The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	1048054	1062281	2569353		Staphylococcus_phage(92.31%)	16	NA	NA
WP_041784790.1|1048054_1049437_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	61.3	5.3e-167
WP_011302825.1|1049456_1050461_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	49.4	2.9e-90
WP_011302826.1|1050450_1050702_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	81.1	4.2e-30
WP_011302827.1|1050761_1051238_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	53.5	4.8e-43
WP_172439364.1|1051221_1052013_+	prolyl oligopeptidase family serine peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.4	4.2e-100
WP_011302829.1|1052108_1053698_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	81.8	8.5e-262
WP_011302830.1|1054086_1055283_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	86.6	1.8e-195
WP_011302831.1|1055381_1056290_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	75.8	1.1e-101
WP_011302832.1|1056459_1057296_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.2	4.2e-111
WP_047504130.1|1057566_1057923_-	CrcB family protein	NA	NA	NA	NA	NA
WP_011302834.1|1057919_1058285_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	62.8	3.3e-36
WP_011302835.1|1058495_1058801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011302836.1|1059085_1059799_+	transaldolase	NA	E3SKN5	Synechococcus_phage	36.3	2.9e-20
WP_011302838.1|1060914_1061364_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	47.5	1.3e-21
WP_011302839.1|1061371_1061797_-	competence protein ComK	NA	NA	NA	NA	NA
WP_048787400.1|1061810_1062281_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	44.4	2.2e-24
>prophage 2
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	1066727	1083815	2569353	tRNA	Staphylococcus_phage(100.0%)	15	NA	NA
WP_048787170.1|1066727_1068194_+	FAD/NAD(P)-binding protein	NA	A0A2H4PQX2	Staphylococcus_phage	58.6	5.5e-13
WP_011302848.1|1068735_1069779_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	64.4	1.0e-130
WP_011302849.1|1069785_1070418_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	64.8	5.0e-72
WP_011302850.1|1070429_1071611_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	71.2	4.2e-165
WP_002482978.1|1071624_1072083_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	76.3	6.6e-58
WP_047504116.1|1072347_1073349_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	68.5	7.3e-126
WP_011302852.1|1073615_1074440_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011302853.1|1074675_1075632_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002482982.1|1075783_1076185_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011302854.1|1076303_1076864_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	63.8	9.5e-67
WP_011302855.1|1076860_1077814_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	83.3	7.3e-67
WP_011302856.1|1077923_1079093_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	77.4	2.0e-167
WP_011302857.1|1079621_1082036_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	85.6	0.0e+00
WP_002482987.1|1082054_1082366_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	68.9	4.5e-34
WP_011302858.1|1082546_1083815_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	77.2	1.5e-38
>prophage 3
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	1205582	1214707	2569353	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_047503974.1|1205582_1206587_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.7e-05
WP_047503971.1|1206589_1207615_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011302950.1|1207635_1208781_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	2.5e-85
WP_011302951.1|1208796_1209057_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.1	7.4e-06
WP_047503968.1|1209438_1211715_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.6	1.7e-29
WP_174538726.1|1211896_1214176_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	3.8e-69
WP_002483102.1|1214188_1214707_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.2	6.6e-30
>prophage 4
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	1341008	1350975	2569353		uncultured_Mediterranean_phage(28.57%)	11	NA	NA
WP_002483230.1|1341008_1341896_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	5.1e-38
WP_011303058.1|1341963_1342470_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_011303059.1|1342561_1343296_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.5	1.4e-09
