The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP023205	Escherichia coli strain TUM18781	4118807	0	735	4118807	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_046788396.1|120_735_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
>prophage 2
NZ_AP023205	Escherichia coli strain TUM18781	4118807	14998	16162	4118807		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943987.1|14998_16162_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 3
NZ_AP023205	Escherichia coli strain TUM18781	4118807	20094	33125	4118807	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|20094_22536_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|22574_23000_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|23204_24503_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|24606_24804_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|24885_25890_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|25892_27152_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|27237_28518_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|28593_28902_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|28987_29938_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001542593.1|29930_31778_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|31787_33125_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 4
NZ_AP023205	Escherichia coli strain TUM18781	4118807	37040	37586	4118807		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|37040_37586_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 5
NZ_AP023205	Escherichia coli strain TUM18781	4118807	45014	45992	4118807		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|45014_45992_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 6
NZ_AP023205	Escherichia coli strain TUM18781	4118807	50912	51446	4118807		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|50912_51446_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 7
NZ_AP023205	Escherichia coli strain TUM18781	4118807	55957	57941	4118807		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|55957_57604_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|57647_57941_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 8
NZ_AP023205	Escherichia coli strain TUM18781	4118807	72218	75430	4118807	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856834.1|72218_73676_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_001295074.1|73912_75430_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 9
NZ_AP023205	Escherichia coli strain TUM18781	4118807	96626	98129	4118807		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|96626_98129_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 10
NZ_AP023205	Escherichia coli strain TUM18781	4118807	102968	103757	4118807		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|102968_103757_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 11
NZ_AP023205	Escherichia coli strain TUM18781	4118807	109317	110867	4118807		Bacillus_virus(50.0%)	2	NA	NA
WP_001039800.1|109317_110076_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000640917.1|110186_110867_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	3.2e-08
>prophage 12
NZ_AP023205	Escherichia coli strain TUM18781	4118807	114852	116838	4118807		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|114852_116838_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 13
NZ_AP023205	Escherichia coli strain TUM18781	4118807	122083	124231	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|122083_124231_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 14
NZ_AP023205	Escherichia coli strain TUM18781	4118807	133514	135473	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|133514_135473_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 15
NZ_AP023205	Escherichia coli strain TUM18781	4118807	141057	142407	4118807		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|141057_142407_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 16
NZ_AP023205	Escherichia coli strain TUM18781	4118807	146224	149837	4118807		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|146224_146761_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|147014_149837_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 17
NZ_AP023205	Escherichia coli strain TUM18781	4118807	153854	157983	4118807		Salmonella_phage(25.0%)	4	NA	NA
WP_024251353.1|153854_154859_-	AAA family ATPase	NA	A0A249Y0V2	Salmonella_phage	31.1	1.4e-28
WP_000122239.1|154855_155413_-	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.3	2.9e-15
WP_001147336.1|155435_156515_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|156567_157983_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 18
NZ_AP023205	Escherichia coli strain TUM18781	4118807	164573	165182	4118807		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|164573_165182_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 19
NZ_AP023205	Escherichia coli strain TUM18781	4118807	174397	175513	4118807		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|174397_175513_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 20
NZ_AP023205	Escherichia coli strain TUM18781	4118807	191375	192167	4118807		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130547.1|191375_192167_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	3.5e-46
>prophage 21
NZ_AP023205	Escherichia coli strain TUM18781	4118807	197817	201501	4118807		Dickeya_phage(100.0%)	1	NA	NA
WP_000096012.1|197817_201501_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 22
NZ_AP023205	Escherichia coli strain TUM18781	4118807	216873	218463	4118807		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|216873_218463_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 23
NZ_AP023205	Escherichia coli strain TUM18781	4118807	223831	225595	4118807		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|223831_224104_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|224290_224881_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|224923_225595_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 24
NZ_AP023205	Escherichia coli strain TUM18781	4118807	234810	243139	4118807		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|234810_239034_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|239110_243139_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 25
NZ_AP023205	Escherichia coli strain TUM18781	4118807	247255	250308	4118807		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|247255_248440_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|249357_250308_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 26
NZ_AP023205	Escherichia coli strain TUM18781	4118807	258814	260659	4118807		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|258814_260659_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 27
NZ_AP023205	Escherichia coli strain TUM18781	4118807	267408	268623	4118807		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|267408_268623_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 28
NZ_AP023205	Escherichia coli strain TUM18781	4118807	280739	287986	4118807		Serratia_phage(33.33%)	5	NA	NA
WP_000184821.1|280739_283037_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|283087_283408_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|283422_284502_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174077.1|284810_287312_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|287323_287986_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 29
NZ_AP023205	Escherichia coli strain TUM18781	4118807	300854	305039	4118807		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_174402723.1|300854_305039_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 30
NZ_AP023205	Escherichia coli strain TUM18781	4118807	310676	315179	4118807		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|310676_312008_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|312074_313001_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|313093_313579_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|313663_313909_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|314333_315179_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 31
NZ_AP023205	Escherichia coli strain TUM18781	4118807	326753	331614	4118807		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|326753_327452_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|327448_328822_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|328927_329602_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|329750_330734_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|330993_331614_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 32
NZ_AP023205	Escherichia coli strain TUM18781	4118807	346310	349361	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|346310_349361_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 33
NZ_AP023205	Escherichia coli strain TUM18781	4118807	356682	359462	4118807		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|356682_357468_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|357501_358398_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718896.1|358565_359462_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
>prophage 34
NZ_AP023205	Escherichia coli strain TUM18781	4118807	375685	378156	4118807		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|375685_376735_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188776.1|376746_378156_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 35
NZ_AP023205	Escherichia coli strain TUM18781	4118807	382234	385021	4118807		uncultured_virus(100.0%)	1	NA	NA
WP_000250055.1|382234_385021_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 36
NZ_AP023205	Escherichia coli strain TUM18781	4118807	398709	399324	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|398709_399324_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 37
NZ_AP023205	Escherichia coli strain TUM18781	4118807	408114	411401	4118807		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|408114_408891_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|408893_409409_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|409412_409682_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|409760_411401_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 38
NZ_AP023205	Escherichia coli strain TUM18781	4118807	423812	425642	4118807		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|423812_425642_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 39
NZ_AP023205	Escherichia coli strain TUM18781	4118807	433127	436986	4118807		Bacillus_phage(100.0%)	3	NA	NA
