The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	53416	108517	6805219	plate,transposase	Dishui_lake_phycodnavirus(20.0%)	55	NA	NA
WP_003458478.1|53416_54118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_034059389.1|54157_54478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077488357.1|54522_54909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121412787.1|54908_55190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088136366.1|55376_55622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121412788.1|55618_55939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083536.1|56522_56918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079389379.1|57188_58598_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_004351946.1|58761_60135_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003111706.1|60630_61317_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_003083569.1|61347_61701_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|61697_62363_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003118492.1|62377_62761_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043094057.1|63042_64551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108112466.1|65313_65454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083584.1|65515_65653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003111526.1|66278_68111_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	28.3	2.7e-17
WP_003083588.1|68163_68592_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003111523.1|68800_69349_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	6.1e-34
WP_003083593.1|69387_69894_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_010791735.1|70072_71023_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_174712969.1|70990_71929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003083599.1|72036_72924_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003118562.1|72986_73691_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|73774_74230_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003114662.1|74340_74574_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|74585_75023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|75079_75496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118564.1|75587_76715_+	aminopeptidase	NA	NA	NA	NA	NA
WP_003114660.1|76722_77706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106611.1|77738_78404_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003106612.1|78396_78939_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|79016_81062_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|81058_81334_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_105753353.1|81422_82481_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_003106614.1|82710_83625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106615.1|83686_85399_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003083634.1|85391_86591_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003114657.1|86590_87310_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	2.1e-18
WP_174712971.1|87306_90405_-	protein kinase	NA	M1PCM5	Moumouvirus	27.4	1.2e-22
WP_003106965.1|90412_91141_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003106966.1|91150_91831_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_009875647.1|91827_95358_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_003115051.1|95354_96704_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_003115052.1|96710_98045_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004351964.1|98060_98525_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_073660370.1|98569_100045_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_023114795.1|100412_101447_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|101535_102054_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_121413080.1|102066_103563_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|103638_104127_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|104294_105140_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003104971.1|105141_105651_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|105647_107507_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003104969.1|107470_108517_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	627192	712469	6805219	holin,tRNA,plate,tail	Pseudomonas_phage(39.02%)	91	NA	NA
WP_023113352.1|627192_628218_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	6.3e-109
WP_003085061.1|628296_628866_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_031628438.1|628949_629303_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|629293_629836_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|629808_631041_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|631084_631591_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|631685_633239_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|633235_634507_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_030047522.1|634607_636530_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|636808_637141_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|637184_638036_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|638035_638416_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|638452_639259_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003123920.1|639374_640361_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|640357_641650_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_030047517.1|641630_644441_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_031684171.1|644573_646286_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.5	9.4e-283
WP_003099554.1|647557_648574_+	phosphotransferase	NA	NA	NA	NA	NA
