The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	243209	313943	7887247	tRNA,transposase,bacteriocin	Bacillus_phage(62.5%)	52	NA	NA
WP_174708132.1|243209_243851_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_174708133.1|244002_244278_-	TatA/E family twin arginine-targeting protein translocase	NA	NA	NA	NA	NA
WP_094327589.1|244428_244632_-	photosystem II reaction center protein PsbH	NA	NA	NA	NA	NA
WP_174708134.1|244717_244849_+	photosystem II reaction center protein PsbN	NA	NA	NA	NA	NA
WP_174708135.1|244932_248178_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_174708136.1|248265_249915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708137.1|250236_251259_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174708138.1|252897_254604_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_174708139.1|255475_258712_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	32.5	1.4e-24
WP_174708140.1|259326_260406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708141.1|260459_261443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708142.1|261909_262662_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.2	8.7e-39
WP_174708143.1|262715_264035_+	histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	9.9e-22
WP_174708144.1|264063_264732_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_174708145.1|265286_266723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708146.1|267718_268960_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_174708147.1|269692_270322_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_174708148.1|270454_272128_+	iron uptake porin	NA	Q5GQG9	Synechococcus_phage	28.4	2.1e-08
WP_174708149.1|272209_272476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708150.1|272744_273350_+	DUF3318 domain-containing protein	NA	NA	NA	NA	NA
WP_114082889.1|274168_274573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708151.1|274994_276485_-	carotene isomerase	NA	NA	NA	NA	NA
WP_174708152.1|277113_277764_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_174708153.1|277841_278195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012410570.1|278323_278602_+	YggT family protein	NA	NA	NA	NA	NA
WP_174708154.1|278890_280108_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_174708155.1|280118_281585_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174708156.1|283852_284863_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_174708157.1|284922_285843_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_174708158.1|285968_286805_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_174708159.1|286866_287424_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_174708160.1|287504_288425_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_174708161.1|288883_290932_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	24.2	1.2e-37
WP_174708162.1|291042_292674_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_174708163.1|293796_294192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708164.1|294375_295161_-	DUF4058 family protein	NA	NA	NA	NA	NA
WP_174708165.1|295436_296333_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	30.2	8.2e-20
WP_174707947.1|296329_296467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708166.1|296470_296782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708167.1|296956_298294_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_174708168.1|299485_300136_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174713491.1|300249_300642_+	nuclease	NA	NA	NA	NA	NA
WP_174708169.1|300721_301561_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_174708170.1|301878_302376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708171.1|302642_302828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174708172.1|302899_304183_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.3	1.2e-27
WP_174708173.1|304489_305716_-	(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_174708174.1|305941_306913_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_174708175.1|307195_307426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708176.1|307459_309676_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_174708177.1|310383_310839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708178.1|311069_313943_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.9	1.2e-35
>prophage 2
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	953704	1022337	7887247	transposase,protease	uncultured_Mediterranean_phage(25.0%)	56	NA	NA
WP_174708235.1|953704_954771_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_174708611.1|954907_955159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708612.1|955211_955709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708613.1|955852_956629_+	AIM24 family protein	NA	NA	NA	NA	NA
WP_174708614.1|957062_962405_+	hypothetical protein	NA	A0A1B1IPM9	uncultured_Mediterranean_phage	30.7	6.6e-08
WP_174708615.1|963182_964442_-	FAD-dependent hydroxylase	NA	NA	NA	NA	NA
WP_174708616.1|964628_964820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708617.1|965037_965796_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_174708618.1|965989_967285_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174708619.1|967595_969167_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_174708620.1|969379_969775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708621.1|969909_970176_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174708622.1|970370_970631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708623.1|970664_971102_+	nitrogen fixation protein	NA	NA	NA	NA	NA
WP_174708624.1|971446_971764_+	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_174708625.1|971828_972182_+	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_174708626.1|972268_973525_+	nif11-class peptide radical SAM maturase 3	NA	NA	NA	NA	NA
WP_174707951.1|973559_973760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708627.1|973997_975158_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_174708628.1|975183_976296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708629.1|976295_977312_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_174708630.1|977335_978085_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_174708631.1|978397_978616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708632.1|978642_978834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708633.1|979363_979579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708634.1|979605_979797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708635.1|979967_980225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708636.1|980365_981124_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_174708637.1|981248_982772_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174708638.1|982890_985653_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	34.1	4.7e-58