WP_000383424.1|433127_435290_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|435373_436090_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|436089_436986_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 40
NZ_AP023205	Escherichia coli strain TUM18781	4118807	440026	445625	4118807		Salmonella_phage(100.0%)	4	NA	NA
WP_001584061.1|440026_441469_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	52.7	1.5e-34
WP_000864455.1|441465_442776_+	DKNYY domain-containing protein	NA	A0A0U2C3T4	Salmonella_phage	46.4	1.5e-09
WP_001352855.1|442806_444315_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_046881008.1|444311_445625_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.2e-07
>prophage 41
NZ_AP023205	Escherichia coli strain TUM18781	4118807	461910	468054	4118807		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|461910_463041_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|463045_463720_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|463697_464579_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226587.1|464597_465665_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000006625.1|465664_466927_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866669.1|466923_468054_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 42
NZ_AP023205	Escherichia coli strain TUM18781	4118807	472096	477508	4118807		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|472096_472426_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|472556_473822_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|473955_475440_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|475486_477508_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 43
NZ_AP023205	Escherichia coli strain TUM18781	4118807	485981	487628	4118807		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012602.1|485981_487628_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 44
NZ_AP023205	Escherichia coli strain TUM18781	4118807	501018	506871	4118807		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|501018_501909_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|501933_502899_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|502903_504409_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_001297694.1|504416_504836_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_004099092.1|505002_506871_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.7	2.7e-65
>prophage 45
NZ_AP023205	Escherichia coli strain TUM18781	4118807	510039	511032	4118807		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|510039_511032_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 46
NZ_AP023205	Escherichia coli strain TUM18781	4118807	522984	526346	4118807		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933726.1|522984_524355_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|524516_526346_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 47
NZ_AP023205	Escherichia coli strain TUM18781	4118807	531877	535718	4118807		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|531877_532918_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|533004_533964_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|533963_534854_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|534944_535718_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 48
NZ_AP023205	Escherichia coli strain TUM18781	4118807	546708	548046	4118807		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|546708_548046_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 49
NZ_AP023205	Escherichia coli strain TUM18781	4118807	558244	565613	4118807		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|558244_558502_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|558465_558825_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|558841_558982_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|559211_559292_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|559588_560992_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|560996_562097_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|562096_563170_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|563198_565613_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 50
NZ_AP023205	Escherichia coli strain TUM18781	4118807	571598	572747	4118807		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|571598_572747_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 51
NZ_AP023205	Escherichia coli strain TUM18781	4118807	577174	578128	4118807		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|577174_577588_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_097757870.1|577699_578128_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 52
NZ_AP023205	Escherichia coli strain TUM18781	4118807	584481	593643	4118807		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|584481_586197_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|586193_587687_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|587733_588183_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|588292_588640_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|588629_588992_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|588988_589486_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001349998.1|589493_590678_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.2	4.4e-13
WP_000060506.1|591096_591186_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|591750_591849_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|591954_593643_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 53
NZ_AP023205	Escherichia coli strain TUM18781	4118807	600947	602282	4118807		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|600947_602282_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 54
NZ_AP023205	Escherichia coli strain TUM18781	4118807	614400	615792	4118807		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|614400_615792_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 55
NZ_AP023205	Escherichia coli strain TUM18781	4118807	620913	627664	4118807		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|620913_623022_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|623040_623316_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|623370_623994_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_089586149.1|624251_625934_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	3.3e-22
WP_000924289.1|625930_626548_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|626839_627664_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 56
NZ_AP023205	Escherichia coli strain TUM18781	4118807	631037	635600	4118807		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|631037_631496_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|631473_632694_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298959.1|632865_633534_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|633750_633987_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|634007_634175_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|634272_635082_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|635120_635600_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 57
NZ_AP023205	Escherichia coli strain TUM18781	4118807	647531	658259	4118807		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|647531_648464_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842823.1|648767_649625_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|649899_651096_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|651105_652131_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|652369_653404_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|653390_654350_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|654353_655637_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001440866.1|655646_657191_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|657435_657867_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|658007_658259_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 58
NZ_AP023205	Escherichia coli strain TUM18781	4118807	680389	681328	4118807		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000887058.1|680389_681328_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
>prophage 59
NZ_AP023205	Escherichia coli strain TUM18781	4118807	689008	690853	4118807		Tupanvirus(100.0%)	1	NA	NA
WP_000582482.1|689008_690853_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 60
NZ_AP023205	Escherichia coli strain TUM18781	4118807	715039	716581	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|715039_716581_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 61
NZ_AP023205	Escherichia coli strain TUM18781	4118807	721899	722895	4118807		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|721899_722895_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 62
NZ_AP023205	Escherichia coli strain TUM18781	4118807	727119	727332	4118807		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|727119_727332_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 63
NZ_AP023205	Escherichia coli strain TUM18781	4118807	730986	733320	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|730986_733320_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 64
NZ_AP023205	Escherichia coli strain TUM18781	4118807	748901	750886	4118807		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|748901_749885_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107035.1|749881_750886_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 65
NZ_AP023205	Escherichia coli strain TUM18781	4118807	798349	798997	4118807		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|798349_798997_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 66
NZ_AP023205	Escherichia coli strain TUM18781	4118807	803867	806002	4118807		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|803867_804293_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_000922639.1|804305_805595_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|805648_806002_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 67
NZ_AP023205	Escherichia coli strain TUM18781	4118807	809578	811621	4118807		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|809578_811621_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 68
NZ_AP023205	Escherichia coli strain TUM18781	4118807	825034	830917	4118807		Staphylococcus_phage(50.0%)	5	NA	NA
WP_000149132.1|825034_827770_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001314210.1|827769_828894_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593555.1|829224_829584_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|829703_830105_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173667.1|830110_830917_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
