1|2942373_2943549_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003120136.1|2943649_2944645_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|2944808_2945288_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003114509.1|2945420_2946752_+	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_019726223.1|2946874_2949163_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|2949343_2949667_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_034006372.1|2949708_2950629_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|2950725_2951877_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2951943_2952186_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|2952480_2952717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|2952982_2953453_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003160318.1|2953449_2955765_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_172664632.1|2956181_2957387_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|2957587_2958229_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|2958505_2958901_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003114514.1|2958923_2959460_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_033877234.1|2959470_2961474_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.8	2.0e-42
WP_003116945.1|2961480_2962266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023085257.1|2962335_2963211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114516.1|2963301_2965851_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003114517.1|2965852_2966869_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_174817405.1|2966832_2968626_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|2968609_2969035_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|2969047_2969545_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|2969618_2971103_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|2971125_2971671_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003450945.1|2971878_2972355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020750612.1|2972414_2973746_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 6
NZ_CP050330	Pseudomonas aeruginosa strain DVT779 chromosome, complete genome	6386887	5351058	5358346	6386887	integrase	Pseudomonas_phage(83.33%)	8	5350483:5350542	5363121:5363202
5350483:5350542	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_004352688.1|5351058_5352060_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
WP_004352686.1|5352056_5353349_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_174817508.1|5353607_5354870_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	52.4	3.5e-109
WP_003159569.1|5354871_5355222_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_003163345.1|5356501_5356720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5356733_5356985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140508.1|5357105_5357540_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_023088865.1|5358055_5358346_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
5363121:5363202	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
