The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	0	50530	4955271	head,capsid,plate,terminase,holin,lysis,tail,portal,tRNA	Escherichia_phage(60.0%)	56	NA	NA
WP_038430660.1|0_2289_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_001302990.1|2697_2853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310277.1|2889_3198_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000746343.1|3175_4126_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_000042038.1|4250_4688_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000551925.1|4686_4881_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	8.5e-23
WP_001177885.1|4911_5181_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000038161.1|5393_6428_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156872.1|6427_8200_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085953.1|8373_9228_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_016237184.1|9286_10360_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_038430662.1|10363_11107_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	98.4	1.7e-124
WP_000988633.1|11206_11716_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_038430663.1|11715_11919_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
WP_000123123.1|11922_12204_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_038430665.1|12203_12701_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_038430667.1|12715_13144_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	1.5e-59
WP_038430668.1|13128_13554_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	3.0e-65
WP_000917182.1|13661_14129_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001782.1|14121_14574_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_038430670.1|14640_15276_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.0e-109
WP_000127163.1|15272_15620_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121479.1|15624_16533_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285307.1|16525_17137_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_064162274.1|17133_18465_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.2	6.6e-175
WP_038430673.1|18464_19067_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	1.1e-95
WP_038430672.1|19038_19479_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.7e-50
WP_074193016.1|19481_19880_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.1	1.3e-12
WP_038430674.1|19907_20501_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	4.6e-104
WP_001286734.1|20560_21751_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|21763_22282_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|22337_22613_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|22645_22765_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_038430675.1|22757_25205_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
WP_000978889.1|25219_25699_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_016240314.1|25698_26862_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000468308.1|26943_27162_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292812.1|27481_29764_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|29818_30676_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_061092633.1|31081_32842_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_000642852.1|32971_33664_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_061092634.1|33862_34951_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	4.1e-82
WP_061092635.1|35021_36305_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001353317.1|36473_37238_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|37410_38094_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|38204_39878_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|40037_40322_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_061092636.1|40527_42792_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551273.1|42828_44577_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	4.3e-57
WP_061092637.1|44573_45560_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_061092638.1|45596_46829_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|46880_47063_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011612.1|47059_47806_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|47959_48853_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|48829_49609_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|49744_50530_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	59282	70064	4955271	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|59282_59831_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109455.1|59857_60505_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|60554_61745_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977905.1|61929_63003_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000117881.1|63604_65005_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001330062.1|65173_66376_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_061092639.1|66641_69254_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090490.1|69296_70064_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.2e-29
>prophage 3
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	85835	87743	4955271		Tupanvirus(100.0%)	1	NA	NA
WP_000053102.1|85835_87743_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.1e-53
>prophage 4
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	100355	102410	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_001361412.1|100355_102410_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.3e-20
>prophage 5
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	106644	107304	4955271	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|106644_107304_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 6
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	118298	130612	4955271		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|118298_118511_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|118521_118710_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001323678.1|118684_118915_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|118904_119078_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818468.1|119126_120200_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054746.1|120282_123015_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	7.0e-38
WP_001265012.1|123097_124126_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120126.1|124098_124791_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	5.9e-18
WP_001230244.1|124920_126093_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063150.1|126092_128639_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	2.0e-71
WP_000209909.1|128635_129235_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|129386_129692_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420622.1|129691_130612_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 7
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	134916	137016	4955271		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|134916_135090_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240620.1|135172_136501_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	4.8e-234
WP_001028079.1|136521_137016_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 8
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	152040	152829	4955271		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|152040_152829_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 9
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	159651	161019	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_001518481.1|159651_161019_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 10
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	164410	165244	4955271		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|164410_165244_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 11
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	169379	169913	4955271		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|169379_169913_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 12
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	179221	180142	4955271		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|179221_180142_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 13
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	184804	185050	4955271		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|184804_185050_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 14
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	200896	201838	4955271		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001305885.1|200896_201838_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 15
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	215011	216193	4955271		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|215011_215746_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|215956_216193_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 16
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	219465	221108	4955271		Pseudomonas_phage(50.0%)	2	NA	NA
WP_061092654.1|219465_220107_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	3.4e-28
WP_061092655.1|220103_221108_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 17
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	233431	233689	4955271		Erwinia_phage(100.0%)	1	NA	NA
WP_000800156.1|233431_233689_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	1.2e-05
>prophage 18
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	240976	244699	4955271		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|240976_241678_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251352.1|241677_242922_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_061092660.1|242950_243862_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|243877_244699_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 19
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	247974	249952	4955271		Mycoplasma_phage(100.0%)	2	NA	NA
WP_061092662.1|247974_248832_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|248815_249952_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 20
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	254973	256344	4955271		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|254973_256344_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 21
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	259480	263216	4955271		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|259480_260731_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000871297.1|260833_261157_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.8e-41
WP_032245944.1|261696_261807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373096.1|261859_262264_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332300.1|262484_263216_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 22
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	269084	274228	4955271	transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_024179472.1|269084_271406_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.5	9.4e-92
WP_000979980.1|271463_271799_-	YmgD family protein	NA	NA	NA	NA	NA
WP_001304448.1|271802_272087_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000120097.1|272148_272322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330597.1|272422_272608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071987222.1|272568_272688_+	ATPase	NA	NA	NA	NA	NA
WP_085949836.1|273014_274228_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 23
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	281201	282889	4955271		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|281201_281621_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457630.1|281620_282889_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	6.7e-209
>prophage 24
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	300976	301735	4955271		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|300976_301735_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 25
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	314185	316937	4955271		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033344.1|314185_315865_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|315989_316937_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 26
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	320073	324081	4955271		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|320073_321156_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456458.1|321155_321989_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|321985_322378_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|322381_323191_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|323226_324081_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 27
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	327182	327413	4955271		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|327182_327413_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 28
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	338667	348855	4955271		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|338667_340206_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|340202_340913_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|340912_341590_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555859.1|342493_343336_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001361954.1|343385_343844_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226473.1|343956_344862_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|344953_345967_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|346168_347077_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|347220_347634_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|348237_348855_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 29
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	358704	360719	4955271		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|358704_359718_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|359714_360719_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 30
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	372384	375342	4955271		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983885.1|372384_373746_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	6.6e-37
WP_000763524.1|373746_375342_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
>prophage 31
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	383838	389130	4955271	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559302.1|383838_384597_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.2e-06
WP_000422045.1|384816_385866_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|385901_386153_-	YciN family protein	NA	NA	NA	NA	NA
WP_001361672.1|386532_389130_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 32
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	394054	394645	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|394054_394645_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 33
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	402460	404395	4955271		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484983.1|402460_404395_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 34
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	413316	415335	4955271		Salmonella_phage(50.0%)	2	NA	NA
WP_000135019.1|413316_414480_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	2.8e-28
WP_000573407.1|414528_415335_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 35
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	428125	429391	4955271		Klosneuvirus(100.0%)	1	NA	NA
WP_000069209.1|428125_429391_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.4e-25
>prophage 36
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	443408	444491	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068002.1|443408_444491_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 37
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	458592	459108	4955271		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945046.1|458592_459108_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 38
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	465461	472731	4955271	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001361837.1|465461_466694_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|466948_467932_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123786.1|468409_469783_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	8.6e-53
WP_000081418.1|469911_470847_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001295593.1|471022_471457_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|471597_472731_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 39
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	477685	478675	4955271		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|477685_478675_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 40
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	492212	496115	4955271		Klosneuvirus(100.0%)	1	NA	NA
WP_000139608.1|492212_496115_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 41
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	500054	504711	4955271	transposase	Escherichia_phage(25.0%)	5	NA	NA
WP_001361839.1|500054_500585_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.7	8.3e-20
WP_000731851.1|500829_501003_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001320773.1|501074_501224_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_087522250.1|501323_502693_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001098566.1|503070_504711_+	methyl-accepting chemotaxis protein Trg	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	1.5e-06
>prophage 42
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	514259	519345	4955271	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_061093055.1|514259_515468_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	2.5e-205
WP_071987258.1|515507_516722_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429062.1|516774_517311_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_024179522.1|517383_519345_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.2e-23
>prophage 43
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	522801	523815	4955271		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220389.1|522801_523815_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.9	2.3e-26
>prophage 44
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	530948	533051	4955271		Salmonella_phage(100.0%)	1	NA	NA
WP_000689327.1|530948_533051_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	5.6e-136
>prophage 45
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	536850	539971	4955271		Bacillus_phage(50.0%)	2	NA	NA
WP_000236738.1|536850_537900_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.1	1.8e-18
WP_001176574.1|537994_539971_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.4	5.4e-157
>prophage 46
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	545815	547360	4955271		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|545815_547360_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 47
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	555637	556738	4955271		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768393.1|555637_556738_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 48
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	562749	564508	4955271		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|562749_563034_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605676.1|563033_563312_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	3.7e-27
WP_000642407.1|563497_564508_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 49
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	567781	569687	4955271		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285545.1|567781_568708_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	7.7e-13
WP_000193514.1|568700_569687_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
>prophage 50
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	574003	577810	4955271		Klosneuvirus(50.0%)	2	NA	NA
WP_072275270.1|574003_576403_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426277.1|576427_577810_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 51
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	583088	590024	4955271		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001361867.1|583088_585872_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	2.2e-18
WP_000832491.1|585928_588301_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_061092704.1|588338_590024_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.2	5.0e-10
>prophage 52
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	599476	600704	4955271	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_116315299.1|599476_600704_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
>prophage 53
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	614679	616215	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194893.1|614679_616215_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
>prophage 54
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	624087	625506	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_061092698.1|624087_625506_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 55