WP_174712991.1|648570_649245_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|649246_650005_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_023090306.1|650005_651073_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003117962.1|651224_653618_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|653663_654296_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|654424_655459_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|655692_656802_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|656857_657904_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|658018_659266_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|659371_660202_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|660325_661000_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|660999_661818_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|661890_663369_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|663686_664001_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|664100_664871_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_023085664.1|664955_665126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|665328_665529_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|665576_665936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073625183.1|666299_666749_+|holin	holin	holin	B5TK61	Pseudomonas_phage	54.2	1.0e-26
WP_003101620.1|666770_667286_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003121844.1|667282_667840_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_121417647.1|667992_668319_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	59.3	1.2e-29
WP_121417649.1|668315_669203_+|plate	baseplate J/gp47 family protein	plate	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003142803.1|669195_669729_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	6.7e-62
WP_023085661.1|669730_671806_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	50.5	2.1e-199
WP_031805528.1|671802_672261_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003085173.1|672303_673464_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003129212.1|673476_673980_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003085178.1|673994_674339_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058158762.1|674508_676746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|676755_677628_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|677602_677809_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_058158763.1|677866_678850_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.4e-105
WP_121417652.1|678882_679512_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.9	3.8e-88
WP_014602438.1|679508_679871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|679867_680125_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|680440_680935_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|680946_681294_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_058158765.1|681323_681578_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_121417654.1|681624_683463_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|683455_683797_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|683804_684500_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|684502_685273_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_003117974.1|685327_685930_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_033939577.1|685988_689603_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	54.7	0.0e+00
WP_160170215.1|689599_689893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121494362.1|689889_690627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023085657.1|690650_691742_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.6e-46
WP_023085656.1|691741_692077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023085655.1|692057_692288_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	62.7	3.3e-18
WP_003113178.1|692383_693436_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.2	4.6e-62
WP_003113177.1|693435_693738_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003161916.1|693734_693965_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	70.3	1.4e-24
WP_121413088.1|694383_694989_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	3.5e-75
WP_003085203.1|694990_696040_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_016561543.1|696036_696873_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	57.3	7.3e-71
WP_003085214.1|696934_697579_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|697850_698273_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003085223.1|698592_699387_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085224.1|699441_700089_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085225.1|700188_700527_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003101642.1|700605_702087_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.5	6.7e-67
WP_010793480.1|702126_702927_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003085240.1|702987_704070_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003085244.1|704191_705160_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|705176_705599_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003113169.1|705889_706924_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085249.1|706923_707643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|707643_708066_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|708143_708494_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003121856.1|708547_709639_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_121412926.1|709641_710985_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003113167.1|711269_712469_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	1517664	1524969	6805219	integrase	Pseudomonas_phage(83.33%)	9	1514201:1514260	1525464:1525545
1514201:1514260	attL	AAAAGGGGTTAGCTTGCGCTAACCCCTTGAAAAATATGGTGGCTACACCGGGACTTGAAC	NA	NA	NA	NA
WP_012614380.1|1517664_1517955_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	1.5e-55
WP_070870539.1|1518493_1518928_+	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	98.6	1.2e-61