WP_047503875.1|1343279_1343828_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.4	1.6e-10
WP_002483234.1|1343820_1344558_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011303060.1|1344684_1345410_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.6	1.1e-46
WP_174538820.1|1345390_1347157_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	23.8	1.7e-21
WP_037538408.1|1347584_1348130_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002483238.1|1348285_1348534_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	4.9e-15
WP_069822462.1|1348643_1349603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064205480.1|1349595_1350975_+	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	32.4	7.1e-55
>prophage 5
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	1680616	1772496	2569353	head,tail,plate,terminase,integrase,holin,portal,transposase,tRNA	Staphylococcus_phage(41.51%)	102	1711808:1711829	1753972:1753993
WP_011303319.1|1680616_1683367_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.8	2.0e-88
WP_011303320.1|1683609_1684212_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_104010417.1|1684351_1685131_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_002483537.1|1685238_1685529_-	YggT family protein	NA	NA	NA	NA	NA
WP_047503516.1|1685542_1686148_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_011303322.1|1686153_1686828_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_047503513.1|1686845_1687634_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_002483541.1|1688080_1689253_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_047503508.1|1689282_1690713_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_052190972.1|1690818_1691706_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_174538745.1|1691721_1693071_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011303326.1|1693072_1694038_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_174538746.1|1694231_1696466_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011303328.1|1696446_1696839_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_011303329.1|1696853_1697789_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_011303330.1|1697803_1698235_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_048787295.1|1698384_1699998_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_047503500.1|1700260_1700701_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011303333.1|1700815_1701499_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_011303334.1|1701638_1701773_-	beta-class phenol-soluble modulin	NA	NA	NA	NA	NA
WP_048787296.1|1701811_1701946_-	beta-class phenol-soluble modulin	NA	NA	NA	NA	NA
WP_048787297.1|1702562_1704446_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011303339.1|1705606_1706230_+	LysE family translocator	NA	NA	NA	NA	NA
WP_103314661.1|1706788_1709146_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	6.2e-160
WP_011303341.1|1709338_1709653_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081229140.1|1709793_1710702_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.5	3.6e-47
WP_011303343.1|1710662_1711346_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115340783.1|1711429_1711507_-	hypothetical protein	NA	NA	NA	NA	NA
1711808:1711829	attL	GTGCCATGCCAGTGCCATAAAA	NA	NA	NA	NA
WP_047503486.1|1712582_1712993_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	91.9	2.0e-69
WP_011303347.1|1713002_1713194_-	hypothetical protein	NA	A0A2H4JGI3	uncultured_Caudovirales_phage	95.2	7.0e-30
WP_047503483.1|1713289_1713538_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_107523634.1|1713726_1714140_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_061050616.1|1714129_1714639_-	DUF4065 domain-containing protein	NA	A8ATC0	Listeria_phage	53.7	6.0e-44
WP_174538821.1|1715031_1715979_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CMK9	Staphylococcus_phage	53.0	1.2e-85
WP_041080397.1|1716406_1716664_-|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	51.9	1.7e-10
WP_104013924.1|1716717_1716816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041080395.1|1717064_1717352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174538747.1|1717386_1719273_-	glucosaminidase domain-containing protein	NA	B7T0E8	Staphylococcus_virus	53.6	3.1e-194