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	633253	635383	4955271		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|633253_633637_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803531.1|633668_633887_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_061092694.1|633943_635383_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	8.2e-30
>prophage 56
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	644363	645254	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_000592819.1|644363_645254_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
>prophage 57
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	650144	665582	4955271		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|650144_650348_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527788.1|650383_651844_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
WP_000151245.1|651932_653300_-	MHS family MFS transporter YdfJ	NA	NA	NA	NA	NA
WP_000836077.1|653357_654377_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001295394.1|654388_655603_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001304355.1|655808_656135_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705197.1|656269_656611_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|656645_657206_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_032142801.1|657208_657919_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|658026_658332_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_061092693.1|658530_660957_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	5.0e-213
WP_072275269.1|661017_663441_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.8e-208
WP_000213028.1|663451_664069_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526500.1|664070_664925_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148691.1|664967_665582_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	3.0e-29
>prophage 58
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	683346	684648	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_000732514.1|683346_684648_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	4.2e-17
>prophage 59
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	694543	696355	4955271		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945913.1|694543_696355_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 60
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	716232	717507	4955271	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|716232_717507_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 61
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	724418	725917	4955271		Salmonella_phage(50.0%)	2	NA	NA
WP_001361459.1|724418_724940_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.0e-46
WP_000250656.1|725020_725917_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 62
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	734720	743524	4955271		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101179.1|734720_735548_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|735675_736257_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|736402_737572_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|737737_737827_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|738125_739151_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_174617227.1|739147_740080_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|740192_741404_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|741694_742843_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|742882_743524_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 63
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	749028	751295	4955271		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587589.1|749028_749841_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	34.1	6.5e-08
WP_001070010.1|749844_750630_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001361451.1|750626_751295_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 64
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	759585	764669	4955271		environmental_halophage(33.33%)	5	NA	NA
WP_000222526.1|759585_760806_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
WP_000907976.1|760802_762074_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|762048_762795_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_001308677.1|762804_764292_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|764300_764669_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 65
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	783317	806830	4955271	tRNA	Tupanvirus(20.0%)	23	NA	NA
WP_061092708.1|783317_784958_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	2.9e-31
WP_061092680.1|785008_785752_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_061092679.1|785764_786244_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001049279.1|786254_787214_-	2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	27.9	1.4e-17
WP_001278074.1|787249_788650_-	anion permease	NA	NA	NA	NA	NA
WP_000069371.1|789138_791517_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	2.1e-171
WP_000368046.1|791848_792682_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|792838_793885_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|794016_794208_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_061092678.1|794211_795648_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001361438.1|795710_796424_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|796670_797135_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|797212_797962_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|797961_798513_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|798575_799556_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|799656_799956_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_061092677.1|799960_802348_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|802362_803346_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|803484_803529_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|803651_804008_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|804061_804259_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|804355_804898_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|804901_806830_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 66
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	818119	820381	4955271		Tupanvirus(100.0%)	1	NA	NA
WP_061092674.1|818119_820381_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 67
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	826507	827335	4955271		Bacillus_virus(100.0%)	1	NA	NA
WP_061092672.1|826507_827335_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
>prophage 68
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	834811	836032	4955271		Klosneuvirus(100.0%)	1	NA	NA
WP_000082010.1|834811_836032_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	4.7e-26
>prophage 69
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	842796	843450	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_001361434.1|842796_843450_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 70
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	847840	849796	4955271		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235808.1|847840_849796_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 71
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	854721	858806	4955271		Tupanvirus(50.0%)	4	NA	NA
WP_001135072.1|854721_855363_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	5.0e-19
WP_000438822.1|855455_856814_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|856930_857689_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723719.1|857825_858806_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.8e-07
>prophage 72
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	867619	868474	4955271		Indivirus(100.0%)	1	NA	NA
WP_001330282.1|867619_868474_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 73
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	871792	876369	4955271		Bacillus_phage(100.0%)	3	NA	NA
WP_000219676.1|871792_873076_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621399.1|873222_874698_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|874878_876369_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 74
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	891123	972897	4955271	capsid,plate,protease,terminase,holin,integrase,tail,tRNA	Salmonella_phage(30.65%)	102	900272:900287	981148:981163
WP_077249133.1|891123_892809_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	9.0e-36
WP_000290578.1|893013_893595_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220958.1|893633_894329_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|894386_896297_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_024179480.1|896428_896773_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|897133_897493_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|897612_897792_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854993.1|897865_899227_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	5.2e-42
WP_000456733.1|899230_899809_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|899992_901357_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
900272:900287	attL	GAACGTCTGCTGCTGG	NA	NA	NA	NA
WP_001361422.1|901487_903086_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|903089_904646_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150543.1|905108_906080_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|906142_906943_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|906955_907807_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156267.1|907861_908320_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|908749_909316_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010122.1|909312_910122_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|910287_910497_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|910509_910653_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006850.1|911322_911610_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|911684_911828_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|911986_912226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262188.1|912369_913161_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001328842.1|913337_914711_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|914756_915638_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055782.1|915829_917878_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
WP_022645796.1|917897_918596_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_024181821.1|918692_919190_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001361420.1|919319_920603_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_061092668.1|920571_923205_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024179479.1|923284_924724_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|924841_925078_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|925182_925374_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812752.1|925374_926031_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	1.5e-55
WP_001386857.1|926495_927050_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.4	2.8e-87
WP_016236828.1|927079_927583_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	70.6	1.6e-57
WP_000805555.1|927582_928176_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.9	4.5e-59
WP_001174916.1|928147_928588_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	8.9e-52
WP_174617229.1|928590_929286_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	67.8	4.1e-27
WP_000049950.1|929285_929966_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_097340187.1|929962_931162_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	2.2e-185
WP_001270634.1|931161_931515_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_097444094.1|931514_932267_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.6	1.1e-89
WP_000466689.1|932326_932566_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_000755137.1|932705_933041_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	55.6	1.6e-24
WP_000042293.1|933037_934072_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.5	5.4e-100
WP_000648663.1|934074_934377_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	2.6e-26
WP_089553543.1|934380_935031_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.8	5.3e-61
WP_174617230.1|935030_937037_-	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	75.3	5.3e-160
WP_023565715.1|937214_937667_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109249.1|937670_938111_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_032330418.1|938121_939267_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
WP_033544654.1|939270_939834_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_023908474.1|939808_940198_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_174617231.1|940184_940739_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	3.3e-80
WP_072651311.1|940735_941143_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_174617286.1|941141_941375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174617232.1|941371_942313_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	3.7e-156
WP_072645186.1|942324_942831_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	2.2e-70
WP_174617233.1|942834_944055_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.0	1.2e-202
WP_086353604.1|944069_944807_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_174617234.1|944694_946161_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.5e-268
WP_113421761.1|946160_947783_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_001218996.1|947785_948337_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_001472362.1|948290_948905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113283.1|949037_949223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062898035.1|949366_949759_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	83.7	1.1e-50
WP_001194120.1|949742_950219_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.8	9.2e-87
WP_174617235.1|950222_950564_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	4.8e-53
WP_071779784.1|950727_950943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174617236.1|950911_951481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044782015.1|951714_952326_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	98.5	2.3e-53
WP_000640150.1|952596_953151_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	2.6e-72
WP_000228038.1|953147_953438_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_174617237.1|953437_954037_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	2.7e-107
WP_097340190.1|954596_954809_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.8e-18
WP_000013905.1|955149_955668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000691548.1|955660_955975_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_000622266.1|955976_957143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151128.1|957379_957841_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.1	3.3e-57
WP_001767393.1|957856_958618_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	2.5e-118
WP_000788993.1|958640_959387_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	4.8e-114
WP_001434152.1|959393_960182_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.5	6.1e-43
WP_000702025.1|960259_960682_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001033915.1|960678_960924_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.0	1.0e-17
WP_000410105.1|961020_961440_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379566.1|961746_961899_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000560218.1|962184_962406_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_000245528.1|962399_962576_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_074465218.1|963025_966154_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	79.5	0.0e+00
WP_174617238.1|966165_967218_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	5.1e-114
WP_010989194.1|967281_967476_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_024165285.1|967468_967657_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.8e-17
WP_001311878.1|967763_968045_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189087.1|968010_969087_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_000976484.1|969479_969821_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879323.1|969833_970706_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168737.1|970709_971084_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|971222_971453_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011651.1|971554_972211_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|972234_972897_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
981148:981163	attR	CCAGCAGCAGACGTTC	NA	NA	NA	NA
>prophage 75
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	980950	982426	4955271		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|980950_982426_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 76
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	986425	994766	4955271	transposase	Bacillus_virus(50.0%)	10	NA	NA
WP_001184045.1|986425_987748_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_024179478.1|987763_988696_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|988774_989530_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|989526_990312_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000399664.1|990488_991469_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000568519.1|991735_992746_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_061092987.1|992754_993366_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072127750.1|993504_993570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|993640_994243_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|994244_994766_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 77
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	998659	1000710	4955271		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639276.1|998659_999478_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|999530_999926_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019591.1|999966_1000710_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 78
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1007196	1008930	4955271	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025349.1|1007196_1008930_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 79
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1013437	1019081	4955271		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1013437_1013827_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036374.1|1013841_1014891_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204347.1|1014893_1015754_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483207.1|1015772_1017374_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_001313042.1|1017419_1019081_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 80
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1029168	1030683	4955271		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|1029168_1030683_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 81
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1042661	1043414	4955271		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|1042661_1043414_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 82
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1055076	1055745	4955271		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|1055076_1055745_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 83
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1069775	1082142	4955271		Bacillus_phage(28.57%)	12	NA	NA
WP_174617239.1|1069775_1071470_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1071640_1071823_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1071901_1072819_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212240.1|1072991_1073912_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1073900_1074371_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|1074351_1075770_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_073313489.1|1075836_1076532_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.4e-06
WP_001313057.1|1076571_1076937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174617240.1|1077503_1078562_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.1	4.3e-92
WP_000218220.1|1079153_1080005_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826747.1|1080112_1081471_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|1081470_1082142_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 84
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1085676	1086207	4955271		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1085676_1086207_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 85
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1103575	1104803	4955271	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_116315299.1|1103575_1104803_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
>prophage 86
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1108154	1109387	4955271		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001083460.1|1108154_1109387_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	8.3e-63
>prophage 87