WP_174708639.1|985546_986272_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174708235.1|987900_988967_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_174708640.1|989090_989969_+	SWIM zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_174708641.1|989970_994182_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	27.4	4.9e-38
WP_174708067.1|994400_995215_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_174708642.1|995379_995730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708643.1|996193_997546_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_174708644.1|997731_999057_+	dihydroorotase	NA	NA	NA	NA	NA
WP_174713519.1|999111_999378_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174713520.1|999800_1000289_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_174708645.1|1000377_1000779_-	VOC family protein	NA	NA	NA	NA	NA
WP_174708646.1|1000798_1001596_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_174708647.1|1002092_1003040_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_174708648.1|1003190_1003991_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_174708649.1|1004066_1004981_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_174708650.1|1005772_1006573_+	RMD1 family protein	NA	NA	NA	NA	NA
WP_174713521.1|1006892_1007498_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012412287.1|1007652_1007865_+	DUF2555 domain-containing protein	NA	NA	NA	NA	NA
WP_174708651.1|1007976_1009182_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	A0A1V0S7W6	Shearwaterpox_virus	38.5	3.3e-24
WP_174708652.1|1009328_1010846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708653.1|1010829_1014237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708654.1|1014239_1017398_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_174708655.1|1017917_1018274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713522.1|1018377_1019400_+	radical SAM protein	NA	NA	NA	NA	NA
WP_174708656.1|1019748_1021230_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_174708657.1|1021443_1022337_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	1762331	1805881	7887247	tRNA,transposase	Ralstonia_phage(33.33%)	36	NA	NA
WP_174709164.1|1762331_1763240_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_174709165.1|1763715_1764063_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174709166.1|1765535_1765889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709167.1|1765910_1766141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709168.1|1766428_1767397_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_174709169.1|1767746_1769783_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.8	2.0e-122
WP_174709170.1|1769882_1770101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709171.1|1770556_1771507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708167.1|1772952_1774290_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_174709172.1|1775070_1775766_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_174713557.1|1775973_1777080_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_174709173.1|1777394_1779233_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_174709174.1|1779338_1780052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709175.1|1780553_1780751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709176.1|1781282_1781618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709177.1|1781781_1784073_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_174709178.1|1784181_1784790_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_174709179.1|1784857_1786261_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_012406985.1|1786913_1787186_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_174709180.1|1787671_1788502_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_174709181.1|1788720_1789554_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_174709182.1|1790076_1790829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709183.1|1791352_1791982_-	DnaJ domain-containing protein	NA	E3T4P7	Cafeteria_roenbergensis_virus	48.1	3.1e-05
WP_174709184.1|1792014_1793112_+	tocopherol cyclase	NA	NA	NA	NA	NA
WP_174709185.1|1794273_1795425_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_174708162.1|1795804_1797436_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_174709186.1|1797714_1798170_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174709187.1|1798460_1798622_+	DUF1392 family protein	NA	NA	NA	NA	NA
WP_174713558.1|1798631_1798880_+	DUF1392 family protein	NA	NA	NA	NA	NA
WP_174709188.1|1799215_1800661_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_174707957.1|1800677_1800932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709189.1|1801226_1801487_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_174709190.1|1801749_1802493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708330.1|1802603_1803560_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	26.7	9.1e-17
WP_174709191.1|1803612_1804464_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_174713559.1|1804762_1805881_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	1915133	1957516	7887247	transposase,protease	Leptospira_phage(40.0%)	34	NA	NA
WP_174708167.1|1915133_1916471_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_174709242.1|1916830_1917787_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_174709243.1|1918911_1919694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709244.1|1919774_1921406_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_174709245.1|1921672_1922398_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174709246.1|1922575_1922746_-	ssl1498 family light-harvesting-like protein	NA	NA	NA	NA	NA
WP_174709247.1|1923259_1924306_-	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_174709248.1|1924289_1925342_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_174709249.1|1925464_1926013_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_174709250.1|1926293_1929380_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.5	9.9e-73
WP_174709251.1|1929385_1929766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709252.1|1929955_1933078_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	1.1e-74
WP_174709253.1|1933074_1934628_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174709254.1|1934875_1935847_-	RNA polymerase sigma factor, RpoD/SigA family	NA	F4YCU2	Synechococcus_phage	37.7	6.1e-45