WP_174538748.1|1719328_1719661_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_174538749.1|1719660_1721526_-|plate	BppU family phage baseplate upper protein	plate	A0EWU3	Staphylococcus_virus	40.1	1.0e-125
WP_174538750.1|1721525_1723433_-	hypothetical protein	NA	A0A059T5B2	Staphylococcus_phage	58.4	5.9e-209
WP_174538751.1|1723447_1725304_-|tail	phage tail protein	tail	Q4ZC57	Staphylococcus_virus	53.4	6.0e-182
WP_174538752.1|1725314_1726241_-|tail	phage tail family protein	tail	Q4ZC58	Staphylococcus_virus	51.3	2.1e-79
WP_174538753.1|1726252_1729342_-|terminase	terminase	terminase	Q4ZCD8	Staphylococcus_virus	56.5	1.5e-158
WP_061050623.1|1729344_1729653_-	hypothetical protein	NA	A0A2H4JC15	uncultured_Caudovirales_phage	62.7	1.1e-27
WP_061050624.1|1729715_1730210_-	hypothetical protein	NA	A0A2H4JI48	uncultured_Caudovirales_phage	72.0	1.1e-61
WP_061050625.1|1730262_1730808_-	hypothetical protein	NA	A0A1W6JPA3	Staphylococcus_phage	80.8	1.0e-73
WP_174538754.1|1730813_1731236_-	DUF3168 domain-containing protein	NA	A1BU61	Staphylococcus_virus	64.4	1.2e-45
WP_174538755.1|1731596_1732304_-	hypothetical protein	NA	W5RA17	Staphylococcus_phage	42.1	5.3e-38
WP_174538756.1|1732372_1732663_-	HK97 gp10 family phage protein	NA	A0A0N9BAY5	Staphylococcus_phage	75.3	1.7e-30
WP_174538757.1|1732649_1732985_-|head,tail	phage head-tail adapter protein	head,tail	Q4ZCE5	Staphylococcus_virus	60.0	2.3e-36
WP_061050629.1|1732986_1733283_-|head,tail	phage head-tail adapter protein	head,tail	Q4ZC67	Staphylococcus_virus	63.3	4.9e-30
WP_061050630.1|1733282_1733576_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1W6JQI6	Staphylococcus_phage	65.3	2.5e-26
WP_174538758.1|1733589_1734522_-	sugar-binding protein	NA	A0A1W6JPD7	Staphylococcus_phage	78.6	4.5e-138
WP_174538759.1|1734534_1735059_-	phage scaffolding protein	NA	Q4ZBR6	Staphylococcus_phage	52.6	1.0e-25
WP_174538760.1|1735177_1735372_-	hypothetical protein	NA	A0A059T624	Staphylococcus_phage	41.3	3.6e-05
WP_174538761.1|1735371_1736328_-|head	phage head morphogenesis protein	head	A0A2H4JC26	uncultured_Caudovirales_phage	72.6	1.6e-130
WP_174538762.1|1736290_1737703_-|portal	phage portal protein	portal	Q4ZAA9	Staphylococcus_virus	67.9	4.0e-186
WP_174538763.1|1737707_1738970_-|terminase	PBSX family phage terminase large subunit	terminase	I6T7M4	Staphylococcus_virus	88.8	5.6e-224
WP_174538764.1|1738956_1739448_-|terminase	terminase small subunit	terminase	Q4ZAI5	Staphylococcus_virus	68.7	6.2e-54
WP_174538765.1|1739527_1739809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174538766.1|1740070_1740493_-	DUF1492 domain-containing protein	NA	A0A0F6N3E5	Staphylococcus_phage	82.0	5.0e-60
WP_174538767.1|1740507_1740651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174538768.1|1740650_1740947_-	DUF5052 family protein	NA	S4UCP8	Listeria_phage	65.3	5.4e-29
WP_174538769.1|1741011_1741707_+	DUF4145 domain-containing protein	NA	U3PE05	Staphylococcus_phage	53.4	4.2e-64
WP_174538770.1|1741688_1741871_-	hypothetical protein	NA	U3PJ54	Staphylococcus_phage	78.3	1.4e-19
WP_174538771.1|1741871_1742183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164972241.1|1742184_1742547_-	hypothetical protein	NA	Q4ZC91	Staphylococcus_virus	31.0	7.9e-06
WP_041080365.1|1742546_1742732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061050641.1|1742744_1742951_-	hypothetical protein	NA	A0A1W6JPS2	Staphylococcus_phage	47.8	2.3e-10
WP_174538772.1|1742928_1743129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174538822.1|1743125_1743929_-	ATP-binding protein	NA	A0A2I6PDV5	Staphylococcus_phage	46.2	1.0e-61
WP_174538773.1|1744026_1744878_-	DnaD domain protein	NA	A0A1Q1PVU4	Staphylococcus_phage	43.7	7.2e-50
WP_061050645.1|1744919_1745735_-	recombinase RecT	NA	S6AVW6	Thermus_phage	48.9	2.1e-59
WP_174538823.1|1745746_1746658_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	50.5	2.3e-78
WP_061050646.1|1746702_1747002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061050647.1|1747076_1747256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061050648.1|1747261_1747567_-	DUF771 domain-containing protein	NA	Q4ZD49	Staphylococcus_phage	45.5	8.4e-17
WP_174538774.1|1747767_1748136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174538824.1|1748504_1748723_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174538775.1|1748907_1749666_+	helix-turn-helix domain-containing protein	NA	Q8SDX2	Staphylococcus_phage	40.1	5.3e-44