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1126075	1126303	4955271		Morganella_phage(100.0%)	1	NA	NA
WP_001333103.1|1126075_1126303_-	hypothetical protein	NA	A0A1W6JP07	Morganella_phage	81.0	5.6e-10
>prophage 88
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1148559	1150361	4955271	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001323403.1|1148559_1149339_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_021569694.1|1149338_1150361_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
>prophage 89
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1160140	1162299	4955271		Yersinia_phage(33.33%)	4	NA	NA
WP_001234530.1|1160140_1160962_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|1161043_1161523_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|1161538_1162015_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1162077_1162299_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 90
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1166996	1168163	4955271		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830144.1|1166996_1168163_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
>prophage 91
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1175807	1176707	4955271		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1175807_1176707_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 92
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1184064	1191296	4955271		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_000704893.1|1184064_1185231_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	1.9e-109
WP_000043505.1|1185478_1186885_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
WP_157904593.1|1186990_1188064_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016242238.1|1188111_1188909_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016242239.1|1188943_1189411_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_021562653.1|1189400_1190270_-	SDR family oxidoreductase	NA	A0A167RG57	Powai_lake_megavirus	31.4	7.7e-31
WP_016242241.1|1190282_1191296_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.4	1.1e-39
>prophage 93
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1198829	1201292	4955271		Bacillus_phage(50.0%)	2	NA	NA
WP_000183060.1|1198829_1199723_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021562650.1|1199897_1201292_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.3	1.1e-18
>prophage 94
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1207292	1214262	4955271		Bacillus_phage(25.0%)	6	NA	NA
WP_001410433.1|1207292_1208663_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	3.8e-32
WP_024243380.1|1209031_1210468_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	2.8e-46
WP_001718496.1|1210470_1211694_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024243381.1|1211690_1212170_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043623.1|1212172_1213138_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000048190.1|1213140_1214262_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 95
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1218506	1228982	4955271		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1218506_1219346_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137196.1|1219523_1221686_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1221688_1222132_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1222137_1223277_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000454701.1|1223935_1225519_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|1225792_1227646_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234768.1|1227667_1228249_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.0e-31
WP_001295424.1|1228340_1228982_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 96
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1233646	1234999	4955271		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469692.1|1233646_1234999_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 97
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1249173	1256037	4955271	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675162.1|1249173_1250577_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|1250573_1251296_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1251475_1251808_+	YegP family protein	NA	NA	NA	NA	NA
WP_001329834.1|1252016_1252313_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001259171.1|1252314_1252611_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476012.1|1252713_1254075_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_001361579.1|1254404_1254722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|1255137_1256037_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 98
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1265177	1268734	4955271		Serratia_phage(50.0%)	4	NA	NA
WP_000846189.1|1265177_1266182_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000093021.1|1266178_1267144_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1267117_1267864_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001361580.1|1267915_1268734_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
>prophage 99
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1274205	1274757	4955271		Sodalis_phage(100.0%)	1	NA	NA
WP_001273871.1|1274205_1274757_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	2.0e-29
>prophage 100
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1287103	1289137	4955271	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1287103_1289137_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 101
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1304854	1314296	4955271		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292746.1|1304854_1305991_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
WP_001361589.1|1305987_1307988_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001296231.1|1308112_1308574_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001361590.1|1308614_1309085_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001308766.1|1309131_1309851_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001334139.1|1309847_1311533_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001240398.1|1311754_1312486_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|1312545_1312653_+	protein YohO	NA	NA	NA	NA	NA
WP_000783133.1|1312633_1313365_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569365.1|1313369_1314296_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 102
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1327489	1328702	4955271	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949836.1|1327489_1328702_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 103
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1332922	1334641	4955271		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815366.1|1332922_1334641_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
>prophage 104
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1338228	1339059	4955271		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255167.1|1338228_1339059_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 105
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1342739	1343468	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|1342739_1343468_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 106
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1346593	1355743	4955271		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149759.1|1346593_1347721_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	6.7e-27
WP_000389260.1|1347761_1348250_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061648.1|1348309_1349155_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105440.1|1349151_1350105_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1350114_1351248_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126093.1|1351342_1352455_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1352805_1353282_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1353369_1354272_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189132.1|1354332_1355055_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|1355038_1355326_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|1355485_1355743_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 107
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1364309	1365512	4955271		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1364309_1365512_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 108
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1377788	1379660	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_001361716.1|1377788_1379660_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 109
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1382875	1387006	4955271		Synechococcus_phage(50.0%)	3	NA	NA
WP_001361717.1|1382875_1383538_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_001361718.1|1383668_1384568_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209369.1|1384573_1387006_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 110
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1390897	1392490	4955271		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|1390897_1392490_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 111
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1397486	1402712	4955271		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1397486_1398002_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1398054_1398120_-	protein YliM	NA	NA	NA	NA	NA
WP_001361720.1|1398354_1399242_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1399541_1400045_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1400448_1401195_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1401333_1401993_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1401989_1402712_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 112
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1409100	1421189	4955271		Synechococcus_phage(20.0%)	12	NA	NA
WP_000990143.1|1409100_1409778_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	2.4e-19
WP_000146334.1|1409851_1410118_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|1410382_1410643_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443510.1|1410782_1411868_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386516.1|1412008_1412971_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218664.1|1412998_1415149_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001235510.1|1415319_1415601_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_000035214.1|1415600_1416041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000007106.1|1416197_1417562_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001361295.1|1417790_1418462_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001361294.1|1418464_1419460_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001361293.1|1419452_1421189_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 113
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1431789	1432698	4955271		Streptococcus_phage(100.0%)	1	NA	NA
WP_001361290.1|1431789_1432698_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
>prophage 114
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1439025	1440315	4955271		Klosneuvirus(100.0%)	1	NA	NA
WP_001361289.1|1439025_1440315_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.7e-18
>prophage 115
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1450507	1457082	4955271		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891660.1|1450507_1451566_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	4.4e-20
WP_000604045.1|1451568_1452258_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|1452257_1453031_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1453197_1453347_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1453475_1454264_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096836.1|1454331_1455804_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|1456065_1457082_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 116
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1461426	1464946	4955271		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109194.1|1461426_1462479_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
WP_000784342.1|1462794_1463175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951266.1|1463288_1464230_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	3.7e-23
WP_000345402.1|1464226_1464946_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 117
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1498626	1500024	4955271		Bordetella_phage(100.0%)	1	NA	NA
WP_000546467.1|1498626_1500024_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	32.3	6.3e-35
>prophage 118
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1516101	1516857	4955271		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000991075.1|1516101_1516857_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.2e-10
>prophage 119
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1520780	1521572	4955271		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114000.1|1520780_1521572_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	1.3e-08
>prophage 120
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1524950	1536784	4955271		Hokovirus(40.0%)	10	NA	NA
WP_001032685.1|1524950_1526432_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.9e-45
WP_000207165.1|1526474_1527893_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.7e-62
WP_061092806.1|1527889_1528399_-	YbgA family protein	NA	NA	NA	NA	NA
WP_000424924.1|1528499_1528706_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|1529018_1529108_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741122.1|1529107_1530781_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087993.1|1530803_1532852_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.1	9.9e-37
WP_001361278.1|1532860_1533433_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001361277.1|1533425_1536110_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186076.1|1536106_1536784_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 121
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1543346	1544111	4955271		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773282.1|1543346_1544111_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 122
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1548254	1552068	4955271	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287164.1|1548254_1549919_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
WP_061092805.1|1550121_1552068_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
>prophage 123
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1556695	1558360	4955271		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1556695_1558360_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 124
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1562926	1563967	4955271		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1562926_1563967_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 125
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1571920	1575453	4955271		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631389.1|1571920_1572646_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207493.1|1572763_1573699_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367864.1|1573782_1575453_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.9	1.4e-76
>prophage 126
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1582445	1585028	4955271	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157895.1|1582445_1585028_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	1.2e-183
>prophage 127
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1592038	1594478	4955271		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1592038_1593127_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1593266_1594478_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 128
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1599296	1599943	4955271		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1599296_1599680_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1599733_1599943_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 129
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1614032	1616147	4955271		Morganella_phage(50.0%)	2	NA	NA
WP_001308472.1|1614032_1614461_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
WP_000887629.1|1614581_1616147_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 130
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1619210	1621033	4955271		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029771.1|1619210_1620431_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
WP_000502940.1|1620403_1621033_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 131
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1635366	1641408	4955271		Klosneuvirus(50.0%)	3	NA	NA
WP_000140634.1|1635366_1636182_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
WP_000096725.1|1636178_1637312_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077748.1|1637526_1641408_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
>prophage 132
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1652231	1655375	4955271		Leptospira_phage(100.0%)	1	NA	NA
WP_000574034.1|1652231_1655375_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	9.8e-60
>prophage 133
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1658520	1660636	4955271		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|1658520_1659204_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000157197.1|1659193_1660636_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.0e-11
>prophage 134
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1668329	1717907	4955271	head,capsid,protease,terminase,holin,lysis,integrase,tail,portal,transposase	Enterobacteria_phage(49.06%)	64	1667861:1667907	1717921:1717967
1667861:1667907	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_061092798.1|1668329_1669283_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|1669469_1670954_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|1671492_1672161_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016245272.1|1672353_1672647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235975.1|1672657_1673362_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_061092797.1|1673371_1673653_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_061092796.1|1673652_1676025_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
WP_001228252.1|1676089_1676689_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_061092795.1|1676756_1680236_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090882.1|1680296_1680899_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_024177847.1|1680835_1681579_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_001518412.1|1681583_1682282_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
WP_000847401.1|1682281_1682611_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001567091.1|1682607_1685169_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_001518410.1|1685161_1685551_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
WP_001518409.1|1685577_1686000_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_001518408.1|1686015_1686756_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_000683145.1|1686763_1687159_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001518407.1|1687155_1687734_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752994.1|1687745_1688099_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001518405.1|1688110_1688509_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
WP_000063252.1|1688550_1689576_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001299443.1|1689631_1689964_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_001518402.1|1689973_1691293_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
WP_001518401.1|1691273_1692875_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_000198149.1|1692871_1693078_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001518400.1|1693074_1695000_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453566.1|1694974_1695520_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001307652.1|1695908_1696103_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|1696465_1696759_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1696849_1697032_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001518397.1|1697248_1697725_-	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
WP_001120496.1|1697728_1698055_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000150292.1|1699523_1700738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205470.1|1700717_1701074_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_032139865.1|1701158_1701299_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|1701295_1701658_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|1701654_1701945_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224919.1|1701937_1702108_-	NinE family protein	NA	NA	NA	NA	NA
WP_001053033.1|1702107_1702563_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_001309322.1|1702559_1702661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|1702759_1703689_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001567061.1|1703893_1704211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116315299.1|1705064_1706292_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