WP_174709255.1|1935975_1936884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709256.1|1936929_1938210_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.3	3.2e-25
WP_174709257.1|1938324_1938696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709258.1|1938970_1940230_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_174709259.1|1940233_1940881_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_174713562.1|1941454_1941829_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174709260.1|1942208_1942361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709083.1|1942715_1943396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709084.1|1943573_1944338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174713563.1|1946201_1946855_+	AAA family ATPase	NA	K7R2R7	Vibrio_phage	41.6	3.3e-34
WP_174708067.1|1946967_1947781_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_174713564.1|1947803_1948046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709261.1|1948148_1948430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709262.1|1950573_1950945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709263.1|1952165_1952831_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_174709264.1|1952924_1953083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709265.1|1953420_1953585_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_174709266.1|1953807_1954536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709267.1|1955938_1956247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174708235.1|1956450_1957516_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	1966388	2025337	7887247	transposase	Feldmannia_species_virus(25.0%)	38	NA	NA
WP_174708137.1|1966388_1967411_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174709273.1|1968334_1968661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709274.1|1968709_1968991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709275.1|1969448_1969859_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_174709276.1|1970296_1970485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174713566.1|1973533_1974862_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_174707959.1|1975085_1975544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709277.1|1978045_1978309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709278.1|1979260_1979860_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_174709279.1|1979967_1980996_-	CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6	NA	NA	NA	NA	NA
WP_174709280.1|1984793_1985258_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_174709281.1|1985254_1985425_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_174709282.1|1985688_1986801_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174709283.1|1988621_1995572_+	AAA family ATPase	NA	B5LWE2	Feldmannia_species_virus	24.6	2.1e-06
WP_174709284.1|1995555_1996185_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_174709285.1|1996430_1997024_+	DsbA family protein	NA	NA	NA	NA	NA
WP_174713567.1|1998367_2000182_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_174709286.1|2000190_2000820_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_174709287.1|2001466_2002024_+	DsbA family protein	NA	NA	NA	NA	NA
WP_174709288.1|2002123_2002300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709289.1|2002283_2002718_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_174709290.1|2002815_2003322_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_174709291.1|2003507_2004257_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	6.4e-18
WP_174709292.1|2004789_2006229_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_174709293.1|2006394_2007387_+	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	35.6	6.5e-50
WP_174709294.1|2007724_2008120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708137.1|2010273_2011296_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174709295.1|2013290_2014478_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_174709296.1|2014711_2015062_+	phospholipid-binding protein	NA	NA	NA	NA	NA
WP_174709297.1|2015110_2015545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709298.1|2016333_2016813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709299.1|2017134_2017428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709300.1|2017598_2017868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709301.1|2018680_2018932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174708162.1|2019617_2021249_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_174709302.1|2021211_2022006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709303.1|2022894_2023788_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_174713568.1|2024416_2025337_-|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	37.5	6.2e-47
>prophage 6
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	2654618	2721805	7887247	transposase,protease	Bacillus_phage(33.33%)	55	NA	NA
WP_174709691.1|2654618_2655425_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_174709692.1|2655746_2656868_-	geranylgeranyl reductase family protein	NA	NA	NA	NA	NA
WP_174709693.1|2657053_2657602_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_174709694.1|2657588_2658317_-	UMP kinase	NA	NA	NA	NA	NA
WP_174709695.1|2658388_2658943_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_174709696.1|2659031_2659178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709697.1|2659394_2660297_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_174709698.1|2661131_2661281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709699.1|2661912_2662128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709700.1|2662450_2662768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709701.1|2662798_2664967_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.4	3.5e-40
WP_174709702.1|2665046_2666555_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174709703.1|2667613_2667901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709704.1|2668432_2669905_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_174709705.1|2670372_2670888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709706.1|2671300_2672548_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_174709707.1|2672547_2673111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709708.1|2673465_2675712_+	GAF domain-containing protein	NA	W8CYF6	Bacillus_phage	29.5	3.4e-22