WP_003124954.1|1519048_1519300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|1519313_1519532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003163344.1|1520187_1520796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003159569.1|1520805_1521156_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_174713019.1|1521157_1522420_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	53.3	2.1e-109
WP_004352686.1|1522678_1523971_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_004352688.1|1523967_1524969_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
1525464:1525545	attR	AAAAGGGGTTAGCTTGCGCTAACCCCTTGAAAAATATGGTGGCTACACCGGGACTTGAACCTGGGACATCAGCATTATGAAT	NA	NA	NA	NA
>prophage 4
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	2140026	2147290	6805219	integrase	Pseudomonas_phage(100.0%)	9	2135760:2135777	2148235:2148252
2135760:2135777	attL	TGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
WP_033993117.1|2140026_2140314_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.7	5.2e-53
WP_070870539.1|2140829_2141264_+	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	98.6	1.2e-61
WP_003124954.1|2141384_2141636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|2141649_2141868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003163344.1|2142523_2143132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003159569.1|2143141_2143492_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_023093179.1|2143493_2144756_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	55.2	1.3e-116
WP_003123045.1|2145014_2146307_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.0	4.8e-247
WP_003114154.1|2146306_2147290_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.6	4.7e-93
2148235:2148252	attR	TGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
>prophage 5
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	2725364	2733765	6805219	tRNA,integrase	Pseudomonas_phage(85.71%)	10	2721494:2721510	2741328:2741344
2721494:2721510	attL	CGGCGATGAACAGCGGC	NA	NA	NA	NA
WP_023088865.1|2725364_2725655_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
WP_070870539.1|2726342_2726777_+	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	98.6	1.2e-61
WP_003124954.1|2726897_2727149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|2727162_2727381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003163344.1|2728036_2728645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003159569.1|2728654_2729005_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_023124218.1|2729006_2730269_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	55.2	1.3e-116
WP_022581098.1|2730526_2731819_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	96.8	2.0e-253
WP_012614375.1|2731818_2732835_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.7	5.0e-191
WP_003082462.1|2732940_2733765_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
2741328:2741344	attR	CGGCGATGAACAGCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	3653084	3700083	6805219	head,transposase,integrase	Pseudomonas_phage(90.0%)	57	3652527:3652542	3671680:3671695
3652527:3652542	attL	GGCGAGGCGCTCGACC	NA	NA	NA	NA
WP_003088621.1|3653084_3656222_-	multidrug efflux RND transporter permease subunit MexY	NA	S5VTK5	Leptospira_phage	21.1	2.9e-51
WP_003118551.1|3656237_3657428_-	multidrug efflux RND transporter periplasmic adaptor subunit MexX	NA	NA	NA	NA	NA
WP_003100372.1|3658231_3658456_-	DUF3203 family protein	NA	NA	NA	NA	NA
WP_003160152.1|3658609_3659971_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.7	4.1e-71
WP_003088639.1|3660018_3660858_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.7	6.0e-65
WP_003100368.1|3661038_3661461_-	VOC family protein	NA	NA	NA	NA	NA
WP_003127781.1|3661602_3661971_-	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_024007667.1|3661967_3662516_-	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	98.9	1.3e-97
WP_050161920.1|3662515_3663082_-	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	98.4	2.3e-100
WP_015649398.1|3663081_3663294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079455803.1|3663277_3664075_-	HNH endonuclease	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	33.0	2.8e-19
WP_024008023.1|3663998_3664688_-	DUF2786 domain-containing protein	NA	J9SVL0	Pseudomonas_phage	98.7	5.5e-125
WP_023118002.1|3664689_3665313_-	DUF3164 family protein	NA	J9STG3	Pseudomonas_phage	99.5	1.7e-109
WP_023102415.1|3665459_3665714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058183319.1|3665710_3666328_-	hypothetical protein	NA	A0A0S4L050	Pseudomonas_phage	96.0	1.7e-112
WP_058183317.1|3666327_3666771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034084933.1|3666767_3667109_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	96.5	2.5e-54
WP_003127825.1|3667110_3668283_-	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	94.4	1.9e-202
WP_079755184.1|3668282_3670064_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	99.3	0.0e+00
WP_033946007.1|3670066_3670993_-	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	90.9	1.9e-149
WP_015649409.1|3671003_3671312_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	100.0	5.4e-48
WP_003127832.1|3671304_3671790_-	hypothetical protein	NA	Q5ZR01	Pseudomonas_phage	100.0	7.4e-92
3671680:3671695	attR	GGCGAGGCGCTCGACC	NA	NA	NA	NA
WP_046720598.1|3671913_3672138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025921029.1|3672422_3672653_-	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	90.8	1.4e-32
WP_046720599.1|3672766_3673126_+	helix-turn-helix domain-containing protein	NA	E5E3P4	Burkholderia_phage	48.5	2.2e-16
WP_003138152.1|3673836_3674094_+	membrane protein	NA	J9STQ9	Pseudomonas_phage	100.0	5.6e-38
WP_003094227.1|3674096_3674255_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_024007974.1|3674251_3674881_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	99.0	2.4e-119
WP_071538434.1|3674877_3675090_+	hypothetical protein	NA	Q5ZQZ0	Pseudomonas_phage	92.9	1.5e-28
WP_003126999.1|3675076_3675700_+	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	94.2	4.1e-103
WP_003117315.1|3675699_3676020_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_003117314.1|3676016_3676319_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	100.0	1.1e-48