WP_032139864.1|1707242_1707350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|1707441_1707774_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145912.1|1707841_1708144_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
WP_001566186.1|1708140_1708842_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
WP_077249156.1|1708838_1709858_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.7e-111
WP_061092794.1|1709854_1710394_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_001067459.1|1710475_1710706_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_061092793.1|1710744_1711500_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	4.7e-93
WP_061092792.1|1711580_1711850_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_061092791.1|1711981_1712299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092790.1|1712854_1713061_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
WP_000995439.1|1713136_1713433_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_052953584.1|1713438_1714224_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_024228451.1|1714220_1714901_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_045173744.1|1714897_1715056_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
WP_032255841.1|1715052_1715610_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_001386642.1|1715620_1715902_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|1716000_1716219_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|1716266_1716545_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_061092788.1|1716743_1717907_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
1717921:1717967	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 135
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1724986	1728117	4955271	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_174617249.1|1724986_1725853_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	2.2e-30
WP_000190288.1|1725854_1726067_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143508.1|1726174_1726696_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1726731_1728117_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 136
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1739633	1740779	4955271		Streptococcus_phage(100.0%)	1	NA	NA
WP_001339221.1|1739633_1740779_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	2.2e-49
>prophage 137
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1746969	1748751	4955271		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001571054.1|1746969_1748751_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.4	3.5e-38
>prophage 138
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1755186	1755873	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1755186_1755873_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 139
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1759126	1759804	4955271		Bacillus_virus(100.0%)	1	NA	NA
WP_001298568.1|1759126_1759804_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.2e-26
>prophage 140
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1766870	1770112	4955271		Escherichia_phage(66.67%)	3	NA	NA
WP_061092784.1|1766870_1769375_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_000806442.1|1769432_1769774_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057541.1|1769809_1770112_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 141
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1778348	1786806	4955271		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801816.1|1778348_1779308_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	2.9e-15
WP_001250114.1|1779304_1780267_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001313630.1|1780398_1781043_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1781223_1783098_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1783207_1783813_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1783812_1784142_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|1784194_1786126_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1786254_1786806_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 142
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1793814	1796964	4955271		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1793814_1796964_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 143
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1805800	1809347	4955271		Bacillus_phage(100.0%)	2	NA	NA
WP_001256219.1|1805800_1807582_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.1e-42
WP_061092783.1|1807574_1809347_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.0e-50
>prophage 144
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1812670	1813366	4955271		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817228.1|1812670_1813366_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 145
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1816506	1821553	4955271	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1816506_1816779_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1816987_1819342_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1819529_1820804_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1820929_1821553_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 146
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1845167	1848815	4955271	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_001021161.1|1845167_1845638_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150488.1|1845726_1846830_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	6.3e-54
WP_000543535.1|1846833_1847283_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_000826423.1|1847606_1848815_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.7e-209
>prophage 147
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1852042	1856382	4955271	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000046637.1|1852042_1853014_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1853024_1854872_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1854899_1855232_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1855254_1856382_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 148
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1864980	1874937	4955271		Bacillus_phage(60.0%)	7	NA	NA
WP_000893614.1|1864980_1866276_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.2e-26
WP_000113933.1|1866333_1867023_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221293.1|1867212_1868415_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698851.1|1868411_1871555_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_024179523.1|1871680_1872865_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219315.1|1872992_1873901_-	fructokinase	NA	NA	NA	NA	NA
WP_061092860.1|1874025_1874937_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	1.8e-102
>prophage 149
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1879598	1880714	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_000484038.1|1879598_1880714_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 150
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1888127	1889285	4955271		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1888127_1889285_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 151
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1896157	1896925	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_061092857.1|1896157_1896925_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 152
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1902221	1903331	4955271		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1902221_1903331_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 153
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1906408	1908369	4955271		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_000998300.1|1906408_1907422_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
WP_000044321.1|1907418_1908369_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
>prophage 154
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1913779	1918059	4955271		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805890.1|1913779_1914862_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.6	3.5e-190
WP_000177888.1|1914984_1918059_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.6	0.0e+00
>prophage 155
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1922600	1928288	4955271		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952478.1|1922600_1923500_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
WP_001361815.1|1923632_1924916_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076233.1|1924905_1926165_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010234.1|1926401_1928288_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 156
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1936807	1937659	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|1936807_1937659_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 157
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1943704	1947011	4955271		Staphylococcus_phage(50.0%)	4	NA	NA
WP_061092851.1|1943704_1944574_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	6.5e-54
WP_001361806.1|1944735_1945329_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474002.1|1945340_1945577_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_061092852.1|1945685_1947011_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	3.2e-113
>prophage 158
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1951994	1957932	4955271	holin	Catovirus(50.0%)	4	NA	NA
WP_061092853.1|1951994_1953683_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.8e-60
WP_000089085.1|1953696_1955169_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001361810.1|1955182_1955770_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131024.1|1955898_1957932_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-21
>prophage 159
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1968994	1970044	4955271		Tupanvirus(100.0%)	1	NA	NA
WP_000701856.1|1968994_1970044_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 160
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1988204	1993859	4955271	capsid	Vibrio_phage(33.33%)	7	NA	NA
WP_061092843.1|1988204_1988783_-	N-acetyltransferase	NA	Q8HA62	Vibrio_phage	48.1	1.0e-39
WP_163444586.1|1988813_1988972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092842.1|1989131_1989335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092841.1|1989416_1990451_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_061092840.1|1990469_1990811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092839.1|1991379_1993527_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	32.4	3.6e-05
WP_061092838.1|1993526_1993859_-	hypothetical protein	NA	A0A2H4YGU9	Raoultella_phage	56.4	4.1e-09
>prophage 161
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	1999217	2004347	4955271		Streptococcus_phage(75.0%)	4	NA	NA
WP_061092833.1|1999217_1999853_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	35.7	4.9e-35
WP_000893289.1|2000635_2001889_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_022645229.1|2001900_2003004_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
WP_022645228.1|2003291_2004347_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
>prophage 162
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2009845	2010997	4955271		Mycobacterium_phage(100.0%)	1	NA	NA
WP_072275297.1|2009845_2010997_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	30.9	4.6e-31
>prophage 163
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2016004	2019832	4955271		Clostridioides_phage(50.0%)	5	NA	NA
WP_022645219.1|2016004_2016778_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729708.1|2016963_2017224_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001225679.1|2017659_2018400_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2018370_2019138_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001361926.1|2019253_2019832_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	2.5e-14
>prophage 164
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2024263	2032115	4955271		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001366128.1|2024263_2024995_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|2025059_2025527_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|2025523_2026246_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|2026279_2027035_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2027106_2028465_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211702.1|2028512_2029283_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2029359_2030160_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648568.1|2030400_2031315_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997062.1|2031311_2032115_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	3.5e-38
>prophage 165
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2038642	2039674	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593991.1|2038642_2039674_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 166
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2052633	2056749	4955271		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_061093015.1|2052633_2056116_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569424.1|2056152_2056749_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
>prophage 167
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2065577	2066336	4955271		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2065577_2066336_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 168
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2077915	2079340	4955271	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753942.1|2077915_2079340_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 169
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2083269	2083614	4955271		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2083269_2083614_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 170
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2089525	2090323	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2089525_2090323_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 171
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2095464	2102270	4955271	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001361646.1|2095464_2097894_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.9	3.5e-41
WP_001294687.1|2097967_2098498_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396038.1|2098512_2099217_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2099394_2099850_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937409.1|2099886_2100813_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2100851_2102270_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 172
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2112463	2113396	4955271	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339919.1|2112463_2113396_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
>prophage 173
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2116658	2123126	4955271		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2116658_2117585_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2117693_2118356_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2118396_2118933_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001306211.1|2119138_2121529_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189634.1|2121575_2123126_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 174
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2132322	2133747	4955271		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2132322_2133747_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 175
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2142257	2142809	4955271		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923725.1|2142257_2142809_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 176
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2147054	2148098	4955271		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|2147054_2148098_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 177
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2174070	2179466	4955271		Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
WP_000425651.1|2174070_2175795_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
WP_120795371.1|2175913_2175958_+	protein YabR	NA	NA	NA	NA	NA
WP_001361829.1|2176112_2177057_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_001300467.1|2177715_2177802_+	leu operon leader peptide	NA	NA	NA	NA	NA
WP_000082807.1|2177894_2179466_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.4	4.5e-05
>prophage 178
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2188284	2188983	4955271		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916296.1|2188284_2188983_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	6.2e-23
>prophage 179
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2197098	2202520	4955271		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_061093020.1|2197098_2199450_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.0	2.5e-36
WP_001117011.1|2199613_2202520_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 180
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2211547	2214301	4955271		Microcystis_phage(50.0%)	5	NA	NA
WP_000257195.1|2211547_2212396_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796361.1|2212420_2213020_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_061092952.1|2213055_2213505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092953.1|2213621_2213801_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|2213821_2214301_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 181
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2222194	2227855	4955271		Vibrio_phage(50.0%)	4	NA	NA
WP_000787109.1|2222194_2223709_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2223739_2224882_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349940.1|2225010_2226228_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001361347.1|2226301_2227855_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
>prophage 182
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2233358	2234507	4955271		Halovirus(100.0%)	1	NA	NA
WP_001361349.1|2233358_2234507_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 183
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2238912	2241729	4955271	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|2238912_2241729_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 184
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2248187	2261181	4955271		uncultured_Caudovirales_phage(16.67%)	12	NA	NA
WP_000681353.1|2248187_2249354_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	6.8e-91
WP_001361352.1|2249605_2250850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001361353.1|2250979_2252473_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.6	7.2e-29
WP_001274824.1|2252492_2253254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001181672.1|2253808_2254018_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|2254121_2255252_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2255340_2257257_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843579.1|2257632_2258037_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102367.1|2258062_2258776_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528541.1|2258924_2259491_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|2259525_2260113_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|2260227_2261181_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 185
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2272855	2274969	4955271		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219600.1|2272855_2274280_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	5.5e-10
WP_001188687.1|2274279_2274969_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 186
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2278155	2283510	4955271		Bacillus_phage(33.33%)	4	NA	NA
WP_000409437.1|2278155_2280093_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2280303_2281971_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000007442.1|2282076_2282244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093812.1|2282277_2283510_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 187
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2290230	2291553	4955271		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2290230_2291553_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 188
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2297140	2300016	4955271		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2297140_2297302_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|2297428_2298034_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2298426_2300016_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 189
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2307946	2309226	4955271		Salmonella_phage(50.0%)	2	NA	NA
WP_000098829.1|2307946_2308486_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2308488_2309226_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 190
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2312451	2317816	4955271		Tupanvirus(50.0%)	4	NA	NA