WP_174709709.1|2677119_2679057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709710.1|2679134_2679560_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174713608.1|2679650_2681186_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	37.9	3.8e-81
WP_174709711.1|2681185_2682250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709712.1|2682242_2683619_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_174709713.1|2683664_2684288_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_174709714.1|2684342_2685407_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	42.0	4.2e-23
WP_174709715.1|2685384_2687055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709716.1|2687316_2690499_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	6.2e-54
WP_174709717.1|2690495_2691194_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_174709718.1|2691750_2692587_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_174713609.1|2692590_2694282_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_174708017.1|2698755_2699778_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174709719.1|2700045_2701335_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_174709720.1|2701517_2702954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709721.1|2703018_2703213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709722.1|2703459_2704233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709723.1|2705817_2706702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174713610.1|2706772_2707366_-	DUF1517 domain-containing protein	NA	NA	NA	NA	NA
WP_174713611.1|2707473_2709048_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_174713612.1|2709117_2709957_+	prephenate/arogenate dehydrogenase	NA	NA	NA	NA	NA
WP_174709724.1|2710273_2710564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709725.1|2710964_2711108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709726.1|2711091_2711310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709727.1|2711341_2712028_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174709728.1|2712044_2712401_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_174707960.1|2712393_2712552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709729.1|2712612_2712963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709730.1|2713126_2714128_-	apocytochrome f	NA	NA	NA	NA	NA
WP_174709731.1|2714234_2714774_-	cytochrome b6-f complex iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012406962.1|2715002_2715311_+	DUF3067 family protein	NA	NA	NA	NA	NA
WP_174709732.1|2715459_2717091_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_174709733.1|2717475_2718003_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_174709734.1|2718230_2718809_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	32.6	1.0e-10
WP_174709735.1|2718815_2719190_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_174709736.1|2719435_2720401_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_174708137.1|2720782_2721805_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	2738030	2790545	7887247	tRNA,transposase,protease	Hokovirus(22.22%)	46	NA	NA
WP_174709748.1|2738030_2738732_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_174709749.1|2738908_2741545_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.5	2.9e-28
WP_174709750.1|2741629_2741947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709751.1|2741953_2743288_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_114082400.1|2743319_2743736_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_174709752.1|2743781_2744036_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_174709753.1|2744147_2744351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709754.1|2744533_2747845_+	helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	21.2	7.7e-15
WP_174709755.1|2748082_2749177_+	DUF4350 domain-containing protein	NA	NA	NA	NA	NA
WP_114082403.1|2749249_2750200_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_174709756.1|2750325_2750805_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_174709757.1|2750843_2751569_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_174709758.1|2751767_2752466_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_174709759.1|2752532_2753177_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_174709760.1|2753618_2756180_+	GAF domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.3	1.1e-16
WP_174709761.1|2756176_2756623_+	response regulator	NA	NA	NA	NA	NA
WP_174713613.1|2756628_2758908_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	24.3	1.2e-14
WP_174709762.1|2759100_2760012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709763.1|2760017_2760167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709764.1|2760206_2761298_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_174709765.1|2761343_2761541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709766.1|2761744_2761981_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.5	1.1e-16
WP_174709767.1|2762042_2762744_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_174709768.1|2763220_2763721_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174709769.1|2763784_2764132_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174709770.1|2764476_2769657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709771.1|2769626_2770964_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_174708235.1|2771504_2772570_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_174709772.1|2772771_2773629_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_174709773.1|2773848_2774079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709774.1|2774571_2775366_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_174709775.1|2775411_2775756_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_174709776.1|2775740_2777372_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_174709777.1|2777813_2778794_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_174709778.1|2778838_2779708_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_174709779.1|2780297_2780945_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_174709780.1|2781106_2781832_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.5	2.3e-36
WP_174709781.1|2782177_2782444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709782.1|2782987_2784508_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	54.6	1.3e-81
WP_174713614.1|2785086_2785719_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_174709783.1|2786377_2786629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709784.1|2787288_2787642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713615.1|2787682_2788090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709785.1|2788289_2788910_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_174709786.1|2789149_2789761_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.5	1.3e-45