WP_003117313.1|3676321_3676870_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	99.5	7.6e-77
WP_058181538.1|3676871_3678545_+	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.6	0.0e+00
WP_023093201.1|3678538_3680113_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.2	7.6e-287
WP_016852447.1|3680102_3681341_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	99.5	5.8e-242
WP_016852448.1|3681342_3681918_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	99.0	2.9e-103
WP_003121593.1|3683243_3683648_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_003127513.1|3683662_3684559_+|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_015649419.1|3684571_3685006_+	hypothetical protein	NA	J9STT1	Pseudomonas_phage	99.0	1.1e-49
WP_003121492.1|3685008_3685524_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_003138162.1|3685520_3685973_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	99.3	2.1e-80
WP_003127509.1|3685969_3686173_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_016852449.1|3686179_3686920_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	98.8	1.8e-134
WP_016852450.1|3686922_3687405_+	hypothetical protein	NA	J9STT8	Pseudomonas_phage	99.4	2.8e-83
WP_049967619.1|3687359_3687542_-	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_174713108.1|3687658_3691291_+	tape measure protein	NA	J9SH65	Pseudomonas_phage	95.9	0.0e+00
WP_043158360.1|3691290_3692250_+	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	97.8	6.9e-190
WP_033967116.1|3692249_3693173_+	hypothetical protein	NA	J9SWM3	Pseudomonas_phage	93.8	8.7e-174
WP_043158359.1|3693172_3694879_+	hypothetical protein	NA	A0A0S4L0R5	Pseudomonas_phage	96.0	0.0e+00
WP_174713109.1|3694865_3695684_+	phage BR0599 family protein	NA	J9SN93	Pseudomonas_phage	98.9	2.9e-165
WP_023117665.1|3695693_3695924_+	hypothetical protein	NA	J9SHJ9	Pseudomonas_phage	100.0	2.7e-36
WP_078463973.1|3695920_3696151_+	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	96.1	4.2e-37
WP_108222943.1|3696137_3698348_+	hypothetical protein	NA	J9RWA5	Pseudomonas_phage	97.7	0.0e+00
WP_024947731.1|3698344_3699493_+	hypothetical protein	NA	J9SP76	Pseudomonas_phage	94.2	3.3e-215
WP_024947732.1|3699489_3699780_+	hypothetical protein	NA	A0A1C6ZDQ9	Pseudomonas_phage	93.8	6.9e-45
WP_024947733.1|3699858_3700083_+	hypothetical protein	NA	A0A0S4L2Y7	Pseudomonas_phage	93.2	8.8e-32
>prophage 7
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	4082398	4121743	6805219	tail,plate	Enterobacteria_phage(33.33%)	33	NA	NA
WP_020750612.1|4082398_4083730_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003450945.1|4083789_4084266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089493.1|4084473_4085019_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003089494.1|4085041_4086526_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089495.1|4086599_4087097_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003124581.1|4087109_4087535_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003124580.1|4087518_4089312_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023128106.1|4089275_4090292_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_019371762.1|4090293_4092843_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	4.2e-77
WP_003116944.1|4092933_4093809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003116945.1|4093878_4094664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713126.1|4094670_4096674_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.6	9.1e-43
WP_003114514.1|4096684_4097221_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003089513.1|4097243_4097639_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003110901.1|4097915_4098557_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023128107.1|4098757_4099963_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003160318.1|4100379_4102695_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003089521.1|4102691_4103162_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_023117344.1|4103427_4103664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089526.1|4103958_4104201_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104946.1|4104267_4105419_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003114511.1|4105515_4106436_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003089535.1|4106477_4106801_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_121417714.1|4106981_4109270_-	acylase	NA	NA	NA	NA	NA
WP_023086214.1|4109392_4110724_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_003103620.1|4110856_4111336_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003120136.1|4111499_4112495_+	FecR family protein	NA	NA	NA	NA	NA
WP_003089547.1|4112595_4113771_+	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_121417712.1|4113770_4115762_+	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	1.2e-34
WP_003120134.1|4115767_4117192_+	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_033992941.1|4117240_4118875_-	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_174713128.1|4119090_4120437_+|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003122677.1|4120459_4121743_+|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
>prophage 8
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	4380612	4397376	6805219	terminase,protease,portal,head,holin,capsid	Pseudomonas_phage(61.11%)	20	NA	NA
WP_014602838.1|4380612_4381608_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
WP_016561968.1|4381674_4382034_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	51.4	1.7e-16
WP_023123383.1|4382033_4383230_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	57.7	1.2e-114
WP_174713142.1|4383226_4384702_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.1	1.4e-197
WP_015648941.1|4384701_4384926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031631455.1|4384941_4386870_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	65.2	1.4e-253
