The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054568	Bacillus thuringiensis strain FDAARGOS_791 chromosome, complete genome	5281841	1373952	1435028	5281841	bacteriocin,integrase,coat,protease,tRNA	Bacillus_phage(33.33%)	53	1392398:1392417	1428408:1428427
WP_000125362.1|1373952_1375092_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354030.1|1375104_1376157_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|1376176_1376377_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344460.1|1376373_1377375_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.2e-08
WP_000464508.1|1377380_1377998_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823597.1|1378186_1379131_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871185.1|1379143_1379674_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001079930.1|1379794_1380724_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000426920.1|1380791_1381112_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000721241.1|1381557_1381992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093533.1|1382025_1382670_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000690816.1|1382848_1384696_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025291.1|1385070_1386177_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092246.1|1386207_1387041_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138561.1|1387060_1388590_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973794.1|1388742_1389882_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|1389884_1390427_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510428.1|1390508_1391156_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621721.1|1391237_1392089_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026353.1|1392185_1394102_-	ABC transporter permease	NA	NA	NA	NA	NA
1392398:1392417	attL	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_001011372.1|1394151_1396074_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114531.1|1396048_1396825_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_000865391.1|1396918_1398001_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276720.1|1397990_1398698_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496111.1|1398837_1400124_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|1400123_1400672_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|1400735_1401026_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|1401029_1401374_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|1401385_1401694_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855457.1|1401863_1403252_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599073.1|1403319_1404180_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797461.1|1404172_1404919_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|1405052_1405850_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|1405852_1406539_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975753.1|1406574_1407120_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135493.1|1407134_1407986_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|1408027_1409047_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_000366809.1|1409481_1410903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907107.1|1410862_1413904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913003.1|1413933_1415697_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001087615.1|1415683_1416436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081956.1|1417992_1419360_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000051680.1|1419387_1421580_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	6.9e-44
WP_000849670.1|1421789_1421966_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001089676.1|1421988_1422195_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001212906.1|1423103_1424225_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000682196.1|1424631_1425933_-	collagen-like protein	NA	NA	NA	NA	NA
WP_001013372.1|1426968_1427595_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226277.1|1427641_1428217_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360976.1|1428438_1429401_-	hypothetical protein	NA	NA	NA	NA	NA
1428408:1428427	attR	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_000582048.1|1429566_1430868_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072246.1|1430961_1433607_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.9	8.0e-164
WP_000366997.1|1434002_1435028_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
>prophage 2
NZ_CP054568	Bacillus thuringiensis strain FDAARGOS_791 chromosome, complete genome	5281841	2744790	2753167	5281841		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|2744790_2746098_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|2746186_2746906_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278823.1|2746898_2747153_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666777.1|2747149_2747833_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|2747816_2750036_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|2750020_2751436_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|2751542_2752583_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|2752579_2753167_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 3
NZ_CP054568	Bacillus thuringiensis strain FDAARGOS_791 chromosome, complete genome	5281841	4301794	4311113	5281841		Bacillus_phage(71.43%)	9	NA	NA
WP_000755546.1|4301794_4303057_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194301.1|4303155_4303920_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453763.1|4304160_4305921_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	4.4e-267
WP_171856546.1|4305982_4306687_+	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_001231497.1|4306683_4307757_+	membrane protein	NA	W8CYF6	Bacillus_phage	87.4	1.2e-169
WP_000823554.1|4307781_4308369_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|4308565_4309285_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000103838.1|4309434_4310106_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_001258513.1|4310240_4311113_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	2.7e-68
>prophage 4
NZ_CP054568	Bacillus thuringiensis strain FDAARGOS_791 chromosome, complete genome	5281841	5089379	5096585	5281841		Geobacillus_phage(33.33%)	9	NA	NA
WP_001065246.1|5089379_5090747_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