WP_174709787.1|2789882_2790545_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	37.7	3.4e-23
>prophage 8
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	3030045	3100025	7887247	transposase,protease	Megavirus(16.67%)	52	NA	NA
WP_174708137.1|3030045_3031068_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174709956.1|3031655_3032189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709957.1|3032897_3033770_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174709958.1|3034297_3035695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709959.1|3039173_3039956_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_174709960.1|3040190_3040772_+|protease	retroviral-like aspartic protease family protein	protease	NA	NA	NA	NA
WP_012412753.1|3040797_3041190_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_174709961.1|3041244_3042057_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_174709962.1|3042440_3042821_-	KGK family protein	NA	NA	NA	NA	NA
WP_174709963.1|3042934_3045376_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_174709964.1|3045928_3046486_+	HPP family protein	NA	NA	NA	NA	NA
WP_174709965.1|3046549_3048385_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_174709966.1|3048590_3049640_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_174709967.1|3050438_3050831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709968.1|3050979_3051222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174709969.1|3051302_3051557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709970.1|3051717_3055428_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_174709971.1|3055499_3055694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709972.1|3055838_3056117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174708067.1|3056209_3057024_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_174709973.1|3057283_3057922_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174709974.1|3057978_3059493_-	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_174709975.1|3059704_3061399_+	serine/threonine protein kinase	NA	G5CRS8	Megavirus	25.4	1.4e-07
WP_174709976.1|3061497_3063639_+	serine/threonine protein kinase	NA	A0A1V0SBL0	Catovirus	20.2	7.2e-06
WP_174709977.1|3063772_3064585_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174709978.1|3065176_3065548_+	EamA family transporter	NA	NA	NA	NA	NA
WP_174709979.1|3065601_3066576_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_174709980.1|3066784_3067597_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_174709981.1|3067842_3068043_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_174708017.1|3068338_3069361_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174709982.1|3069486_3070449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709983.1|3070706_3071807_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	27.5	7.0e-13
WP_174709984.1|3072215_3073331_-	anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_174709985.1|3073376_3074606_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_174709986.1|3074732_3075584_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_174713628.1|3075632_3076037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709987.1|3076141_3076969_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	45.2	5.4e-50
WP_174709988.1|3077062_3079294_-	anthranilate synthase	NA	NA	NA	NA	NA
WP_174709989.1|3079801_3080983_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_174709990.1|3081608_3082898_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_174709991.1|3083118_3084315_-	scytonemin biosynthesis PEP-CTERM protein ScyF	NA	NA	NA	NA	NA
WP_174709992.1|3084489_3085854_-	ScyD/ScyE family protein	NA	NA	NA	NA	NA
WP_174709993.1|3085924_3087205_-	ScyD/ScyE family protein	NA	NA	NA	NA	NA
WP_174709994.1|3087262_3088231_-	scytonemin biosynthesis cyclase/decarboxylase ScyC	NA	NA	NA	NA	NA
WP_174709995.1|3088253_3089315_-	tryptophan dehydrogenase ScyB	NA	NA	NA	NA	NA
WP_174709996.1|3089739_3091611_-	scytonemin biosynthesis protein ScyA	NA	NA	NA	NA	NA
WP_174709997.1|3091708_3091861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174709998.1|3093389_3095369_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	1.5e-18
WP_174709999.1|3095565_3096417_+	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	29.5	2.0e-07
WP_012408021.1|3096598_3097801_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_174710000.1|3098419_3099583_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_174713629.1|3099713_3100025_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	3138625	3213519	7887247	tRNA,tail,transposase,plate	Cyanophage(28.57%)	59	NA	NA
WP_174710022.1|3138625_3140086_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_041565237.1|3140453_3140594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710023.1|3140769_3143685_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_174710024.1|3143681_3144029_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_174710025.1|3144032_3144623_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174710026.1|3144730_3145087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710027.1|3145386_3145692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710028.1|3145963_3148189_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	25.7	2.1e-32
WP_174710029.1|3148194_3149040_-	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_174710030.1|3149343_3150624_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_174710031.1|3151048_3151600_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_174710032.1|3151826_3153413_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_174713633.1|3155446_3156277_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_174710033.1|3156287_3157229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710034.1|3157348_3157591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710035.1|3158226_3161343_-	MFS transporter	NA	NA	NA	NA	NA
WP_174710036.1|3161971_3162184_+	high light inducible protein	NA	NA	NA	NA	NA
WP_174710037.1|3162230_3162428_+	high light inducible protein	NA	NA	NA	NA	NA
WP_174713634.1|3162941_3163559_-	universal stress protein	NA	NA	NA	NA	NA
WP_174713635.1|3163912_3164749_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.4	8.7e-32
WP_174710038.1|3164849_3166292_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174710039.1|3166379_3167231_-	nitrate ABC transporter permease	NA	NA	NA	NA	NA