WP_031627904.1|4386841_4387387_-|terminase	terminase small subunit	terminase	A0A1B0Z033	Pseudomonas_phage	63.7	1.8e-57
WP_033979785.1|4387601_4388339_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.7	2.5e-43
WP_174220302.1|4388435_4388867_-	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	1.3e-50
WP_033979786.1|4388884_4389502_-	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	89.8	2.8e-104
WP_003119044.1|4389498_4389834_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_033979787.1|4390033_4390216_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	52.5	2.1e-07
WP_033979789.1|4391060_4391930_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	94.5	6.3e-158
WP_033979790.1|4391958_4392402_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	94.6	4.1e-73
WP_174713303.1|4392394_4393003_-	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	2.0e-41
WP_016046669.1|4393939_4394512_-	hypothetical protein	NA	H2BD67	Pseudomonas_phage	100.0	9.3e-102
WP_016561979.1|4394543_4394762_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	63.2	6.4e-19
WP_023088260.1|4395141_4395714_+	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	91.7	1.9e-86
WP_124136131.1|4395748_4395931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078459554.1|4396284_4397376_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.6	1.1e-15
>prophage 9
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	4400945	4411099	6805219		Pseudomonas_phage(44.44%)	16	NA	NA
WP_016561982.1|4400945_4401122_+	hypothetical protein	NA	A0A2H4J8U0	uncultured_Caudovirales_phage	71.4	1.2e-15
WP_023097515.1|4401183_4402146_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_023097514.1|4402164_4403142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016561985.1|4403150_4403495_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016561986.1|4403616_4403829_+	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	94.3	5.8e-33
WP_003099041.1|4404746_4405118_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_003451734.1|4405617_4405770_+	hypothetical protein	NA	H2BD54	Pseudomonas_phage	98.0	8.1e-13
WP_003099037.1|4405753_4405975_+	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_009314056.1|4405971_4406181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033979801.1|4406191_4407100_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	71.6	3.6e-124
WP_153578273.1|4407974_4408133_+	hypothetical protein	NA	A0A1B0VM49	Pseudomonas_phage	56.4	2.9e-05
WP_052155638.1|4408122_4408428_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_033979804.1|4408511_4408772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033937788.1|4408895_4410116_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	70.6	1.8e-171
WP_023104444.1|4410128_4410374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033937786.1|4410373_4411099_+	hypothetical protein	NA	A0A2H5BFW5	Vibrio_phage	45.9	5.4e-54
>prophage 10
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	4466040	4472934	6805219	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090386.1|4466040_4466709_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_003090387.1|4466819_4467215_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090389.1|4467211_4467571_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003116720.1|4467570_4467876_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090393.1|4467872_4468208_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003097625.1|4468204_4469188_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003097628.1|4469275_4470250_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003160439.1|4470254_4471652_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097631.1|4471653_4472934_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 11
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	4701604	4747486	6805219	head,integrase	Pseudomonas_phage(82.76%)	64	4729012:4729027	4751314:4751329
WP_174713194.1|4701604_4702117_+	hypothetical protein	NA	Q5QF67	Pseudomonas_virus	92.3	8.7e-91
WP_023082390.1|4702120_4702387_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	100.0	6.3e-45
WP_174713309.1|4702422_4702698_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	82.0	2.0e-33
WP_174713196.1|4702727_4703096_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	84.4	1.0e-45
WP_174713198.1|4703092_4703527_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	97.9	2.1e-74
WP_124127309.1|4703697_4704036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058012998.1|4704233_4704554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058012991.1|4704537_4704819_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_174713200.1|4704815_4705022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713202.1|4705023_4706934_-	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	61.6	3.2e-45
WP_174713203.1|4706995_4709719_-	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	84.2	0.0e+00
WP_174713205.1|4709690_4710098_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	94.8	9.3e-72
WP_034001814.1|4710102_4710594_-	DUF1833 family protein	NA	A0A125RNN4	Pseudomonas_phage	98.2	9.2e-90
WP_023094692.1|4710577_4711045_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.1	9.3e-92
WP_174713206.1|4711041_4713531_-	tape measure protein	NA	A0A127KNB7	Pseudomonas_phage	90.0	0.0e+00
WP_174713208.1|4713530_4714148_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	97.6	7.0e-111
WP_174713209.1|4714144_4715140_-	Ig-like domain-containing protein	NA	H2BD89	Pseudomonas_phage	94.6	2.7e-165
WP_174713211.1|4715154_4715529_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	97.6	6.4e-67
WP_058169530.1|4715525_4715930_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	92.5	7.1e-64
WP_058151272.1|4715931_4716252_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	93.4	1.1e-54
WP_174713212.1|4716248_4716650_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	95.5	1.9e-69
WP_174713214.1|4716734_4717193_-	DivIVA domain-containing protein	NA	A0A125RNM4	Pseudomonas_phage	69.7	6.9e-47