>prophage 69
NZ_AP023205	Escherichia coli strain TUM18781	4118807	838798	842930	4118807		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|838798_839464_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|839684_839930_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_053264548.1|840031_842230_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	7.2e-118
WP_000964718.1|842303_842930_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 70
NZ_AP023205	Escherichia coli strain TUM18781	4118807	845936	848755	4118807		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|845936_846605_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|846597_847656_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|847900_848755_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 71
NZ_AP023205	Escherichia coli strain TUM18781	4118807	854488	855971	4118807		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082110.1|854488_855256_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|855257_855971_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 72
NZ_AP023205	Escherichia coli strain TUM18781	4118807	859511	861322	4118807		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|859511_860582_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073590.1|860578_861322_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 73
NZ_AP023205	Escherichia coli strain TUM18781	4118807	881329	883777	4118807		Dickeya_phage(100.0%)	1	NA	NA
WP_000993455.1|881329_883777_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 74
NZ_AP023205	Escherichia coli strain TUM18781	4118807	893006	894233	4118807		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105435.1|893006_894233_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.3	6.4e-132
>prophage 75
NZ_AP023205	Escherichia coli strain TUM18781	4118807	898612	901006	4118807		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|898612_901006_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 76
NZ_AP023205	Escherichia coli strain TUM18781	4118807	906975	907854	4118807		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|906975_907854_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 77
NZ_AP023205	Escherichia coli strain TUM18781	4118807	914417	918928	4118807		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|914417_915137_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|915133_916486_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|916516_916813_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493758.1|916871_917189_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001298201.1|917305_918928_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 78
NZ_AP023205	Escherichia coli strain TUM18781	4118807	935830	936667	4118807		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|935830_936667_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 79
NZ_AP023205	Escherichia coli strain TUM18781	4118807	960895	970436	4118807		Acinetobacter_phage(25.0%)	9	NA	NA
WP_032142035.1|960895_961459_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	2.4e-62
WP_000963785.1|961544_962765_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|962831_964922_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|964972_965605_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|965906_966311_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|966365_967235_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|967288_967507_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057346.1|967500_968523_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|968522_970436_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 80
NZ_AP023205	Escherichia coli strain TUM18781	4118807	976006	981580	4118807		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|976006_976393_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|976392_976752_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|976759_977047_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|977172_977547_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|977643_978114_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|978210_980325_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|980395_981580_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 81
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1001457	1002929	4118807	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004432.1|1001457_1002405_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|1002419_1002929_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 82
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1013431	1017585	4118807		Bacillus_virus(50.0%)	4	NA	NA
WP_000078339.1|1013431_1014190_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001297685.1|1014197_1015301_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|1015310_1016492_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|1016559_1017585_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 83
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1024089	1024974	4118807		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258919.1|1024089_1024974_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
>prophage 84
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1035539	1036583	4118807		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1035539_1036583_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 85
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1053359	1055884	4118807	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|1053359_1054427_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1054516_1055884_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 86
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1059850	1060348	4118807	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1059850_1060348_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 87
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1064052	1065543	4118807		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|1064052_1065543_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 88
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1075239	1090034	4118807		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|1075239_1076169_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1076264_1078601_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_038976814.1|1078830_1079484_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|1079480_1080209_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|1080205_1080838_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1081051_1081324_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1081320_1082175_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|1082220_1082712_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1082829_1083117_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|1083139_1084573_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1084620_1085346_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1085352_1085910_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1085878_1086454_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|1086450_1087017_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|1087037_1088024_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|1088037_1089015_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1089224_1090034_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 89
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1094102	1095580	4118807		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|1094102_1094381_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|1094608_1095580_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 90
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1102208	1105081	4118807	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1102208_1104143_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|1104232_1105081_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 91
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1108282	1114921	4118807		Dickeya_phage(50.0%)	4	NA	NA
WP_000207684.1|1108282_1109626_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1110256_1110709_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|1110736_1112224_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133043.1|1112248_1114921_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.5e-24
>prophage 92
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1120402	1122292	4118807		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1120402_1122292_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 93
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1127994	1135787	4118807		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189326.1|1127994_1128297_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.2	1.5e-13
WP_000449041.1|1128347_1128791_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|1128770_1129289_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001351326.1|1129416_1130052_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147579.1|1130124_1131165_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|1131278_1131854_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|1131863_1132454_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|1132473_1132869_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249149.1|1132826_1134863_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809262.1|1134926_1135787_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 94
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1158796	1159942	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|1158796_1159942_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 95
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1169208	1171503	4118807		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1169208_1171503_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 96
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1197736	1198702	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|1197736_1198702_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 97
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1211123	1227307	4118807	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082867.1|1211123_1214216_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.3e-157