WP_174710040.1|3167977_3169168_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.6	7.6e-21
WP_174710041.1|3169226_3169913_-	ribonuclease III	NA	M1HK80	Acanthocystis_turfacea_Chlorella_virus	37.1	4.1e-19
WP_174710042.1|3170065_3170836_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_174710043.1|3171352_3171961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710044.1|3172004_3172592_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174710045.1|3172683_3174717_+	magnesium chelatase ATPase subunit D	NA	NA	NA	NA	NA
WP_012408070.1|3174775_3175561_-	RNA polymerase sigma factor SigF	NA	C7F449	Cyanophage	40.0	3.5e-14
WP_174710046.1|3175886_3176615_+	Bax inhibitor-1 family protein	NA	NA	NA	NA	NA
WP_174713636.1|3177767_3178661_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_174710047.1|3178745_3179072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710048.1|3179244_3179745_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_174710049.1|3180025_3180817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710050.1|3181127_3183578_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_174710051.1|3183676_3183946_+	YciI family protein	NA	NA	NA	NA	NA
WP_174710052.1|3184171_3184966_+	Tab2/Atab2 family RNA-binding protein	NA	NA	NA	NA	NA
WP_174710053.1|3185152_3185383_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_174710054.1|3185369_3185729_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_174710055.1|3185948_3187148_-	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_174710056.1|3187395_3188424_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_174710057.1|3188497_3190696_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_174710058.1|3190884_3191298_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_174710059.1|3191585_3192068_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174710060.1|3192200_3192698_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_174710061.1|3192816_3194550_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_174710062.1|3194630_3195188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710063.1|3195226_3198769_-	hypothetical protein	NA	A0A1L2BX61	Bacteriophage	35.4	2.3e-09
WP_174710064.1|3198792_3199317_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_174710065.1|3199316_3199556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174713637.1|3200015_3201455_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_174713638.1|3202880_3204599_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_174710066.1|3204954_3205599_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_174710067.1|3205570_3207709_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_174710068.1|3207820_3208501_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_174710069.1|3208592_3209714_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_174710070.1|3210384_3211224_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_174710071.1|3211254_3212916_+|tail	phage tail sheath family protein	tail	H6WFT7	Cyanophage	33.7	1.5e-19
WP_012407860.1|3213063_3213519_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 10
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	3667967	3725123	7887247	tRNA,transposase,protease	Bacillus_phage(37.5%)	43	NA	NA
WP_174710440.1|3667967_3670610_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	37.4	2.8e-60
WP_174710441.1|3671803_3672823_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.5	1.8e-18
WP_174710442.1|3672842_3673520_-|protease	ATP-dependent Zn protease	protease	NA	NA	NA	NA
WP_174710443.1|3673844_3675488_+	lipoxygenase	NA	NA	NA	NA	NA
WP_174710444.1|3675775_3676018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710445.1|3676076_3677018_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_174710446.1|3676992_3677196_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_174708167.1|3678298_3679636_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_174710447.1|3679632_3680661_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_174710448.1|3680717_3681572_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.1	1.6e-12
WP_174710449.1|3681596_3682220_-	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_174710450.1|3682302_3684039_-	Gldg family protein	NA	NA	NA	NA	NA
WP_174710451.1|3684053_3684866_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_174710452.1|3684866_3685877_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	5.6e-25
WP_174710453.1|3686302_3687373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710454.1|3687411_3688251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710455.1|3688393_3690646_+	cadmium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	26.6	9.6e-09
WP_163929371.1|3690716_3691022_+	DUF5132 domain-containing protein	NA	NA	NA	NA	NA
WP_174710456.1|3691392_3691971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710457.1|3691980_3694329_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_174710258.1|3695709_3696018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174710458.1|3697240_3698977_-	flavin reductase	NA	NA	NA	NA	NA
WP_174710459.1|3699119_3699632_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_174710460.1|3699738_3701469_-	flavin reductase	NA	NA	NA	NA	NA
WP_174710461.1|3701677_3702661_+	1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_174710462.1|3702768_3703398_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_174708137.1|3703357_3704380_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174710463.1|3704582_3705731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710464.1|3705859_3706519_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_174710465.1|3706922_3707183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174713662.1|3708290_3708587_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	38.0	3.2e-05
WP_174710466.1|3708598_3709858_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_174710467.1|3709922_3710399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713663.1|3710576_3711647_+	methyltransferase	NA	NA	NA	NA	NA
WP_174710468.1|3713456_3714596_+	3-oxoacyl-ACP synthase III family protein	NA	NA	NA	NA	NA
WP_174710469.1|3714731_3715319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710470.1|3715589_3715997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710471.1|3716282_3718013_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	7.3e-57
WP_174710472.1|3718105_3719938_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.5e-55
WP_174710473.1|3720003_3720750_-	YdcF family protein	NA	NA	NA	NA	NA