WP_174538776.1|1749829_1750330_+	PH domain-containing protein	NA	A0A0D4DCT6	Staphylococcus_phage	66.7	1.2e-55
WP_174538825.1|1750668_1751715_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	57.3	3.0e-45
WP_174538777.1|1751784_1752222_+	DUF4231 domain-containing protein	NA	A0A1J0MFR0	Staphylococcus_phage	88.3	4.4e-67
WP_174538778.1|1752215_1752623_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	80.0	2.4e-59
WP_081224922.1|1752619_1752817_-	hypothetical protein	NA	A0A2H4JBN9	uncultured_Caudovirales_phage	90.8	8.9e-28
WP_174538779.1|1752914_1753958_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DCG3	Staphylococcus_phage	63.4	4.0e-119
WP_048787032.1|1754452_1754962_-	metallophosphoesterase	NA	NA	NA	NA	NA
1753972:1753993	attR	GTGCCATGCCAGTGCCATAAAA	NA	NA	NA	NA
WP_011303379.1|1754958_1755543_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.5	5.2e-15
WP_047503109.1|1755545_1756355_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002483630.1|1756564_1757386_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_048787031.1|1757388_1759152_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011303381.1|1759196_1759808_-	succinate dehydrogenase cytochrome b558 subunit	NA	NA	NA	NA	NA
WP_069793621.1|1760136_1761924_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011303383.1|1762129_1762444_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	6.6e-25
WP_011303384.1|1762525_1764874_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	24.9	3.0e-13
WP_069793622.1|1764883_1766596_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	26.8	1.7e-18
WP_047503103.1|1766707_1767229_-	CvpA family protein	NA	NA	NA	NA	NA
WP_002483638.1|1767225_1767495_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_048787030.1|1767803_1768736_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_047503101.1|1769035_1771438_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002483641.1|1771437_1772496_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.9	1.9e-31
>prophage 6
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	2083131	2101867	2569353		uncultured_Caudovirales_phage(33.33%)	14	NA	NA
WP_011303647.1|2083131_2084100_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.3	2.6e-136
WP_002483928.1|2084513_2085482_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	94.4	2.2e-175
WP_048787330.1|2085605_2087711_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	90.0	0.0e+00
WP_002483930.1|2087673_2088072_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	76.5	8.6e-54
WP_011303649.1|2088798_2089686_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002483932.1|2089699_2090200_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	72.3	2.0e-52
WP_048787329.1|2090382_2091897_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.8	3.3e-69
WP_011303651.1|2092267_2093773_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	6.3e-65
WP_011303653.1|2094244_2095192_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.6	1.5e-11
WP_002483937.1|2095362_2095911_-	5'-3'-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	39.0	2.0e-29
WP_174538790.1|2096088_2097144_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.2	3.9e-21
WP_002483939.1|2097302_2098820_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_048787328.1|2098816_2099779_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	4.8e-26
WP_047502733.1|2100088_2101867_-	DNA helicase RecQ	NA	K7YHB4	Megavirus	36.4	2.2e-77
>prophage 7
NZ_CP054434	Staphylococcus saprophyticus strain UTI-035 chromosome, complete genome	2569353	2110170	2117720	2569353		Pandoravirus(16.67%)	9	NA	NA
WP_011303663.1|2110170_2111313_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	36.7	5.4e-24
WP_011303664.1|2111296_2111890_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.5	1.9e-36
WP_002483950.1|2112145_2112817_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.9	1.2e-63
WP_011303665.1|2112818_2113244_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_002483952.1|2113236_2113953_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.4	2.5e-51
WP_011303666.1|2114193_2114787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002483954.1|2114855_2115107_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011303667.1|2115324_2116386_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	42.3	8.7e-61
WP_002483956.1|2116880_2117720_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.2e-52