WP_000212470.1|1214399_1215383_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|1215601_1215934_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|1215975_1217355_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|1217772_1219293_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|1219446_1220070_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|1220346_1221111_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|1221364_1221871_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|1221949_1223791_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|1223985_1225731_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|1225841_1226057_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|1226293_1227307_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 98
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1233689	1234928	4118807	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|1233689_1234928_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 99
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1240065	1241499	4118807		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1240065_1241499_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 100
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1251014	1261976	4118807		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|1251014_1251668_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|1251928_1252099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|1252156_1252930_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_024184509.1|1253072_1253861_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|1253898_1255059_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|1255064_1255736_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|1255883_1257365_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|1257569_1258199_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|1258199_1258622_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|1258646_1259474_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|1259473_1260055_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|1260083_1261976_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 101
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1265803	1276627	4118807		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|1265803_1266196_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183481.1|1266248_1266731_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001281881.1|1267276_1269535_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|1269768_1270506_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|1270580_1271993_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|1272103_1274323_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|1274365_1274623_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|1274673_1275600_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|1275799_1276627_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 102
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1282703	1283588	4118807		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1282703_1283588_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 103
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1305807	1306980	4118807		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|1305807_1306980_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 104
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1363579	1364734	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1363579_1364734_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 105
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1379903	1380581	4118807		Bacillus_virus(100.0%)	1	NA	NA
WP_000956868.1|1379903_1380581_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.4e-09
>prophage 106
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1398631	1399864	4118807		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1398631_1399864_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 107
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1408391	1413765	4118807		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195023.1|1408391_1411265_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
WP_000951951.1|1411531_1412275_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001363803.1|1412331_1413765_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
>prophage 108
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1417689	1433081	4118807	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|1417689_1418586_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715208.1|1418610_1419321_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813218.1|1419326_1421060_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_001701073.1|1421150_1422248_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|1422258_1423776_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192814.1|1423818_1424367_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|1424421_1424493_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|1424489_1424615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|1424616_1426065_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001355763.1|1426500_1428420_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|1428419_1428908_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|1428943_1430311_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|1430346_1431663_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|1431680_1433081_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 109
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1457360	1458116	4118807		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1457360_1458116_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 110
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1480934	1483429	4118807		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|1480934_1481696_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|1482010_1483429_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 111
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1493060	1499833	4118807		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|1493060_1493774_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_032283505.1|1493842_1494532_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|1495216_1495747_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957912.1|1495759_1498006_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|1498156_1499032_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|1499038_1499833_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 112
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1505310	1516438	4118807		Klosneuvirus(25.0%)	5	NA	NA
WP_001138204.1|1505310_1508199_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.8	1.8e-68
WP_001285985.1|1508191_1511734_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|1511733_1513560_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|1513621_1514953_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|1515184_1516438_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 113
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1537063	1546418	4118807		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_088529264.1|1537063_1539571_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.0	1.5e-18
WP_000637297.1|1539895_1540432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534495.1|1540421_1541273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000512757.1|1541274_1543761_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.4	5.3e-16
WP_001583868.1|1543772_1546418_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.5	1.4e-99
>prophage 114
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1555410	1557916	4118807	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000117728.1|1555410_1556217_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184247.1|1556267_1556711_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_032192149.1|1556710_1557916_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	1.0e-73
>prophage 115
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1569442	1570198	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1569442_1570198_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 116
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1575056	1575905	4118807		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1575056_1575905_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 117
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1583439	1587554	4118807		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|1583439_1586196_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_021542211.1|1586252_1587554_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.1	2.3e-39
>prophage 118
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1591586	1596506	4118807		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|1591586_1593224_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|1593311_1594610_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_032197157.1|1594669_1595542_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|1595555_1595696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|1595834_1596506_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 119
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1601954	1602740	4118807		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1601954_1602740_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 120
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1627079	1629112	4118807		Hokovirus(50.0%)	2	NA	NA
WP_001090345.1|1627079_1628507_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
WP_001173673.1|1628506_1629112_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 121
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1632224	1635940	4118807		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|1632224_1632986_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1632979_1633606_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1633745_1634885_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1634947_1635940_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 122
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1641154	1648294	4118807		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1641154_1641793_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_174402734.1|1641789_1643052_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847985.1|1643048_1643957_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1644152_1644920_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|1644970_1645627_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1645732_1648294_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 123