WP_174710474.1|3721061_3722402_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_174710475.1|3722550_3723564_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_174709303.1|3724229_3725123_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	4511357	4578760	7887247	transposase,integrase	Vibrio_phage(16.67%)	57	4549791:4549850	4578698:4578788
WP_174709027.1|4511357_4512479_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174710970.1|4512533_4513211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710971.1|4513361_4513859_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_174710972.1|4513898_4514615_+	DUF4336 domain-containing protein	NA	NA	NA	NA	NA
WP_174710973.1|4515043_4515826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710974.1|4515865_4516348_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_174710975.1|4516802_4517126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710976.1|4517422_4518217_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_174713709.1|4518350_4518539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710977.1|4522087_4523002_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_174710978.1|4523078_4523549_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174710979.1|4524003_4525185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710980.1|4526708_4527497_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_174710981.1|4527616_4528423_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_094344845.1|4528632_4528863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710982.1|4528885_4529818_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_174710983.1|4529804_4530446_-	ParA family protein	NA	K7R2R7	Vibrio_phage	32.1	3.0e-16
WP_174710984.1|4530689_4531163_-	shikimate kinase	NA	NA	NA	NA	NA
WP_174710985.1|4531387_4532104_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_100904368.1|4534747_4535269_-	HNH endonuclease	NA	F5B475	Synechococcus_phage	38.3	2.1e-20
WP_174710986.1|4535855_4536836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710987.1|4536912_4537122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710988.1|4537485_4537752_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_174710989.1|4537833_4538067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710990.1|4538093_4538936_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.7	8.8e-16
WP_174710991.1|4539147_4539822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710992.1|4539842_4540376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710993.1|4540733_4541627_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_174710994.1|4541647_4542055_-	nuclease	NA	NA	NA	NA	NA
WP_174710995.1|4542424_4542772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710996.1|4542843_4543266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174710997.1|4543317_4543800_-	DUF4174 domain-containing protein	NA	NA	NA	NA	NA
WP_174710998.1|4543903_4544065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174710999.1|4544289_4545753_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_174711000.1|4546145_4547165_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_174711001.1|4547422_4548490_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_174711002.1|4548650_4549717_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
4549791:4549850	attL	AGAAAATGTGCCTCAAGTCCTAGCCCATCGCTGTGCTTACCTCAATGGATTATTGTCAGT	NA	NA	NA	NA
WP_174711003.1|4550009_4551611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713710.1|4554309_4556604_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_174711004.1|4556991_4559238_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.4	2.0e-51
WP_174711005.1|4559419_4560538_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_114086238.1|4560540_4561332_-	ParA family protein	NA	NA	NA	NA	NA
WP_174711006.1|4562046_4562565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711007.1|4563139_4564099_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_174711008.1|4564109_4564400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711009.1|4564968_4566273_+	MFS transporter	NA	NA	NA	NA	NA
WP_174711010.1|4566826_4567288_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_174711011.1|4568874_4569303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711012.1|4569299_4569707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711013.1|4569889_4570165_-	HU family DNA-binding protein	NA	A0A2H4PAM3	Aphanizomenon_phage	55.6	8.1e-19
WP_174711014.1|4570969_4571530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711015.1|4573129_4573444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711016.1|4573501_4573705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711017.1|4573746_4573968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711018.1|4574482_4575376_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DFH7	Gordonia_phage	26.3	3.0e-06
WP_174713711.1|4575462_4575930_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_174708235.1|4577694_4578760_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
4578698:4578788	attR	AGAAAATGTGCCTCAAGTCCTAGCCCATCGCTGTGCTTACCTCAATGGATTATTGTCAGTTTGAGCCACTTTAAAAAGTGAGATGCTCCCC	NA	NA	NA	NA
>prophage 12
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	5237851	5311908	7887247	transposase,bacteriocin	Organic_Lake_phycodnavirus(20.0%)	59	NA	NA
WP_174711480.1|5237851_5239054_-|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	77.7	2.5e-181
WP_174711481.1|5239166_5240396_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_174711482.1|5240472_5242062_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_174711483.1|5242075_5242672_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_174711484.1|5243165_5243492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711485.1|5243571_5244975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711486.1|5245362_5246718_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_174708235.1|5247352_5248418_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_174711487.1|5249015_5250785_+	asparagine synthase	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.6	1.8e-18
WP_174711488.1|5251194_5251443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711489.1|5251497_5252529_-	VOC family protein	NA	NA	NA	NA	NA
WP_174711490.1|5252718_5253342_+	DUF3859 domain-containing protein	NA	NA	NA	NA	NA
WP_174711491.1|5253347_5255174_+	asparagine synthase	NA	R4TIC1	Phaeocystis_globosa_virus	22.5	1.5e-12
WP_174711492.1|5255143_5256427_+	decarboxylase	NA	NA	NA	NA	NA
WP_174711493.1|5256501_5257803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711494.1|5258128_5258662_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.3	6.0e-10