WP_000106033.1|2312451_2313474_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2313612_2314527_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|2314741_2316103_+	MFS transporter	NA	NA	NA	NA	NA
WP_054494984.1|2316151_2317816_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 191
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2332786	2333743	4955271	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181180.1|2332786_2333743_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
>prophage 192
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2341244	2341799	4955271		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151864.1|2341244_2341799_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 193
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2348367	2349828	4955271		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|2348367_2349828_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 194
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2360093	2361770	4955271		Escherichia_phage(100.0%)	2	NA	NA
WP_000044700.1|2360093_2360690_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	5.1e-50
WP_000790588.1|2361167_2361770_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	1.8e-55
>prophage 195
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2365129	2366116	4955271		Stx2-converting_phage(100.0%)	1	NA	NA
WP_061092742.1|2365129_2366116_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.7	2.1e-101
>prophage 196
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2370696	2377923	4955271		Liberibacter_phage(100.0%)	4	NA	NA
WP_061092745.1|2370696_2373759_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	71.0	0.0e+00
WP_072275279.1|2373760_2374927_-	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	44.0	1.1e-64
WP_061092746.1|2374927_2376427_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	78.8	1.3e-206
WP_061092747.1|2376423_2377923_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	77.4	1.5e-228
>prophage 197
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2386195	2387215	4955271		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001361370.1|2386195_2387215_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	2.4e-44
>prophage 198
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2392344	2401382	4955271	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001294540.1|2392344_2393847_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|2393989_2395072_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2395071_2396172_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2396438_2397950_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2398083_2398527_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|2398526_2401382_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
>prophage 199
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2409722	2415819	4955271		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2409722_2410658_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148579.1|2410670_2411132_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2411204_2411591_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471849.1|2411796_2414493_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2414633_2414687_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2414871_2415819_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 200
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2419457	2422768	4955271		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000187798.1|2419457_2421596_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001009180.1|2421780_2422245_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	1.9e-52
WP_001105432.1|2422245_2422536_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.8	1.9e-26
WP_000212715.1|2422525_2422768_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
>prophage 201
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2427030	2433511	4955271		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2427030_2428029_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_061092749.1|2428061_2429057_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001361374.1|2429043_2430066_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001095661.1|2430079_2431582_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|2431714_2432671_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2432980_2433511_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 202
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2475557	2476721	4955271		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944010.1|2475557_2476721_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	6.4e-81
>prophage 203
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2480563	2493589	4955271	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076315.1|2480563_2483005_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|2483043_2483469_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2483673_2484972_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2485075_2485273_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2485354_2486359_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|2486361_2487621_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2487706_2488987_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051889.1|2489063_2489372_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|2489457_2490408_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122466.1|2490400_2492248_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990300.1|2492257_2493589_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	6.7e-18
>prophage 204
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2497504	2498050	4955271		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2497504_2498050_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 205
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2507965	2508943	4955271		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2507965_2508943_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 206
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2513862	2514396	4955271		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2513862_2514396_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 207
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2518597	2520581	4955271		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2518597_2520244_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2520287_2520581_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 208
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2534858	2538070	4955271	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_061092757.1|2534858_2536316_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	4.0e-48
WP_000003806.1|2536552_2538070_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 209
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2557634	2559137	4955271		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|2557634_2559137_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 210
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2563977	2564766	4955271		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|2563977_2564766_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 211
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2570329	2571879	4955271		Bacillus_virus(50.0%)	2	NA	NA
WP_001075536.1|2570329_2571088_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
WP_000611436.1|2571198_2571879_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 212
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2578003	2584372	4955271		Bacillus_virus(50.0%)	5	NA	NA
WP_061092764.1|2578003_2579536_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.0	1.3e-12
WP_000507105.1|2579514_2580495_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_045133186.1|2580505_2581201_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_061092765.1|2581184_2582114_+	allose kinase	NA	NA	NA	NA	NA
WP_061092766.1|2582386_2584372_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	42.4	1.8e-139
>prophage 213
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2589617	2591765	4955271		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2589617_2591765_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 214
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2601049	2603008	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078218.1|2601049_2603008_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	7.4e-90
>prophage 215
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2607050	2608400	4955271		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|2607050_2608400_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 216
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2612217	2615831	4955271		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2612217_2612754_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|2613008_2615831_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 217
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2620038	2669582	4955271	holin,plate,tail,tRNA	Burkholderia_phage(27.27%)	51	NA	NA
WP_001147328.1|2620038_2621118_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2621170_2622586_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001600849.1|2622668_2623652_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891408.1|2623817_2624060_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_012602639.1|2624193_2625231_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_022646425.1|2625592_2626597_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_061092769.1|2626914_2627430_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001296638.1|2627471_2627681_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001562441.1|2627796_2629122_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|2629194_2629803_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|2629912_2630281_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|2630451_2632875_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|2633029_2633902_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001308201.1|2633914_2634412_-	chorismate lyase	NA	NA	NA	NA	NA
WP_061092770.1|2634634_2636215_-	SopA family protein	NA	NA	NA	NA	NA
WP_001361468.1|2636442_2637363_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973665.1|2637605_2638946_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|2639017_2640133_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|2640497_2641688_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001361466.1|2641841_2643386_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|2643400_2644291_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000202902.1|2644384_2644795_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001328330.1|2645009_2645288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000745730.1|2645334_2647431_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000595548.1|2647430_2648168_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001361463.1|2648164_2648803_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|2648916_2649159_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_000789981.1|2649512_2651162_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290321.1|2651686_2653036_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000619864.1|2653090_2653438_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_000758131.1|2653975_2654263_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
WP_000266448.1|2654265_2654871_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|2654883_2655198_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000404767.1|2655342_2655798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|2655794_2655992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729835.1|2655981_2657406_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
WP_000907502.1|2657405_2657930_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_000658214.1|2657980_2658298_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|2658257_2658386_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262479.1|2658487_2660863_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	26.1	5.9e-57
WP_000271436.1|2660862_2661816_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|2661815_2662025_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_001361462.1|2662012_2663053_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
WP_000679401.1|2663062_2663764_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
WP_001093498.1|2663862_2664222_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000951744.1|2664212_2665328_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
WP_000359520.1|2665320_2666037_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
WP_000135569.1|2666039_2667620_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_174617250.1|2667616_2668324_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_061092772.1|2668320_2668776_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
WP_061092773.1|2668790_2669582_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 218
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2682830	2686514	4955271		Dickeya_phage(100.0%)	1	NA	NA
WP_061092778.1|2682830_2686514_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 219
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2699937	2701527	4955271		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187541.1|2699937_2701527_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 220
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2706892	2708656	4955271		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2706892_2707165_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941119.1|2707351_2707942_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2707984_2708656_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 221
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2723332	2731661	4955271		Vibrio_phage(50.0%)	2	NA	NA
WP_000653948.1|2723332_2727556_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.6	1.1e-66
WP_000263098.1|2727632_2731661_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 222
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2735656	2738709	4955271		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2735656_2736841_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023085.1|2737758_2738709_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
>prophage 223
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2747049	2748894	4955271		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591346.1|2747049_2748894_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
>prophage 224
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2755645	2756860	4955271		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690928.1|2755645_2756860_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	1.7e-44
>prophage 225
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2769025	2776272	4955271		Serratia_phage(33.33%)	5	NA	NA
WP_000184821.1|2769025_2771323_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2771373_2771694_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_061093018.1|2771708_2772788_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174087.1|2773096_2775598_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|2775609_2776272_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 226
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2783139	2787736	4955271		Pandoravirus(100.0%)	3	NA	NA
WP_000694759.1|2783139_2784693_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	2.3e-09
WP_000067197.1|2784825_2785953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261171.1|2786185_2787736_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
>prophage 227
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2800947	2802279	4955271		Erwinia_phage(100.0%)	1	NA	NA
WP_001293340.1|2800947_2802279_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	30.1	5.8e-46
>prophage 228
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2806041	2806887	4955271		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|2806041_2806887_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 229
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2818497	2820566	4955271		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_001033722.1|2818497_2819196_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2819192_2820566_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 230
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2824015	2824636	4955271		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_001361705.1|2824015_2824636_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	1.1e-63
>prophage 231
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2842383	2848609	4955271		Catovirus(50.0%)	3	NA	NA
WP_000105770.1|2842383_2844219_-	ATP-binding protein	NA	A0A1V0SAD6	Catovirus	24.3	6.6e-24
WP_000753588.1|2844528_2845365_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012602895.1|2845558_2848609_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 232
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2858060	2860840	4955271		Escherichia_phage(50.0%)	3	NA	NA
WP_000059679.1|2858060_2858846_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621623.1|2858879_2859776_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718898.1|2859943_2860840_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 233
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2878478	2880949	4955271		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2878478_2879528_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|2879539_2880949_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 234
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2885027	2887814	4955271		uncultured_virus(100.0%)	1	NA	NA
WP_000249994.1|2885027_2887814_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 235
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2901501	2902116	4955271		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2901501_2902116_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 236
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2910905	2914192	4955271		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2910905_2911682_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2911684_2912200_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2912203_2912473_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187542.1|2912551_2914192_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.7	6.3e-42
>prophage 237
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2940650	2942480	4955271		Catovirus(100.0%)	1	NA	NA
WP_024179510.1|2940650_2942480_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.6e-83
>prophage 238
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2949860	2953719	4955271		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|2949860_2952023_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213567.1|2952106_2952823_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|2952822_2953719_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 239
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2956722	2958780	4955271		Salmonella_phage(100.0%)	1	NA	NA
WP_000611182.1|2956722_2958780_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	67.6	6.0e-82
>prophage 240
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2966900	2968556	4955271		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|2966900_2968556_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 241
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2976574	2982718	4955271		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|2976574_2977705_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145189.1|2977709_2978384_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2978361_2979243_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226627.1|2979261_2980329_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	7.8e-102
WP_000006629.1|2980328_2981591_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.3e-23
WP_000866674.1|2981587_2982718_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	2.3e-27
>prophage 242
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	2986760	2992174	4955271		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2986760_2987090_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047509.1|2987220_2988486_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001361911.1|2988621_2990106_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238888.1|2990152_2992174_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 243
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3000503	3002150	4955271		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012577.1|3000503_3002150_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.3e-66
>prophage 244
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3015540	3021393	4955271		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3015540_3016431_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|3016455_3017421_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|3017425_3018931_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|3018938_3019358_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|3019524_3021393_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 245