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1666122	1667133	4118807		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363554.1|1666122_1667133_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 124
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1674900	1675866	4118807		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|1674900_1675866_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 125
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1681332	1686892	4118807	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|1681332_1681830_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|1681909_1682971_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|1683213_1683714_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|1683841_1686472_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1686706_1686892_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 126
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1699940	1705236	4118807		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|1699940_1701143_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1701497_1702457_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_053264630.1|1702466_1704611_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	1.1e-195
WP_000080947.1|1704583_1704994_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223224.1|1704990_1705236_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.4e-06
>prophage 127
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1709171	1713223	4118807		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|1709171_1709621_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1709621_1710284_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1710304_1711705_-	GABA permease	NA	NA	NA	NA	NA
WP_000097662.1|1711942_1713223_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
>prophage 128
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1718481	1726248	4118807	integrase,transposase	Escherichia_phage(66.67%)	6	1709715:1709728	1726558:1726571
1709715:1709728	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_087599250.1|1718481_1719643_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|1719795_1721514_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_032217274.1|1721515_1723267_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.5	0.0e+00
WP_000448925.1|1723338_1723755_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1723793_1725023_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1725765_1726248_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1726558:1726571	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 129
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1740587	1741658	4118807		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|1740587_1741658_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 130
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1747564	1750138	4118807		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1747564_1750138_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 131
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1755993	1757292	4118807		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|1755993_1757292_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 132
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1762585	1768844	4118807	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|1762585_1763005_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1763211_1764249_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1764296_1764986_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1765290_1765674_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1765729_1766317_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|1766419_1767301_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1767509_1768844_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 133
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1774615	1778358	4118807		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|1774615_1776415_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1776430_1777405_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1777677_1778358_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 134
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1781816	1782077	4118807		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1781816_1782077_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 135
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1786197	1797505	4118807		Bacillus_phage(50.0%)	7	NA	NA
WP_044722602.1|1786197_1790085_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001297612.1|1790660_1792088_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|1792252_1792966_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|1792955_1794290_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|1794350_1794689_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|1794733_1795924_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|1796251_1797505_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 136
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1803263	1804775	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493471.1|1803263_1804775_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 137
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1819911	1826368	4118807		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|1819911_1821126_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|1821153_1821540_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|1821556_1821880_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|1821975_1822491_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|1822507_1824358_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|1824359_1824695_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|1824706_1824907_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133591.1|1825084_1826368_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
>prophage 138
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1836253	1836685	4118807		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1836253_1836685_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 139
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1845514	1851999	4118807		Escherichia_phage(66.67%)	7	NA	NA
WP_000937933.1|1845514_1846885_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|1847046_1848513_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1848581_1850159_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|1850253_1850793_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001295476.1|1850808_1851327_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|1851637_1851829_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|1851846_1851999_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 140
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1858245	1862247	4118807		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|1858245_1858884_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|1858883_1859921_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|1860245_1860872_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1860957_1862247_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 141
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1883335	1884049	4118807		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1883335_1884049_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 142
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1902068	1903019	4118807		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1902068_1903019_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 143
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1921573	1926511	4118807		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|1921573_1922443_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|1922656_1923082_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842944.1|1923068_1923518_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|1923578_1924154_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|1924249_1925149_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|1925206_1926511_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 144
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1929989	1945346	4118807		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|1929989_1930781_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290230.1|1930938_1931955_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458406.1|1931954_1932788_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|1932787_1933663_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|1933652_1934750_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_047675307.1|1934883_1935795_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	4.5e-58
WP_000719943.1|1935797_1936166_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|1936270_1937122_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1937163_1937673_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1937713_1939441_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1939485_1939743_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1940126_1941098_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|1941282_1942044_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|1942273_1943260_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|1943330_1945346_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 145
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1967047	1967782	4118807		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1967047_1967782_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 146
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1971600	1972521	4118807		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1971600_1972521_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 147
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1976250	1983827	4118807		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|1976250_1977945_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|1978014_1978959_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|1979032_1980178_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001348569.1|1980233_1983827_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 148
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1990468	1991902	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1990468_1991902_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 149
NZ_AP023205	Escherichia coli strain TUM18781	4118807	1994942	1995875	4118807		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1994942_1995875_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 150