WP_174711495.1|5258875_5259370_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_174711496.1|5259628_5260495_-	glutamate racemase	NA	NA	NA	NA	NA
WP_174711497.1|5260622_5262515_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	36.9	3.7e-22
WP_174711498.1|5263047_5264943_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	40.8	4.3e-26
WP_174711499.1|5265750_5267229_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_174711500.1|5267428_5267629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711501.1|5267658_5268399_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_174711502.1|5268532_5268895_-	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	37.9	5.3e-18
WP_094330992.1|5269258_5270266_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	24.2	8.1e-08
WP_174711503.1|5270365_5271175_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_174711504.1|5271201_5271837_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_174711505.1|5272551_5272749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711506.1|5273697_5274669_+	solanesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_174711507.1|5274960_5275434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012408510.1|5275638_5276844_+	heterocyst differentiation protein HetZ	NA	NA	NA	NA	NA
WP_174711508.1|5276836_5277814_+	PatU	NA	NA	NA	NA	NA
WP_174713745.1|5278373_5280677_+	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
WP_174711509.1|5280833_5281310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174711510.1|5281395_5282670_-	proton extrusion protein PcxA	NA	NA	NA	NA	NA
WP_174711511.1|5284769_5284859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711512.1|5285415_5289312_+	serine/threonine-protein kinase PknK	NA	A0A1V0SGY7	Hokovirus	29.2	1.8e-15
WP_174708167.1|5290388_5291726_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_174711513.1|5291759_5293334_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_174711514.1|5294579_5295302_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_174708235.1|5295534_5296600_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_174711515.1|5297038_5299846_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_174711516.1|5299979_5302718_+	peptidoglycan-binding protein	NA	A0A1V0SLQ7	Klosneuvirus	33.5	3.0e-28
WP_174711517.1|5302735_5303530_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_174711518.1|5303573_5304635_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_174711519.1|5305070_5305310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711520.1|5305390_5305630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711521.1|5305710_5305950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711520.1|5306030_5306270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711520.1|5306350_5306590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711521.1|5306670_5306910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711522.1|5306990_5307230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711523.1|5307317_5307560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711524.1|5307624_5307882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711525.1|5307911_5308151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711526.1|5308147_5308573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174711527.1|5308717_5308945_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_174711528.1|5309133_5310231_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_174711529.1|5310465_5311908_+|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
>prophage 13
NZ_CP040094	Nostoc sp. TCL240-02 chromosome, complete genome	7887247	7128829	7166136	7887247	transposase	Bodo_saltans_virus(25.0%)	35	NA	NA
WP_174712741.1|7128829_7129789_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	27.3	2.0e-16
WP_174712742.1|7129820_7130648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174712743.1|7130881_7132084_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_174712744.1|7132379_7132991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163935789.1|7133208_7133640_+	biotin carboxylase	NA	NA	NA	NA	NA
WP_174712745.1|7134819_7135425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174712746.1|7135470_7136496_-	glucokinase	NA	NA	NA	NA	NA
WP_174712747.1|7136580_7137228_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_174712748.1|7137508_7137742_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_174712749.1|7137771_7138335_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174712750.1|7138368_7139100_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.0e-15
WP_174712751.1|7139277_7140117_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_174708067.1|7140984_7141799_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_174712752.1|7141978_7142749_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.7e-19
WP_174712753.1|7142796_7143759_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_174712754.1|7143774_7144377_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_174712755.1|7144391_7145342_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_174712756.1|7145349_7146594_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012411375.1|7146820_7147147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174712757.1|7147373_7147880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174712758.1|7148151_7148613_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174712759.1|7148764_7149805_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_174712760.1|7150603_7150858_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174712761.1|7150859_7154597_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	30.0	4.3e-22
WP_174712762.1|7154900_7156112_-	aspartate aminotransferase	NA	NA	NA	NA	NA
WP_174712763.1|7156108_7157299_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_174712764.1|7157962_7158484_-	DUF2518 family protein	NA	NA	NA	NA	NA
WP_174712765.1|7158887_7159097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174712766.1|7159459_7160788_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_114082369.1|7160769_7161612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174712767.1|7161906_7162971_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_174712768.1|7163502_7163880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174713829.1|7163972_7164449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174708235.1|7164475_7165542_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_174712769.1|7165656_7166136_-|transposase	transposase	transposase	NA	NA	NA	NA