WP_174713215.1|4717203_4718295_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	90.1	1.5e-188
WP_033979153.1|4718310_4718760_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.3e-77
WP_174713217.1|4718763_4720041_-	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	98.8	6.9e-214
WP_174713219.1|4720044_4720968_-|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	98.7	1.9e-168
WP_174713220.1|4720930_4722301_-	DUF1073 domain-containing protein	NA	A0A125RNL9	Pseudomonas_phage	98.2	3.0e-263
WP_016852759.1|4722303_4722501_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	5.2e-28
WP_174713222.1|4722500_4723964_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	83.7	5.3e-242
WP_174713223.1|4723953_4724433_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	90.8	1.5e-65
WP_033997179.1|4724464_4725088_-	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	98.1	2.8e-120
WP_023098997.1|4725084_4725357_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	100.0	8.8e-42
WP_023434898.1|4725359_4725692_-	peptidase M48	NA	A0A125RNL3	Pseudomonas_phage	100.0	2.6e-56
WP_034017703.1|4726083_4726770_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	93.4	3.6e-124
WP_033936255.1|4726766_4727351_-	recombination protein NinG	NA	A0A125RNK9	Pseudomonas_phage	92.3	5.8e-99
WP_033936256.1|4727347_4727818_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	71.8	1.7e-61
WP_174713224.1|4727810_4728017_-	TraR/DksA family transcriptional regulator	NA	A0A0S2SYW7	Pseudomonas_phage	91.0	2.4e-28
WP_169309828.1|4728018_4728501_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	98.1	7.6e-81
WP_052159128.1|4728785_4729601_-	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	53.6	2.4e-74
4729012:4729027	attL	TCGATGATCAGCAGCG	NA	NA	NA	NA
WP_034026878.1|4729590_4730397_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	91.0	1.8e-143
WP_034026816.1|4730396_4731149_-	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	56.0	2.0e-67
WP_023099006.1|4731224_4731536_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	50.6	1.8e-14
WP_023099007.1|4731825_4732491_+	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	40.2	1.8e-43
WP_071536331.1|4732538_4733027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713225.1|4733557_4733764_+	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	95.6	2.1e-32
WP_153574150.1|4734066_4734225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713227.1|4734327_4735272_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	85.4	3.8e-76
WP_071536911.1|4735454_4735667_+	DUF551 domain-containing protein	NA	W6MW45	Pseudomonas_phage	98.5	1.5e-36
WP_003124811.1|4735683_4735989_+	hypothetical protein	NA	A0A0S2SY55	Pseudomonas_phage	46.2	6.9e-11
WP_174713228.1|4736023_4736437_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	96.4	9.2e-75
WP_174713229.1|4736700_4737066_+	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	97.5	4.0e-66
WP_174713231.1|4737062_4737566_+	hypothetical protein	NA	Q9MC57	Pseudomonas_phage	37.6	4.8e-17
WP_174712967.1|4737908_4738121_+	hypothetical protein	NA	B5WZW6	Pseudomonas_phage	95.2	1.9e-15
WP_174713232.1|4738163_4738910_+	phage recombination protein Bet	NA	W6MVM3	Pseudomonas_phage	96.4	7.6e-136
WP_033983786.1|4738893_4739514_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	97.1	5.3e-111
WP_174713234.1|4739510_4739846_+	LytTR family transcriptional regulator	NA	H2BDF6	Pseudomonas_virus	95.5	5.5e-54
WP_003088363.1|4739856_4740015_+	hypothetical protein	NA	Q9MC73	Pseudomonas_phage	100.0	1.3e-24
WP_124209038.1|4740078_4740474_+	hypothetical protein	NA	A0A1B0Z069	Pseudomonas_phage	100.0	2.3e-30
WP_174713236.1|4740470_4741007_+	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	94.4	3.9e-94
WP_058170179.1|4741926_4742250_+	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	99.1	3.0e-57
WP_174713237.1|4742246_4742627_+	hypothetical protein	NA	A0A2K8HNT1	Pseudomonas_phage	99.2	6.0e-65
WP_034085205.1|4742623_4744390_+	DEAD/DEAH box helicase	NA	A0A0U1UNQ7	Pseudomonas_phage	100.0	0.0e+00
WP_003160559.1|4746085_4746370_+	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	100.0	8.0e-46
WP_031628314.1|4746379_4747486_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TP61	Pseudomonas_virus	99.7	3.5e-214
4751314:4751329	attR	TCGATGATCAGCAGCG	NA	NA	NA	NA
>prophage 12
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	4866262	4917216	6805219	protease,transposase,integrase	uncultured_virus(22.22%)	50	4867510:4867528	4921402:4921420
WP_003124459.1|4866262_4867813_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.7	3.0e-118
4867510:4867528	attL	GGCCTGCCACTGGCGGCGT	NA	NA	NA	NA
WP_003121550.1|4867889_4868222_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_006217728.1|4868218_4868614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003097498.1|4868782_4870219_-	Cu(+)/Ag(+) sensor histidine kinase	NA	NA	NA	NA	NA
WP_003097513.1|4870190_4870883_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	9.4e-32
WP_006217733.1|4871137_4873039_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_005408883.1|4873064_4874045_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_003090303.1|4874082_4874568_+	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_003097518.1|4874601_4874874_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_071534985.1|4874987_4877468_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.7	2.1e-89
WP_003090319.1|4877609_4877996_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_003097522.1|4878000_4878927_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003090336.1|4879055_4879340_+	CopK family periplasmic copper-binding protein	NA	NA	NA	NA	NA
WP_003097524.1|4879571_4880462_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003097526.1|4880466_4880772_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023657317.1|4880879_4881521_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016852795.1|4881663_4882119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010791747.1|4882194_4883502_+	TolC family protein	NA	NA	NA	NA	NA