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2013760	2014846	4118807		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|2013760_2014846_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 151
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2023410	2024547	4118807		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699126.1|2023410_2024547_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
>prophage 152
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2031023	2032541	4118807		Mollivirus(100.0%)	1	NA	NA
WP_000334218.1|2031023_2032541_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
>prophage 153
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2036752	2038625	4118807		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|2036752_2037526_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|2037722_2038625_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 154
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2049184	2052412	4118807		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|2049184_2049835_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|2049921_2051754_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|2051812_2052412_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 155
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2086828	2091832	4118807		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|2086828_2088811_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|2088810_2089779_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001388277.1|2089782_2090922_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_001297077.1|2091229_2091832_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 156
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2094984	2095887	4118807	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_089586082.1|2094984_2095887_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 157
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2101779	2115834	4118807		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779091.1|2101779_2102856_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301049.1|2103317_2103968_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|2104021_2104276_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|2104275_2105406_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|2105494_2107780_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_089586092.1|2108475_2112210_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.9	1.2e-19
WP_000990766.1|2112337_2113060_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|2113206_2115834_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 158
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2125534	2128384	4118807		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|2125534_2128384_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 159
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2132661	2138439	4118807		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865570.1|2132661_2133765_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	1.2e-118
WP_000406087.1|2133876_2134932_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710363.1|2135005_2136070_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884942.1|2136069_2136720_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422230.1|2136795_2138439_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 160
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2147206	2147824	4118807		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2147206_2147824_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 161
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2159523	2167171	4118807		Vibrio_phage(50.0%)	7	NA	NA
WP_000050787.1|2159523_2160531_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
WP_000494183.1|2160669_2160954_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578056.1|2161078_2162839_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|2162987_2163683_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|2163710_2164901_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|2165233_2165578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264455.1|2165581_2167171_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 162
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2172925	2177226	4118807		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2172925_2173492_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|2173903_2174617_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|2174655_2175642_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848214.1|2175759_2177226_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
>prophage 163
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2191718	2192576	4118807		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2191718_2192576_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 164
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2196645	2200431	4118807		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|2196645_2198637_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_089586077.1|2198668_2199505_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2199762_2200431_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 165
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2204125	2205646	4118807		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|2204125_2205646_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 166
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2225961	2235403	4118807		Enterobacteria_phage(85.71%)	10	NA	NA
WP_021542177.1|2225961_2226888_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|2226892_2227624_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2227604_2227712_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|2227771_2228503_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|2228724_2230410_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2230406_2231126_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2231172_2231643_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2231683_2232145_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|2232269_2234270_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|2234266_2235403_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 167
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2247914	2312893	4118807	capsid,tail,head,portal,tRNA,plate,lysis,integrase,terminase,holin	Escherichia_phage(50.0%)	75	2275155:2275182	2307809:2307836
WP_001295427.1|2247914_2249948_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2250079_2251189_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001447395.1|2251451_2251733_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|2252025_2252568_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677398.1|2252648_2253323_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945409.1|2253338_2255819_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405711.1|2255834_2256869_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2256950_2257289_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|2257507_2258332_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2258452_2258725_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195588.1|2258947_2259736_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|2259732_2260533_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|2260597_2261416_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|2261467_2262214_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|2262187_2263153_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846226.1|2263149_2264154_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.7e-13
WP_000858484.1|2264150_2265428_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129567.1|2265684_2266737_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001345895.1|2267044_2267899_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853879.1|2267927_2269190_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182904.1|2269199_2269652_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|2269682_2269967_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490678.1|2269970_2271326_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_174402737.1|2271373_2272414_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|2272513_2273293_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|2273374_2274274_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|2274679_2274997_+	hypothetical protein	NA	NA	NA	NA	NA
2275155:2275182	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|2275261_2276275_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|2276390_2276690_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|2276811_2277087_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|2277097_2277268_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_137537363.1|2277264_2277765_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	99.4	3.8e-91
WP_000557703.1|2277828_2278053_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001534948.1|2278052_2278355_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	1.9e-45
WP_001113269.1|2278354_2278579_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_000027664.1|2278575_2278851_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_137537362.1|2278840_2281117_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.3	0.0e+00
WP_137537361.1|2281604_2283149_-	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	99.8	7.7e-292
WP_089626729.1|2283543_2284578_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	3.5e-200
WP_000156861.1|2284577_2286350_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085976.1|2286523_2287378_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_044527451.1|2287436_2288510_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.4	1.9e-201
WP_062874095.1|2288513_2289257_+|terminase	terminase endonuclease subunit	terminase	Q83VT2	Escherichia_phage	99.2	8.1e-122
WP_000988633.1|2289356_2289866_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|2289865_2290069_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|2290072_2290354_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|2290353_2290851_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_089620551.1|2290865_2291291_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	93.6	2.8e-58
WP_089530808.1|2291278_2291704_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	8.8e-65