WP_000720567.1|5091184_5091703_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_001093444.1|5091912_5092299_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655496.1|5092364_5093072_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_000994639.1|5093093_5093447_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288934.1|5093460_5093865_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714651.1|5094112_5095498_+	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.5	1.1e-76
WP_000820167.1|5095500_5095713_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000540634.1|5095778_5096585_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
>prophage 1
NZ_CP054567	Bacillus thuringiensis strain FDAARGOS_791 plasmid unnamed, complete sequence	55939	0	19138	55939	tail,capsid,plate	Bacillus_phage(35.71%)	24	NA	NA
WP_001059035.1|949_1867_+|capsid	phage major capsid protein	capsid	A5GYL9	Lactococcus_phage	34.8	1.2e-45
WP_001131834.1|1883_2066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001128458.1|2071_2461_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.8	3.2e-21
WP_000056960.1|2460_2853_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_000168162.1|2837_3329_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.9	1.1e-39
WP_000273213.1|3331_3733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852141.1|3747_4212_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_001210040.1|4277_4694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229383.1|4771_5032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235292.1|5047_7774_+	hypothetical protein	NA	B5LPS3	Bacillus_virus	46.4	9.4e-75
WP_000383069.1|7773_8655_+|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.6	1.7e-73
WP_000289463.1|8666_10514_+|tail	phage tail protein	tail	A0A2P1JTV8	Anoxybacillus_phage	44.2	2.9e-128
WP_000222205.1|10523_10790_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042329765.1|10850_12440_+|plate	BppU family phage baseplate upper protein	plate	D2XPZ7	Bacillus_virus	41.4	2.9e-76
WP_001152008.1|12454_13123_+	hypothetical protein	NA	A0A2H4J9X9	uncultured_Caudovirales_phage	74.8	7.9e-52
WP_000151216.1|13164_13446_+	hypothetical protein	NA	D2XR31	Bacillus_phage	84.9	4.8e-35
WP_001131587.1|13448_13673_+	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	79.4	5.2e-24
WP_001266380.1|13672_14434_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	84.2	1.3e-122
WP_001173690.1|14630_14984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249931.1|14996_15905_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	4.3e-16
WP_001057807.1|16074_16416_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000272608.1|16412_17678_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.6	1.7e-108
WP_000473803.1|18173_18437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128985.1|18547_19138_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.7	2.3e-10
>prophage 2
NZ_CP054567	Bacillus thuringiensis strain FDAARGOS_791 plasmid unnamed, complete sequence	55939	23099	23921	55939		Enterococcus_phage(100.0%)	1	NA	NA
WP_001018643.1|23099_23921_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	43.8	1.3e-51
>prophage 3
NZ_CP054567	Bacillus thuringiensis strain FDAARGOS_791 plasmid unnamed, complete sequence	55939	30023	55639	55939	terminase,portal	Bacillus_phage(66.67%)	38	NA	NA
WP_000451516.1|30023_30587_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	50.0	1.6e-37
WP_000831284.1|30721_31066_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.0e-43
WP_000448836.1|31085_31790_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	90.4	2.7e-58
WP_000859163.1|31994_32342_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.3	8.3e-21
WP_001189353.1|32838_33987_+	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	33.8	1.8e-51
WP_000721629.1|34026_34176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578778.1|34496_34847_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	49.6	6.9e-23
WP_080011779.1|34978_35200_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	50.0	7.4e-07
WP_001006520.1|35239_36010_+	phage antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	45.1	4.2e-57
WP_000655888.1|36467_36617_+	hypothetical protein	NA	A0A0M5M3T1	Bacillus_phage	72.1	1.8e-09
WP_000780697.1|36629_37112_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	51.2	9.4e-39
WP_001043060.1|37108_37783_+	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	57.9	2.5e-61
WP_000487938.1|37982_38204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073890.1|38204_39020_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JP67	Staphylococcus_phage	54.5	1.4e-58
WP_041184387.1|38970_39852_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.2	1.9e-85
WP_000332351.1|39864_40128_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	3.8e-18
WP_011731652.1|40042_40330_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	80.0	6.4e-35
WP_000811957.1|40326_40590_+	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_000219525.1|40601_41315_+	hypothetical protein	NA	B5LPM7	Bacillus_virus	51.4	4.1e-38
WP_000434347.1|41323_41464_+	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	93.5	3.8e-17
WP_000201869.1|41766_42048_+	glutaredoxin family protein	NA	M4W5X4	Bacillus_phage	56.3	1.1e-15
WP_000712437.1|42058_42235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932236.1|42239_42737_+	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	31.1	1.0e-16
WP_011731650.1|42774_42984_+	hypothetical protein	NA	I1TLG8	Bacillus_phage	95.7	2.0e-33
WP_000455713.1|43024_43624_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	45.6	1.9e-44
WP_000784801.1|45020_45218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292053.1|45220_45409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114345.1|45433_45613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529718.1|45615_46245_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.8	5.9e-49
WP_042329745.1|46382_46769_+	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	97.7	7.5e-63
WP_000432046.1|47844_48171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393224.1|48259_48490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583549.1|48992_49577_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	47.2	6.5e-26
WP_000504255.1|49589_50414_+	GIY-YIG nuclease family protein	NA	D2XPX7	Bacillus_virus	60.6	1.2e-73
WP_000113786.1|50970_51900_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	91.1	8.2e-132
WP_042513780.1|51871_53188_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	71.0	2.5e-182
WP_000182666.1|53187_54726_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	38.6	1.3e-94
WP_001169137.1|54712_55639_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.3	4.5e-45