WP_010791748.1|4883517_4885035_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003121560.1|4885031_4888151_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003121561.1|4888406_4889171_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.1	4.0e-23
WP_031684069.1|4889167_4890778_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_010791750.1|4890868_4891798_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010791751.1|4891895_4892162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010791752.1|4892158_4892593_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010791753.1|4892664_4893015_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_010791754.1|4893027_4893327_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003121566.1|4893372_4893735_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_010791755.1|4893774_4895472_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.2e-40
WP_003124452.1|4895489_4895855_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003124451.1|4895851_4896088_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010791756.1|4896084_4897074_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003119931.1|4897084_4897699_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.8	1.5e-36
WP_000801210.1|4897759_4898977_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|4898973_4899882_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_010791757.1|4899884_4901567_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003119991.1|4901704_4902115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071535186.1|4904326_4904659_-	DUF2790 domain-containing protein	NA	NA	NA	NA	NA
WP_031684243.1|4904952_4906890_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	48.0	1.1e-98
WP_003090903.1|4907485_4908259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098798.1|4908320_4908983_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003090905.1|4908992_4909475_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003098802.1|4909471_4910362_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003158678.1|4910444_4912805_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.3	1.8e-45
WP_003114767.1|4912823_4913315_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090910.1|4913311_4913797_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	8.1e-22
WP_003090911.1|4913908_4914307_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003090913.1|4914491_4915703_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003115276.1|4915754_4916207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090915.1|4916340_4917216_+|protease	protease HtpX	protease	NA	NA	NA	NA
4921402:4921420	attR	GGCCTGCCACTGGCGGCGT	NA	NA	NA	NA
>prophage 13
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	5753442	5762471	6805219		Bacillus_phage(33.33%)	8	NA	NA
WP_003092260.1|5753442_5754483_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003092262.1|5754616_5755123_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_023102904.1|5755270_5756278_+	TolB family protein	NA	NA	NA	NA	NA
WP_023102903.1|5756403_5758971_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092272.1|5759037_5759361_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113871.1|5759787_5760792_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_121412621.1|5760896_5761790_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003098558.1|5761835_5762471_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
>prophage 14
NZ_CP050323	Pseudomonas aeruginosa strain DVT429 chromosome, complete genome	6805219	5962945	6026182	6805219	tRNA,terminase,protease,portal,integrase,lysis,holin	Pseudomonas_phage(83.33%)	84	5983675:5983693	6023513:6023531
WP_049291021.1|5962945_5964235_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003092800.1|5964253_5965369_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003115257.1|5965365_5966409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003092804.1|5966405_5967164_-	type 4a pilus biogenesis protein PilF	NA	NA	NA	NA	NA
WP_003092809.1|5967181_5968321_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003092811.1|5968345_5968777_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	7.2e-22
WP_003092814.1|5969020_5969221_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003092818.1|5969247_5969586_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_062877461.1|5969592_5971452_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.3	1.7e-107
WP_003092824.1|5971494_5972016_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003100617.1|5972023_5972347_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	9.8e-24
WP_003092829.1|5972374_5972761_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.2e-52
WP_003092832.1|5972796_5974011_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.2	2.3e-33
WP_003092836.1|5974040_5974532_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_003100615.1|5974676_5975453_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003092842.1|5975452_5976226_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_003092845.1|5976377_5977193_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003092848.1|5977297_5977846_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003100612.1|5978029_5978950_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.9	1.9e-51
WP_016562221.1|5978960_5980823_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003092856.1|5980882_5981221_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.4	5.8e-11
WP_003100607.1|5981264_5982383_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	6.7e-96
WP_003113798.1|5982395_5983439_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
5983675:5983693	attL	TGGCGTAAATTTGGCGTAA	NA	NA	NA	NA
WP_052154628.1|5983717_5984407_-	hypothetical protein	NA	A0A0A0YWF4	Pseudomonas_phage	97.4	1.1e-128
WP_071565428.1|5984426_5984645_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	53.5	4.7e-06