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3024561	3025554	4955271		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|3024561_3025554_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 246
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3037504	3040866	4955271		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933723.1|3037504_3038875_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
WP_000334081.1|3039036_3040866_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	3.3e-132
>prophage 247
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3046400	3050240	4955271		Cyanophage(50.0%)	4	NA	NA
WP_000867150.1|3046400_3047441_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	37.5	1.0e-50
WP_000741620.1|3047526_3048486_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251985.1|3048485_3049376_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3049466_3050240_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 248
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3059244	3060582	4955271		Moraxella_phage(100.0%)	1	NA	NA
WP_001361796.1|3059244_3060582_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.9	1.2e-62
>prophage 249
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3070780	3078149	4955271		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3070780_3071038_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3071001_3071361_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3071377_3071518_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122134670.1|3071747_3071828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|3072124_3073528_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3073532_3074633_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3074632_3075706_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072062.1|3075734_3078149_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 250
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3082757	3083906	4955271		Oenococcus_phage(100.0%)	1	NA	NA
WP_022646304.1|3082757_3083906_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.6	1.0e-51
>prophage 251
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3088333	3089287	4955271		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3088333_3088747_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3088858_3089287_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 252
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3096147	3104624	4955271		Aeromonas_phage(25.0%)	9	NA	NA
WP_001087115.1|3096147_3097863_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
WP_000828491.1|3097859_3099353_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.3	3.3e-29
WP_000703955.1|3099412_3099760_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3099749_3100112_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148045.1|3100108_3100606_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001306726.1|3100613_3101798_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|3102077_3102167_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|3102731_3102830_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168471.1|3102935_3104624_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.9	1.9e-57
>prophage 253
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3115281	3116616	4955271		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3115281_3116616_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 254
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3153402	3154794	4955271		environmental_Halophage(100.0%)	1	NA	NA
WP_001330372.1|3153402_3154794_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 255
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3159095	3165845	4955271		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3159095_3161204_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3161222_3161498_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3161552_3162176_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001361558.1|3162433_3164116_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.2	5.7e-22
WP_000924289.1|3164112_3164730_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001361559.1|3165020_3165845_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	1.8e-90
>prophage 256
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3170864	3179770	4955271	integrase	Morganella_phage(50.0%)	12	3169577:3169590	3184322:3184335
3169577:3169590	attL	CCCAGATGAGCAAA	NA	NA	NA	NA
WP_174617252.1|3170864_3173207_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.1	1.1e-79
WP_069723246.1|3173199_3173541_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	59.6	4.2e-33
WP_016231876.1|3173551_3174154_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.8	1.5e-25
WP_000181940.1|3174146_3174368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3174364_3174628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|3174624_3174819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244025.1|3175710_3175893_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_174617253.1|3175885_3176719_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_001705542.1|3176731_3177166_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	53.6	8.0e-29
WP_096171348.1|3177165_3177384_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096171436.1|3177854_3178403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174617254.1|3178501_3179770_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JPG6	Morganella_phage	78.8	5.0e-196
3184322:3184335	attR	CCCAGATGAGCAAA	NA	NA	NA	NA
>prophage 257
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3183112	3187675	4955271		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3183112_3183571_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050149.1|3183548_3184769_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_001297375.1|3184940_3185609_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3185825_3186062_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3186082_3186250_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3186347_3187157_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3187195_3187675_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 258
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3195113	3197207	4955271		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364801.1|3195113_3196142_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
WP_000064000.1|3196223_3197207_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 259
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3200615	3210122	4955271		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|3200615_3201548_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213846.1|3201761_3202958_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000646018.1|3202967_3203993_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982121.1|3204231_3205266_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.6	1.3e-08
WP_000483835.1|3205252_3206212_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214150.1|3206215_3207499_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001361565.1|3207508_3209053_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3209297_3209729_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3209870_3210122_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 260
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3237930	3252453	4955271	tRNA	Acinetobacter_phage(33.33%)	10	NA	NA
WP_061092950.1|3237930_3241740_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	46.1	0.0e+00
WP_000779792.1|3241896_3242505_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206229.1|3242602_3243994_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582421.1|3243990_3245835_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.9	1.5e-15
WP_000741500.1|3246025_3247177_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985745.1|3247306_3248602_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000183978.1|3248709_3250248_+	aldehyde dehydrogenase AldB	NA	NA	NA	NA	NA
WP_000061475.1|3250288_3251368_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	40.7	1.6e-62
WP_000833473.1|3251840_3252026_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
WP_000499742.1|3252042_3252453_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	8.4e-20
>prophage 261
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3273866	3275408	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|3273866_3275408_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 262
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3280726	3281722	4955271		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182668.1|3280726_3281722_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.5	3.1e-12
>prophage 263
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3285567	3287570	4955271	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_087522250.1|3285567_3286937_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001135737.1|3287016_3287169_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|3287357_3287570_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 264
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3291224	3293558	4955271		Escherichia_phage(100.0%)	1	NA	NA
WP_000013984.1|3291224_3293558_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	9.2e-71
>prophage 265
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3303446	3305431	4955271		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196444.1|3303446_3304430_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	3.0e-15
WP_000103576.1|3304426_3305431_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	1.5e-17
>prophage 266
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3352645	3354115	4955271		Bacillus_virus(50.0%)	2	NA	NA
WP_000123131.1|3352645_3353293_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
WP_000622316.1|3353344_3354115_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 267
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3367104	3369240	4955271		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065788.1|3367104_3367530_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.1e-50
WP_061092820.1|3367542_3368832_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	2.5e-171
WP_000008961.1|3368886_3369240_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.7e-24
>prophage 268
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3372584	3374627	4955271		Indivirus(100.0%)	1	NA	NA
WP_061092821.1|3372584_3374627_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	2.6e-45
>prophage 269
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3388036	3393932	4955271		Staphylococcus_phage(33.33%)	6	NA	NA
WP_061092822.1|3388036_3390772_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001314210.1|3390771_3391896_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001260301.1|3391968_3392244_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	2.9e-16
WP_000593555.1|3392240_3392600_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3392719_3393121_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_061092823.1|3393125_3393932_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
>prophage 270
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3401825	3412227	4955271		Dickeya_phage(33.33%)	12	NA	NA
WP_001100462.1|3401825_3402491_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.1	5.6e-58
WP_000130623.1|3402711_3402957_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000385055.1|3403171_3403480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106503.1|3403512_3405711_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	2.2e-119
WP_000964718.1|3405784_3406411_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000042886.1|3406551_3406911_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_001295207.1|3406913_3407183_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000743203.1|3407172_3407769_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_001040650.1|3407918_3409406_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000617723.1|3409408_3410077_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3410069_3411128_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3411372_3412227_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 271
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3417962	3419445	4955271		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3417962_3418730_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416625.1|3418731_3419445_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	29.0	2.0e-13
>prophage 272
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3422987	3424798	4955271		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|3422987_3424058_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073590.1|3424054_3424798_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 273
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3435810	3437907	4955271		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000410855.1|3435810_3437907_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 274
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3448236	3450684	4955271		Dickeya_phage(100.0%)	1	NA	NA
WP_000993450.1|3448236_3450684_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 275
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3459436	3460663	4955271		Ralstonia_phage(100.0%)	1	NA	NA
WP_061092828.1|3459436_3460663_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.8	3.7e-132
>prophage 276
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3465053	3467447	4955271		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081915.1|3465053_3467447_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 277
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3473416	3474295	4955271		Sodalis_phage(100.0%)	1	NA	NA
WP_000039099.1|3473416_3474295_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	4.2e-69
>prophage 278
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3480858	3485368	4955271		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|3480858_3481578_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253708.1|3481574_3482927_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|3482958_3483255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|3483313_3483631_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001361659.1|3483745_3485368_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	6.9e-142
>prophage 279
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3502346	3503183	4955271		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3502346_3503183_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 280
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3522090	3531631	4955271		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601837.1|3522090_3522654_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.8	1.6e-61
WP_000963788.1|3522739_3523960_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001361650.1|3524026_3526117_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000242755.1|3526167_3526800_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3527101_3527506_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3527560_3528430_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3528483_3528702_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057370.1|3528695_3529718_-	hydrolase	NA	NA	NA	NA	NA
WP_061092830.1|3529717_3531631_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.7	1.9e-74
>prophage 281
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3537202	3542776	4955271		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209686.1|3537202_3537589_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
WP_000820714.1|3537588_3537948_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903381.1|3537955_3538243_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3538368_3538743_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3538839_3539310_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3539406_3541521_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3541591_3542776_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 282
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3562653	3564125	4955271	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004466.1|3562653_3563601_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114986.1|3563615_3564125_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 283
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3574468	3578622	4955271		Bacillus_virus(50.0%)	4	NA	NA
WP_000078316.1|3574468_3575227_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
WP_001361187.1|3575234_3576338_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019670.1|3576347_3577529_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|3577596_3578622_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 284
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3585126	3586011	4955271		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258939.1|3585126_3586011_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	9.2e-24
>prophage 285
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3591348	3595861	4955271		Escherichia_phage(50.0%)	4	NA	NA
WP_000843961.1|3591348_3592179_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275531.1|3592520_3593375_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001361192.1|3593410_3594301_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132912.1|3594361_3595861_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
>prophage 286
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3605148	3606192	4955271		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3605148_3606192_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 287
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3622690	3625215	4955271	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3622690_3623758_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3623847_3625215_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 288
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3630005	3630503	4955271	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|3630005_3630503_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 289
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3634208	3638941	4955271		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108455.1|3634208_3635699_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|3635746_3636436_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_061092739.1|3636432_3637308_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979888.1|3637304_3637769_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445109.1|3637828_3638941_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	6.1e-73
>prophage 290
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3645689	3660483	4955271		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001361198.1|3645689_3646619_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	1.2e-16
WP_000809774.1|3646714_3649051_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|3649280_3649934_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047096.1|3649930_3650659_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620398.1|3650655_3651288_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3651500_3651773_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3651769_3652624_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3652669_3653161_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3653278_3653566_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3653588_3655022_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3655069_3655795_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3655801_3656359_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3656327_3656903_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3656899_3657466_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3657486_3658473_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922872.1|3658486_3659464_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3659673_3660483_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 291
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3664551	3666029	4955271		Vibrio_phage(50.0%)	2	NA	NA
WP_000445407.1|3664551_3664830_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
WP_001047336.1|3665057_3666029_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 292
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3672658	3675531	4955271	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3672658_3674593_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3674682_3675531_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 293
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3679611	3686250	4955271		Dickeya_phage(50.0%)	4	NA	NA
WP_000207669.1|3679611_3680955_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3681585_3682038_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|3682065_3683553_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3683577_3686250_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 294
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3691731	3693621	4955271		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3691731_3693621_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 295
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3699324	3707120	4955271		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189307.1|3699324_3699627_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	2.3e-14
