The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050326	Pseudomonas aeruginosa strain DVT423 chromosome, complete genome	6716245	685867	740399	6716245	tail,tRNA,holin	Pseudomonas_phage(53.85%)	57	NA	NA
WP_023086927.1|685867_686893_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	2.4e-108
WP_003085061.1|686971_687541_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|687624_687978_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|687968_688511_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|688483_689716_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_009875777.1|689759_690266_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|690359_691913_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|691909_693181_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|693281_695204_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|695482_695815_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|695858_696710_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|696709_697090_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|697126_697933_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085089.1|698048_699035_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|699031_700324_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004352244.1|700304_703088_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_023086928.1|703214_704231_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|704227_704902_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_009875781.1|704903_705662_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_009875782.1|705662_706724_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_009875783.1|706875_709269_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|709314_709947_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|710075_711110_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|711343_712453_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|712508_713555_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003123930.1|713669_714917_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|715022_715853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|715976_716651_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|716650_717469_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_023086929.1|717541_719020_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|719336_719651_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|719750_720521_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|720978_721179_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_023086930.1|721226_721586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017002346.1|721949_722393_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	6.5e-26
WP_009875788.1|722408_723038_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_004355109.1|723034_723397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|723393_723651_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|723966_724461_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|724472_724820_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_003113188.1|724849_725104_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_009875789.1|725150_726989_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|726981_727323_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003117971.1|727330_728026_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.1e-69
WP_003117973.1|728028_728799_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003117974.1|728853_729456_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_023086931.1|729514_733129_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	55.3	0.0e+00
WP_003118927.1|733364_734153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|734176_735268_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_023085656.1|735267_735603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118928.1|735583_735814_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	65.3	6.7e-19
WP_009315200.1|735909_736962_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
WP_003113177.1|736961_737264_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003118930.1|737260_737491_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003101640.1|737909_738515_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|738516_739566_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_023086932.1|739562_740399_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.6e-70
>prophage 2
NZ_CP050326	Pseudomonas aeruginosa strain DVT423 chromosome, complete genome	6716245	1614907	1653976	6716245	tRNA,coat,integrase	Pseudomonas_phage(60.0%)	40	1613130:1613189	1626929:1627010
1613130:1613189	attL	AAAAGGGGTTAGCTTGCGCTAACCCCTTGAAAAATATGGTGGCTACACCGGGACTTGAAC	NA	NA	NA	NA
WP_023087829.1|1614907_1616674_+	hypothetical protein	NA	A0A0B6VLB5	Edwardsiella_phage	34.8	2.8e-11
WP_031633682.1|1617205_1617541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115921.1|1617987_1618260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031633681.1|1618255_1618468_+	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	95.7	4.4e-33
WP_023087826.1|1618471_1618762_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.8	6.2e-54
WP_023087663.1|1619277_1619712_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	7.1e-62
WP_023087824.1|1619833_1620085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003125072.1|1620097_1620346_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_031633680.1|1620497_1621808_+	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	56.8	2.7e-51
WP_003114150.1|1621812_1622169_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_023087822.1|1622172_1623447_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	87.0	8.2e-199
WP_023087821.1|1623676_1624969_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.0	3.0e-241
WP_023087820.1|1624965_1625967_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.5	2.6e-75
WP_023087819.1|1625943_1626828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099270.1|1627220_1628321_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1626929:1627010	attR	AAAAGGGGTTAGCTTGCGCTAACCCCTTGAAAAATATGGTGGCTACACCGGGACTTGAACCTGGGACATCAGCATTATGAAT	NA	NA	NA	NA
WP_003099278.1|1628361_1628946_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099279.1|1628987_1629602_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099281.1|1629718_1630660_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_009875808.1|1630826_1631675_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003095005.1|1631676_1632294_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_025982305.1|1632298_1634071_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023087818.1|1634214_1635483_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003114692.1|1635500_1636583_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003121049.1|1636584_1637415_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_023087817.1|1637408_1638167_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099300.1|1638156_1638954_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003099307.1|1639087_1639609_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003121048.1|1639734_1641180_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	27.8	1.8e-45