WP_116844081.1|5984856_5985102_-	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	92.3	5.1e-33
WP_023127387.1|5985098_5985410_-	hypothetical protein	NA	A0A1W6JTB1	Pseudomonas_phage	100.0	1.6e-52
WP_034030961.1|5986385_5986667_-	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	3.0e-45
WP_034030959.1|5986666_5987227_-	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.4	7.2e-99
WP_003159082.1|5987231_5987423_-	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_015980916.1|5987415_5988003_-	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	97.4	7.1e-105
WP_015980915.1|5988032_5989691_-	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	98.5	0.0e+00
WP_015980914.1|5989687_5990092_-	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	100.0	4.0e-67
WP_033946345.1|5990104_5990650_-	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	95.6	8.1e-95
WP_021205308.1|5990649_5991060_-	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	97.8	1.0e-65
WP_034030956.1|5991062_5992760_-	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	97.5	0.0e+00
WP_016852557.1|5992759_5993281_-	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	98.3	3.7e-97
WP_174713267.1|5993321_5995805_-	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	96.9	0.0e+00
WP_021205305.1|5995907_5996210_-	hypothetical protein	NA	A0A1W6JT80	Pseudomonas_phage	98.0	2.0e-47
WP_023875722.1|5996271_5996913_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	96.2	5.5e-111
WP_023875724.1|5996994_5997747_-	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	99.6	1.4e-137
WP_015980908.1|5997748_5997943_-	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	98.4	1.5e-27
WP_034030954.1|5997946_5998417_-	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	98.7	1.2e-86
WP_023110593.1|5998413_5998743_-	hypothetical protein	NA	A0A1B0YZU3	Pseudomonas_phage	100.0	3.1e-57
WP_003129701.1|5998739_5999057_-	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	100.0	4.6e-50
WP_019396609.1|5999123_6001217_-|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	98.7	0.0e+00
WP_023875725.1|6001176_6002823_-|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	99.8	0.0e+00
WP_003159476.1|6002822_6003038_-	hypothetical protein	NA	A0A1B0YZU1	Pseudomonas_phage	100.0	8.5e-32
WP_174713268.1|6003028_6005008_-|terminase	phage terminase large subunit family protein	terminase	A0A1W6JT68	Pseudomonas_phage	98.4	0.0e+00
WP_023114595.1|6004979_6005525_-|terminase	terminase small subunit	terminase	A0A1W6JT69	Pseudomonas_phage	100.0	3.1e-94
WP_023114596.1|6005676_6006420_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	1.1e-134
WP_034010592.1|6006416_6006887_-|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	93.6	2.6e-73
WP_023875728.1|6006883_6007126_-	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	51.9	3.2e-19
WP_034010591.1|6007122_6007740_-	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	93.6	3.6e-107
WP_004353177.1|6007736_6008069_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_021205299.1|6008153_6008852_-	Rha family transcriptional regulator	NA	S5MQL6	Escherichia_phage	61.2	4.1e-27
WP_004353175.1|6009219_6009609_-	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	99.2	2.2e-70
WP_034030950.1|6009605_6009884_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	96.7	2.1e-43
WP_034030948.1|6009880_6010570_-	metallophosphoesterase	NA	A0A0A0YWI7	Pseudomonas_phage	96.9	4.4e-130
WP_173603017.1|6010566_6010938_-	hypothetical protein	NA	A0A0A0YQ44	Pseudomonas_phage	98.1	7.7e-49
WP_073673205.1|6010934_6012365_-	replicative DNA helicase	NA	A0A0A0YUG7	Pseudomonas_phage	96.2	3.0e-258
WP_034030944.1|6012361_6013150_-	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	99.6	1.2e-147
WP_034030943.1|6014140_6014326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023124259.1|6014322_6014553_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	98.7	2.0e-39
WP_174713270.1|6014549_6015314_-	Rha family transcriptional regulator	NA	A0A1W6JTB2	Pseudomonas_phage	97.6	2.3e-135
WP_033977750.1|6015310_6015544_-	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	96.1	4.9e-33
WP_044305358.1|6015536_6015815_-	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	80.4	6.4e-32
WP_033977752.1|6015811_6016120_-	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	76.5	2.4e-35
WP_034030939.1|6016116_6016404_-	DUF3077 domain-containing protein	NA	A0A0A0YQ33	Pseudomonas_phage	98.9	2.2e-43
WP_153575528.1|6016400_6016718_-	hypothetical protein	NA	A0A1W6JTB5	Pseudomonas_phage	77.1	6.9e-38
WP_034030938.1|6017246_6017522_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	90.6	9.3e-07
WP_079390076.1|6017621_6018200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034030937.1|6018317_6018701_+	LuxR family transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	82.9	8.8e-48
WP_003119031.1|6018711_6019002_+	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	100.0	7.4e-47
WP_015980928.1|6019012_6019810_+	Bro-N domain-containing protein	NA	A0A1W6JTB0	Pseudomonas_phage	100.0	4.9e-149
WP_023875744.1|6019884_6020115_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	92.1	1.2e-31
WP_034030936.1|6020117_6020453_+	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	89.2	2.7e-48
WP_034030935.1|6020449_6021157_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	97.0	6.9e-46
WP_003085682.1|6021275_6021467_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
WP_034030934.1|6021463_6022177_+	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	94.9	2.0e-125
WP_034030933.1|6022173_6022479_+	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	98.0	1.6e-52
WP_034030976.1|6022500_6023499_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	97.6	2.4e-153
WP_003111696.1|6023921_6025121_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6023513:6023531	attR	TGGCGTAAATTTGGCGTAA	NA	NA	NA	NA
WP_020750775.1|6025117_6026182_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	40.4	2.1e-22