WP_001440152.1|2291675_2291849_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917145.1|2291811_2292279_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_089626728.1|2292271_2292733_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.6	6.5e-45
WP_089626726.1|2292748_2293288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001680515.1|2293298_2294651_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_089626725.1|2294752_2295388_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
WP_000127163.1|2295384_2295732_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121497.1|2295736_2296645_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_089626724.1|2296637_2297168_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.3	1.2e-100
WP_137537359.1|2297178_2299428_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	56.3	1.2e-136
WP_063611711.1|2299431_2299959_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	2.4e-88
WP_137537358.1|2300397_2300775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286740.1|2301105_2302296_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	2.1e-225
WP_001251408.1|2302308_2302827_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|2302883_2303159_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|2303191_2303311_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_089626722.1|2303303_2305751_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	93.5	0.0e+00
WP_085440879.1|2305765_2306245_+|tail	phage tail protein	tail	O64315	Escherichia_phage	97.5	1.3e-83
WP_089626721.1|2306244_2307408_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	1.6e-204
WP_000468308.1|2307489_2307708_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476018.1|2307980_2309342_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	3.2e-217
2307809:2307836	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|2309444_2309741_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|2309742_2310039_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|2310247_2310580_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|2310770_2311493_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675146.1|2311489_2312893_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 168
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2326334	2327687	4118807		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_089586072.1|2326334_2327687_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 169
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2332351	2342827	4118807		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|2332351_2332993_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|2333084_2333666_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252331.1|2333687_2335541_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001300971.1|2335814_2337398_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|2337598_2337748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|2338056_2339196_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|2339201_2339645_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137136.1|2339647_2341810_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654516.1|2341987_2342827_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.3e-06
>prophage 170
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2347070	2353864	4118807		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048188.1|2347070_2348192_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
WP_000043623.1|2348194_2349160_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_001298845.1|2349162_2349642_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699714.1|2349638_2350862_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|2350864_2352301_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_174402739.1|2352493_2353864_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.2e-32
>prophage 171
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2359480	2361943	4118807		Klebsiella_phage(50.0%)	2	NA	NA
WP_089586070.1|2359480_2360875_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	6.3e-19
WP_000183060.1|2361049_2361943_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 172
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2367255	2376413	4118807		Paramecium_bursaria_Chlorella_virus(33.33%)	8	NA	NA
WP_000708864.1|2367255_2368374_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	65.0	9.6e-135
WP_000163137.1|2368377_2369343_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.8	8.4e-87
WP_001042470.1|2369345_2369807_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000926412.1|2369812_2371219_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.2	7.8e-49
WP_068868467.1|2371218_2371965_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.3	1.6e-08
WP_023486668.1|2371970_2373395_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_000043476.1|2373591_2374998_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_001570041.1|2375246_2376413_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
>prophage 173
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2385099	2385999	4118807		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2385099_2385999_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 174
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2393623	2394790	4118807		Stx2-converting_phage(100.0%)	1	NA	NA
WP_053264463.1|2393623_2394790_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	7.2e-226
>prophage 175
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2404841	2410247	4118807		Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_000240779.1|2404841_2405060_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
WP_053264465.1|2405141_2405432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023155942.1|2405476_2405773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264466.1|2406066_2408037_+	ATP-binding protein	NA	X5JAK5	Clostridium_phage	36.5	4.2e-77
WP_053264467.1|2408696_2409488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053264468.1|2409512_2410247_-	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	40.9	1.4e-25
>prophage 176
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2425437	2428604	4118807	integrase	Moraxella_phage(50.0%)	3	2422218:2422231	2436157:2436170
2422218:2422231	attL	CATTATTATAACAA	NA	NA	NA	NA
WP_053264482.1|2425437_2426553_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.6	1.9e-21
WP_157838737.1|2426552_2427269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264489.1|2427335_2428604_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.6	7.9e-77
2436157:2436170	attR	TTGTTATAATAATG	NA	NA	NA	NA
>prophage 177
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2445809	2446340	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|2445809_2446340_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 178
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2449884	2462266	4118807		Bacillus_phage(28.57%)	12	NA	NA
WP_001362894.1|2449884_2450556_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000826746.1|2450555_2451914_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218209.1|2452021_2452873_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824362.1|2453464_2454538_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_001313057.1|2455104_2455470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365545.1|2455509_2456205_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_001157239.1|2456271_2457690_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786004.1|2457670_2458141_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212238.1|2458129_2459050_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2459222_2460140_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|2460218_2460401_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_174402741.1|2460571_2462266_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	39.4	7.7e-19
>prophage 179
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2479471	2481291	4118807	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_174402742.1|2479471_2480635_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.4e-199
WP_000334586.1|2480619_2481291_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
>prophage 180
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2493530	2494283	4118807		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|2493530_2494283_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 181
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2506268	2507783	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_174402743.1|2506268_2507783_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 182
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2517870	2523514	4118807		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001307261.1|2517870_2519532_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_032151742.1|2519577_2521179_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204335.1|2521197_2522058_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|2522060_2523110_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2523124_2523514_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 183
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2528766	2530500	4118807	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|2528766_2530500_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 184
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2538395	2540446	4118807		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|2538395_2539139_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2539179_2539575_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639274.1|2539627_2540446_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 185
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2544464	2552807	4118807	transposase	Bacillus_virus(50.0%)	10	NA	NA
WP_001295503.1|2544464_2544986_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|2544987_2545590_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|2545660_2545726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|2545864_2546476_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2546484_2547495_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000399698.1|2547762_2548743_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000571465.1|2548920_2549706_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2549702_2550458_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|2550536_2551469_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2551484_2552807_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 186