WP_000449455.1|3699677_3700121_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037593.1|3700100_3700619_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_001361205.1|3700746_3701382_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147632.1|3701454_3702495_+	permease	NA	NA	NA	NA	NA
WP_000646049.1|3702607_3703183_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|3703192_3703783_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246837.1|3703802_3704198_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249118.1|3704155_3706192_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809263.1|3706256_3707120_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 296
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3724740	3725886	4955271		Streptococcus_phage(100.0%)	1	NA	NA
WP_001361210.1|3724740_3725886_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 297
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3733698	3735993	4955271		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861747.1|3733698_3735993_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.6e-158
>prophage 298
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3761998	3762964	4955271		Escherichia_phage(100.0%)	1	NA	NA
WP_001098827.1|3761998_3762964_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 299
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3774625	3786915	4955271	integrase,tRNA	Salmonella_phage(40.0%)	9	3778963:3778976	3797312:3797325
WP_061092729.1|3774625_3777718_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.5	9.1e-159
WP_000212454.1|3777901_3778885_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
3778963:3778976	attL	TAAAGCGCGTTTCT	NA	NA	NA	NA
WP_000450588.1|3779103_3779436_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|3779477_3780857_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094730.1|3781274_3782795_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018006.1|3782900_3783524_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065890.1|3783811_3784576_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_072661569.1|3784872_3786189_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.0e-34
WP_000268404.1|3786318_3786915_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
3797312:3797325	attR	TAAAGCGCGTTTCT	NA	NA	NA	NA
>prophage 300
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3792996	3803084	4955271	transposase	Escherichia_phage(75.0%)	8	NA	NA
WP_174617257.1|3792996_3793983_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.6	2.1e-165
WP_085960995.1|3794504_3795717_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_061424402.1|3796866_3799302_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	100.0	0.0e+00
WP_000816147.1|3799315_3799942_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
WP_000544912.1|3799934_3800711_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
WP_001139856.1|3800765_3801362_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	100.0	1.7e-114
WP_001327048.1|3801358_3801889_+	4Fe-4S binding protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
WP_174617258.1|3802103_3803084_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
>prophage 301
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3807691	3809248	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_072648050.1|3807691_3809248_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.9e-104
>prophage 302
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3813928	3816102	4955271		Yersinia_phage(33.33%)	4	NA	NA
WP_174617261.1|3813928_3814747_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.0e-46
WP_000206657.1|3814838_3815321_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.6	2.3e-13
WP_001186740.1|3815335_3815812_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|3815880_3816102_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 303
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3819536	3824895	4955271	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_000437371.1|3819536_3821378_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3821572_3823318_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3823428_3823644_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264356.1|3823881_3824895_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.3e-109
>prophage 304
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3831197	3832436	4955271	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708491.1|3831197_3832436_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 305
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3837585	3839019	4955271		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3837585_3839019_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 306
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3848160	3859123	4955271		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3848160_3848814_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3849075_3849246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3849303_3850077_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001320780.1|3850219_3851008_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3851045_3852206_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3852211_3852883_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3853030_3854512_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3854716_3855346_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3855346_3855769_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3855793_3856621_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3856620_3857202_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195292.1|3857230_3859123_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
>prophage 307
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3862950	3863343	4955271		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3862950_3863343_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 308
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3866653	3876004	4955271		Bacillus_virus(33.33%)	7	NA	NA
WP_001281841.1|3866653_3868912_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000965722.1|3869145_3869883_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|3869957_3871370_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3871480_3873700_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3873742_3874000_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691628.1|3874050_3874977_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3875176_3876004_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 309
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3882080	3882965	4955271		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3882080_3882965_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 310
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3905175	3906348	4955271		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|3905175_3906348_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 311
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3926111	3928289	4955271		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|3926111_3926333_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186715.1|3926401_3926878_-	RadC family protein	NA	NA	NA	NA	NA
WP_032153711.1|3926893_3927379_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
WP_174617263.1|3927470_3928289_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	8.0e-46
>prophage 312
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3941574	3947126	4955271	transposase	Sodalis_phage(33.33%)	6	NA	NA
WP_001349534.1|3941574_3941823_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|3941891_3942083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131501864.1|3943675_3943789_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_000919994.1|3944639_3945206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|3945446_3946262_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3946322_3947126_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
>prophage 313
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3951096	3952311	4955271		Salmonella_phage(100.0%)	1	NA	NA
WP_000214122.1|3951096_3952311_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
>prophage 314
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3958680	3968953	4955271		uncultured_virus(20.0%)	6	NA	NA
WP_000174035.1|3958680_3959661_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_000820616.1|3959657_3960602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637419.1|3960604_3961687_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_032153698.1|3962153_3962420_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_000438165.1|3963841_3967255_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627728.1|3967318_3968953_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
>prophage 315
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3974574	3975803	4955271	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_116315299.1|3974574_3975803_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
>prophage 316
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	3996813	3997605	4955271		Lactobacillus_phage(100.0%)	1	NA	NA
WP_029402616.1|3996813_3997605_+	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	46.5	2.0e-06
>prophage 317
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4005795	4006980	4955271	integrase	Enterobacteria_phage(100.0%)	1	3996221:3996234	4011494:4011507
3996221:3996234	attL	GGATATCGTTACTG	NA	NA	NA	NA
WP_001218742.1|4005795_4006980_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_001218742.1|4005795_4006980_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
4011494:4011507	attR	CAGTAACGATATCC	NA	NA	NA	NA
>prophage 318
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4029737	4030892	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4029737_4030892_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 319
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4059186	4060419	4955271		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4059186_4060419_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 320
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4068555	4073026	4955271		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_001521236.1|4068555_4071429_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
WP_001521235.1|4071592_4073026_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
>prophage 321
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4076831	4092222	4955271	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
WP_000806638.1|4076831_4077728_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_001521231.1|4077752_4078463_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_063117505.1|4078468_4080202_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_001701073.1|4080292_4081390_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003334.1|4081400_4082918_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192782.1|4082960_4083509_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001050745.1|4083630_4083756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|4083757_4085206_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001361332.1|4085641_4087561_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838435.1|4087560_4088049_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|4088084_4089452_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001299798.1|4089487_4090804_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|4090821_4092222_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 322
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4116502	4117255	4955271		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|4116502_4117255_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 323
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4121541	4124036	4955271		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|4121541_4122303_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|4122617_4124036_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 324
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4133666	4140439	4955271		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4133666_4134380_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082184.1|4134448_4135138_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4135822_4136353_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|4136365_4138612_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4138762_4139638_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4139644_4140439_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 325
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4145916	4166794	4955271	tRNA	Bacillus_phage(22.22%)	14	NA	NA
WP_001138161.1|4145916_4148805_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	2.6e-67
WP_061092715.1|4148797_4152340_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	8.9e-09
WP_000775928.1|4152339_4154166_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.5	1.6e-25
WP_000237947.1|4154227_4155559_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4155790_4157044_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_001361321.1|4157301_4158126_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810565.1|4158157_4159738_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000382419.1|4159737_4160913_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066236.1|4160915_4161512_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_001361319.1|4161583_4162531_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
WP_000678646.1|4163114_4164212_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117714.1|4164288_4165095_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000184255.1|4165145_4165589_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001361317.1|4165588_4166794_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.0e-73
>prophage 326
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4178320	4179076	4955271		Bacillus_phage(100.0%)	1	NA	NA
WP_024179465.1|4178320_4179076_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 327
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4183932	4184781	4955271		Vibrio_phage(100.0%)	1	NA	NA
WP_000100410.1|4183932_4184781_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 328
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4189382	4196429	4955271		Oenococcus_phage(33.33%)	4	NA	NA
WP_000211776.1|4189382_4190723_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	9.1e-07
WP_000098220.1|4190743_4192084_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000186450.1|4192314_4195071_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046818.1|4195127_4196429_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.6e-38
>prophage 329
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4200462	4203485	4955271		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000210878.1|4200462_4202100_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4202186_4203485_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 330
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4207267	4210466	4955271		Vibrio_phage(50.0%)	3	NA	NA
WP_001199974.1|4207267_4207939_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001232705.1|4208023_4209031_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032245922.1|4209056_4210466_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.7	5.6e-15
>prophage 331
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4217766	4218552	4955271		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001361315.1|4217766_4218552_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.1e-20
>prophage 332
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4233201	4235234	4955271		Hokovirus(50.0%)	2	NA	NA
WP_001090363.1|4233201_4234629_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4234628_4235234_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 333
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4238346	4248369	4955271		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_001295182.1|4238346_4239108_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4239101_4239728_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|4239867_4241007_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4241069_4242062_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208071.1|4242182_4242590_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001237173.1|4242736_4243330_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863203.1|4243329_4244757_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562981.1|4244767_4245004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141294.1|4245045_4245702_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	6.6e-51
WP_061092717.1|4245807_4248369_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
>prophage 334
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4267385	4268396	4955271		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024179462.1|4267385_4268396_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 335
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4275810	4276776	4955271		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287400.1|4275810_4276776_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 336
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4282243	4287630	4955271	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4282243_4282741_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4282820_4283882_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4283950_4284451_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047171.1|4284579_4287210_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4287444_4287630_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 337
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4300288	4305585	4955271		Bacillus_virus(20.0%)	5	NA	NA
WP_000985486.1|4300288_4301491_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	1.1e-27
WP_000777955.1|4301846_4302806_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.1	3.1e-134
WP_174617268.1|4302815_4304960_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.7	3.8e-196
WP_000080947.1|4304932_4305343_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223233.1|4305339_4305585_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 338
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4311390	4315441	4955271		Clostridium_phage(50.0%)	4	NA	NA
WP_000522416.1|4311390_4311840_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000156811.1|4311840_4312503_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|4312523_4313924_-	GABA permease	NA	NA	NA	NA	NA
WP_000097676.1|4314160_4315441_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.6e-32
>prophage 339
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4324937	4325204	4955271		Salmonella_phage(100.0%)	1	NA	NA
WP_012602462.1|4324937_4325204_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	67.9	1.2e-11
>prophage 340
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4330848	4331331	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4330848_4331331_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 341
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4344963	4346034	4955271		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4344963_4346034_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 342
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4353380	4355954	4955271		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4353380_4355954_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 343
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4361733	4363032	4955271		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841104.1|4361733_4363032_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	9.7e-46
>prophage 344
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4368325	4374407	4955271	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4368325_4368745_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4368951_4369989_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|4370036_4370726_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|4371030_4371414_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189223.1|4371468_4372056_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001361605.1|4372158_4373040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219190.1|4373072_4374407_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 345
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4380178	4383921	4955271		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4380178_4381978_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002529.1|4381993_4382968_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4383240_4383921_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 346
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4387380	4387641	4955271		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196294.1|4387380_4387641_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
>prophage 347
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4391759	4403066	4955271		Bacillus_phage(50.0%)	7	NA	NA
WP_000970176.1|4391759_4395647_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
WP_024179492.1|4396221_4397649_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.3	7.9e-17