WP_003094990.1|1641176_1642076_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003099314.1|1642085_1643042_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003099318.1|1643194_1644178_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003457067.1|1644591_1645509_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003161397.1|1645505_1646528_+	ferrochelatase	NA	NA	NA	NA	NA
WP_003099328.1|1646807_1648181_+	MFS transporter	NA	NA	NA	NA	NA
WP_003099330.1|1648182_1649130_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_023087816.1|1649126_1651499_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099335.1|1651515_1652304_-	molecular chaperone	NA	NA	NA	NA	NA
WP_003099337.1|1652322_1652865_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099339.1|1652864_1653380_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099340.1|1653427_1653976_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP050326	Pseudomonas aeruginosa strain DVT423 chromosome, complete genome	6716245	2768593	2779033	6716245	tRNA,integrase	Pseudomonas_phage(77.78%)	13	2766664:2766680	2786593:2786609
2766664:2766680	attL	CGGCGATGAACAGCGGC	NA	NA	NA	NA
WP_023087665.1|2768593_2769835_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	26.2	6.7e-20
WP_022581007.1|2770325_2770541_+	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	93.0	1.4e-34
WP_033871697.1|2770546_2770765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031760609.1|2770763_2771051_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	95.7	8.9e-53
WP_023087663.1|2771566_2772001_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	7.1e-62
WP_003124954.1|2772121_2772373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|2772386_2772605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031633401.1|2773331_2773913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003133726.1|2773922_2774273_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	40.2	1.6e-19
WP_023087660.1|2774274_2775537_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	55.9	6.0e-117
WP_023087658.1|2775794_2777087_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	97.0	6.9e-254
WP_012614375.1|2777086_2778103_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.7	5.0e-191
WP_003082462.1|2778208_2779033_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
2786593:2786609	attR	CGGCGATGAACAGCGGC	NA	NA	NA	NA
>prophage 4
NZ_CP050326	Pseudomonas aeruginosa strain DVT423 chromosome, complete genome	6716245	4085099	4123563	6716245	plate,tail	Enterobacteria_phage(33.33%)	33	NA	NA
WP_023087493.1|4085099_4086431_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003124582.1|4086490_4086967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089493.1|4087175_4087721_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003089494.1|4087743_4089228_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089495.1|4089301_4089799_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003122696.1|4089811_4090237_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_023087492.1|4090220_4092014_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003114517.1|4091977_4092994_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_023087491.1|4092995_4095545_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	5.5e-77
WP_003122693.1|4095566_4096139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003104930.1|4096298_4096487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023087490.1|4096486_4098493_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.5	1.3e-41
WP_003114514.1|4098503_4099040_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003089513.1|4099062_4099458_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003110901.1|4099734_4100376_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003115787.1|4100576_4101782_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003160318.1|4102198_4104514_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003089521.1|4104510_4104981_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003104944.1|4105246_4105483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089526.1|4105777_4106020_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104946.1|4106096_4107248_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003114511.1|4107344_4108265_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003089535.1|4108306_4108630_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003139299.1|4108810_4111099_-	acylase	NA	NA	NA	NA	NA
WP_003089540.1|4111221_4112553_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_003122684.1|4112669_4113149_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003144014.1|4113309_4114305_+	FecR family protein	NA	NA	NA	NA	NA
WP_003089547.1|4114405_4115581_+	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_023087489.1|4115580_4117572_+	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	41.9	9.0e-35
WP_003120134.1|4117577_4119002_+	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003163333.1|4119050_4120697_-	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_023087488.1|4120910_4122257_+|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003122677.1|4122279_4123563_+|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
>prophage 5
NZ_CP050326	Pseudomonas aeruginosa strain DVT423 chromosome, complete genome	6716245	4573651	4580545	6716245	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090386.1|4573651_4574320_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_003090387.1|4574430_4574826_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090389.1|4574822_4575182_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090391.1|4575181_4575487_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003119979.1|4575483_4575819_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003160436.1|4575815_4576799_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.6e-141
WP_003097628.1|4576886_4577861_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003160439.1|4577865_4579263_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097631.1|4579264_4580545_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 6
NZ_CP050326	Pseudomonas aeruginosa strain DVT423 chromosome, complete genome	6716245	5697750	5706778	6716245		Bacillus_phage(33.33%)	8	NA	NA
WP_003092260.1|5697750_5698791_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003092262.1|5698924_5699431_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_012613731.1|5699578_5700586_+	TolB family protein	NA	NA	NA	NA	NA
WP_012613730.1|5700711_5703279_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092272.1|5703345_5703669_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113871.1|5704094_5705099_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003115226.1|5705203_5706097_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003098558.1|5706142_5706778_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