WP_001215892.1|4397813_4398527_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4398516_4399851_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4399911_4400250_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883114.1|4400294_4401485_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4401812_4403066_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 348
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4408824	4410336	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493451.1|4408824_4410336_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
>prophage 349
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4425473	4431811	4955271		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4425473_4426688_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4426715_4427102_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4427118_4427442_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4427537_4428053_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196628.1|4428069_4429920_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4429921_4430257_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4430268_4430469_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133570.1|4430527_4431811_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 350
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4441715	4442147	4955271		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|4441715_4442147_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 351
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4462656	4469138	4955271		Escherichia_phage(66.67%)	7	NA	NA
WP_000937903.1|4462656_4464024_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	8.9e-42
WP_001299507.1|4464185_4465652_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|4465720_4467298_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|4467392_4467932_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001295476.1|4467947_4468466_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000075991.1|4468776_4468968_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	98.4	2.1e-26
WP_000017552.1|4468985_4469138_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 352
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4475385	4479387	4955271		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028623.1|4475385_4476024_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.4e-29
WP_001296287.1|4476023_4477061_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001295473.1|4477385_4478012_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|4478097_4479387_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 353
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4500654	4501368	4955271		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4500654_4501368_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 354
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4518635	4519586	4955271		Cyanophage(100.0%)	1	NA	NA
WP_022645961.1|4518635_4519586_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 355
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4538140	4543075	4955271		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102892.1|4538140_4539010_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|4539223_4539649_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001361766.1|4539635_4540085_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838948.1|4540145_4540721_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4540816_4541716_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_061092810.1|4541773_4543075_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.9	3.3e-09
>prophage 356
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4546553	4561923	4955271		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517443.1|4546553_4547345_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290224.1|4547502_4548519_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458420.1|4548518_4549352_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4549351_4550227_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021031.1|4550216_4551314_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001361768.1|4551447_4552359_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	2.0e-58
WP_000719965.1|4552361_4552730_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096643.1|4552834_4553686_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4553728_4554238_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4554278_4556006_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4556050_4556308_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4556691_4557663_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4557847_4558609_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001317975.1|4558838_4559837_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443682.1|4559907_4561923_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	2.2e-150
>prophage 357
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4589208	4589943	4955271		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4589208_4589943_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 358
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4593761	4594682	4955271		Morganella_phage(100.0%)	1	NA	NA
WP_000484016.1|4593761_4594682_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 359
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4598372	4605948	4955271		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283480.1|4598372_4600067_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
WP_000955028.1|4600135_4601080_+	transporter YfdV	NA	NA	NA	NA	NA
WP_000183691.1|4601153_4602299_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_072275257.1|4602354_4605948_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 360
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4614034	4670148	4955271	capsid,plate,protease,terminase,lysis,tail,integrase	Salmonella_phage(32.35%)	71	4625873:4625894	4669059:4669080
WP_001224627.1|4614034_4614604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
WP_001181154.1|4615352_4615982_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_000243052.1|4616299_4616920_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
WP_001361862.1|4616944_4624864_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
WP_001361863.1|4624923_4625442_+	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	1.4e-83
4625873:4625894	attL	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|4625967_4626168_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001549484.1|4626225_4626393_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	96.4	1.1e-26
WP_174617271.1|4626465_4626750_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	4.5e-49
WP_020231265.1|4626742_4627027_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	97.9	1.0e-48
WP_174617272.1|4628133_4628586_-	ead/Ea22-like family protein	NA	A0A088CPS0	Enterobacteria_phage	88.5	6.3e-45
WP_021514106.1|4628582_4629170_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	62.1	1.0e-55
WP_174617273.1|4629166_4629331_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.2e-23
WP_089046654.1|4629341_4629638_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	5.0e-51
WP_113421868.1|4629661_4630249_-	DUF669 domain-containing protein	NA	A0A2D1GLM1	Escherichia_phage	99.5	3.8e-106
WP_015966849.1|4630245_4630926_-	ATP-binding protein	NA	K7PMI2	Enterobacteria_phage	100.0	5.8e-127
WP_000613347.1|4630934_4631123_-	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
WP_015966850.1|4631119_4631233_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	100.0	2.7e-13
WP_016231970.1|4631225_4631372_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A2D1GLZ1	Escherichia_phage	97.9	3.8e-20
WP_001518152.1|4631396_4632365_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	100.0	2.0e-56
WP_174617274.1|4632552_4633002_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	5.1e-71
WP_001077327.1|4633064_4633289_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_023971974.1|4633422_4633956_-	HNH endonuclease	NA	A0A2H4FNF1	Salmonella_phage	96.6	2.0e-98
WP_000371654.1|4634262_4634955_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	98.3	3.3e-133
WP_000247283.1|4635102_4635333_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	96.1	3.9e-35
WP_174617275.1|4635452_4635752_+	hypothetical protein	NA	C6ZCW4	Enterobacteria_phage	96.0	5.8e-47
WP_174617276.1|4635914_4636736_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	93.8	3.9e-133
WP_174617277.1|4636843_4638724_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.0	0.0e+00
WP_077070034.1|4638806_4639418_+	HNH endonuclease	NA	A0A2I6PIF0	Escherichia_phage	98.0	4.9e-109
WP_025748954.1|4639466_4639907_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	4.5e-80
WP_174617278.1|4639903_4640431_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	98.9	6.8e-99
WP_001254222.1|4640427_4640610_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566871.1|4640606_4640777_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_174617279.1|4640769_4641492_+	phage antirepressor KilAC domain-containing protein	NA	O48426	Enterobacteria_phage	99.6	7.1e-131
WP_174617280.1|4641491_4642097_+	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	96.5	6.2e-96
WP_000512806.1|4642140_4642629_+	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_000286100.1|4643167_4643371_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001504512.1|4643348_4643846_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	99.4	2.9e-91
WP_174617281.1|4643934_4644372_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	3.8e-71
WP_001028468.1|4644575_4645097_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
WP_001548473.1|4645300_4645579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053903632.1|4645971_4646190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218991.1|4646212_4646764_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
WP_153674329.1|4646766_4648389_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	96.3	0.0e+00
WP_174617234.1|4648388_4649855_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.5e-268
WP_086353604.1|4649742_4650480_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_174617233.1|4650494_4651715_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.0	1.2e-202
WP_001066728.1|4651718_4652225_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.3e-70
WP_000627485.1|4652236_4653178_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	1.7e-156
WP_174617286.1|4653174_4653408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072651311.1|4653406_4653814_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_174617231.1|4653810_4654365_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	3.3e-80
WP_023908474.1|4654351_4654741_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_033544654.1|4654715_4655279_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_032330418.1|4655282_4656428_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
WP_000109249.1|4656438_4656879_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_023565715.1|4656882_4657335_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_174617282.1|4657512_4659465_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	64.6	1.1e-165
WP_032330412.1|4659464_4660115_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.8	3.1e-61
WP_047643984.1|4660118_4660421_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	59.0	1.8e-27
WP_077150919.1|4660423_4661455_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.3	6.0e-99
WP_113403305.1|4661451_4661787_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	44.1	2.0e-19
WP_032247566.1|4661811_4662135_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	96.9	1.2e-42
WP_165371268.1|4662242_4662404_+	hypothetical protein	NA	A0A077KAX5	Edwardsiella_phage	98.1	1.6e-22
WP_174617283.1|4662475_4663390_+	phage repressor protein/antirepressor Ant	NA	A5VW58	Enterobacteria_phage	64.4	1.8e-99
WP_032330410.1|4663450_4664206_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	78.2	1.3e-90
WP_001270634.1|4664205_4664559_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_001197069.1|4664558_4665758_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	1.1e-184
WP_174617284.1|4665754_4666435_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.0	1.4e-107
WP_174617285.1|4667221_4667659_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.8	1.5e-43
WP_174617287.1|4667746_4668904_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	5.3e-221
WP_000368135.1|4669215_4670148_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
4669059:4669080	attR	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 361
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4689929	4691015	4955271		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4689929_4691015_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 362
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4699506	4700643	4955271		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_061092617.1|4699506_4700643_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 363
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4707190	4708708	4955271		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4707190_4708708_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 364
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4712919	4714792	4955271	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4712919_4713693_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156125.1|4713889_4714792_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	3.1e-67
>prophage 365
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4728324	4731552	4955271		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203401.1|4728324_4728975_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	1.6e-09
WP_001012889.1|4729061_4730894_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813851.1|4730952_4731552_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 366
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4765976	4770980	4955271		Tupanvirus(50.0%)	4	NA	NA
WP_000860297.1|4765976_4767959_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_000461641.1|4767958_4768927_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	5.2e-36
WP_023908921.1|4768930_4770070_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.6	1.9e-29
WP_001306469.1|4770377_4770980_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 367
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4774582	4779152	4955271	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001361551.1|4774582_4775788_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
WP_001350322.1|4775844_4777134_+	MFS transporter	NA	NA	NA	NA	NA
WP_061092620.1|4777150_4777954_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150338.1|4777994_4778180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092621.1|4778192_4779152_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
>prophage 368
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4785044	4786121	4955271		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779074.1|4785044_4786121_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 369
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4789166	4797442	4955271		Pseudomonas_phage(50.0%)	4	NA	NA
WP_000135040.1|4789166_4789421_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4789420_4790551_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|4790696_4792982_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_001220091.1|4793677_4797442_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.2	2.2e-21
>prophage 370
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4800579	4804760	4955271		Oenococcus_phage(50.0%)	2	NA	NA
WP_001571680.1|4800579_4801782_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.6	4.6e-58
WP_061092622.1|4802132_4804760_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	3.1e-91
>prophage 371
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4819683	4824526	4955271		Bacillus_phage(50.0%)	2	NA	NA
WP_001361611.1|4819683_4821510_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	7.5e-20
WP_000876059.1|4821676_4824526_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	8.4e-42
>prophage 372
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4828688	4834457	4955271		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865538.1|4828688_4829783_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	8.8e-117
WP_000406089.1|4829894_4830950_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786344.1|4831023_4832088_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884961.1|4832087_4832738_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.1e-05
WP_000422219.1|4832813_4834457_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	25.0	5.5e-14
>prophage 373
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4843225	4843843	4955271		Bacillus_virus(100.0%)	1	NA	NA
WP_001361614.1|4843225_4843843_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.5e-12
>prophage 374
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4855539	4863189	4955271		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4855539_4856547_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|4856686_4856971_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578066.1|4857095_4858856_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_001234850.1|4859005_4859701_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|4859728_4860919_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|4861251_4861596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194936.1|4861599_4863189_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 375
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4868943	4873244	4955271		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4868943_4869510_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|4869921_4870635_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198804.1|4870673_4871660_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001361616.1|4871777_4873244_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	5.6e-42
>prophage 376
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4887739	4888597	4955271		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|4887739_4888597_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 377
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4892666	4894658	4955271		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000489280.1|4892666_4894658_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 378
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4900007	4900676	4955271		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|4900007_4900676_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 379
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4904370	4905891	4955271		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|4904370_4905891_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 380
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4920815	4944517	4955271	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188136.1|4920815_4922762_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4922834_4923059_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4923381_4923702_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934036.1|4923732_4926009_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.5e-166
WP_001040187.1|4926633_4926852_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4927135_4927840_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_061092629.1|4927881_4929603_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_061092630.1|4929603_4931370_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537432.1|4931492_4932458_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4933002_4933497_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_061093092.1|4933631_4937699_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001361928.1|4937857_4938469_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067771.1|4938479_4939823_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_000886683.1|4939913_4941206_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850332.1|4941444_4943889_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|4943899_4944517_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 381
NZ_CP054556	Escherichia coli strain LWY24 chromosome, complete genome	4955271	4950826	4955010	4955271	integrase	Escherichia_phage(55.56%)	9	4945025:4945036	4952776:4952787
4945025:4945036	attL	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000067979.1|4950826_4951624_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023395.1|4951655_4952651_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	100.0	7.1e-190
WP_000072552.1|4952744_4953056_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
4952776:4952787	attR	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000022051.1|4953160_4953517_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001005162.1|4953527_4953698_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|4953694_4954195_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4954259_4954484_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|4954483_4954786_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_001113263.1|4954785_4955010_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