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2556806	2558282	4118807		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2556806_2558282_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 187
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2566337	2570807	4118807		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|2566337_2567000_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|2567023_2567680_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2567781_2568012_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204700.1|2568150_2568525_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2568528_2569401_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|2569413_2569755_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|2570150_2570807_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
>prophage 188
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2578303	2580352	4118807		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|2578303_2580352_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 189
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2585682	2585892	4118807		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2585682_2585892_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 190
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2591532	2593089	4118807		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2591532_2593089_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 191
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2596951	2605058	4118807	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|2596951_2598313_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2598386_2598566_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|2598685_2599045_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2599407_2599752_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2599883_2601794_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220997.1|2601851_2602547_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|2602586_2603168_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_077822690.1|2603372_2605058_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 192
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2613431	2615610	4118807	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_072133801.1|2613431_2614394_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	2.8e-42
WP_071820416.1|2614401_2615610_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.2e-207
>prophage 193
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2621560	2626137	4118807		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|2621560_2623051_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|2623231_2624707_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|2624853_2626137_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 194
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2629455	2630310	4118807		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|2629455_2630310_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 195
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2639123	2643208	4118807		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723710.1|2639123_2640104_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
WP_000719096.1|2640240_2640999_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438810.1|2641115_2642474_+	MFS transporter	NA	NA	NA	NA	NA
WP_001120527.1|2642566_2643208_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 196
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2648134	2650096	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_089586210.1|2648134_2650096_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 197
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2655694	2656348	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000882826.1|2655694_2656348_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 198
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2663110	2664331	4118807		Klosneuvirus(100.0%)	1	NA	NA
WP_000082041.1|2663110_2664331_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.5e-27
>prophage 199
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2671807	2672635	4118807		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|2671807_2672635_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 200
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2680252	2682514	4118807		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|2680252_2682514_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 201
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2693809	2713349	4118807	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|2693809_2695738_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|2695741_2696284_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2696380_2696578_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2696630_2696987_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2697109_2697154_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|2697437_2698421_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|2698435_2700823_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2700827_2701127_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956519.1|2701227_2702208_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|2702270_2702822_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2702821_2703571_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|2703648_2704113_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_089586158.1|2704359_2705073_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_038977146.1|2705135_2706572_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|2706575_2706767_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|2706898_2707945_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|2708101_2708935_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|2709267_2711646_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000869244.1|2711702_2713349_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	5.9e-32
>prophage 202
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2731994	2737078	4118807		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|2731994_2732363_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|2732371_2733859_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|2733868_2734615_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000908012.1|2734589_2735861_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144565.1|2735857_2737078_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 203
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2745368	2747635	4118807		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|2745368_2746037_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001070027.1|2746033_2746819_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|2746822_2747635_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 204
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2753139	2761931	4118807		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|2753139_2753781_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|2753820_2754969_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|2755259_2756471_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|2756583_2757516_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2757512_2758538_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2758836_2758926_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|2759091_2760261_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2760406_2760988_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|2761115_2761931_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 205
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2770734	2772233	4118807		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|2770734_2771631_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|2771711_2772233_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 206
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2779144	2780419	4118807	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2779144_2780419_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 207
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2800302	2802114	4118807		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2800302_2802114_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 208
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2812008	2813310	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|2812008_2813310_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 209
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2823411	2893564	4118807	capsid,tail,head,portal,lysis,integrase,protease,terminase	Escherichia_phage(41.07%)	82	2830987:2831002	2862132:2862147
WP_001260849.1|2823411_2824233_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2824332_2824416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2824508_2824844_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|2825240_2826494_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2826600_2827494_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2827628_2828849_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2828973_2829669_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2829621_2830914_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2830987:2831002	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2831072_2831687_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2831729_2832584_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001676570.1|2832585_2833203_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_001340362.1|2833213_2835637_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_097734408.1|2835697_2838124_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.0e-215
WP_001307224.1|2838322_2838628_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2838735_2839446_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2839448_2840009_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705214.1|2840043_2840385_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2840519_2840846_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2841051_2842266_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2842277_2843297_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2843354_2843465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281937.1|2843484_2844765_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|2844799_2845051_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_033873403.1|2845123_2847595_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|2847688_2847880_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2847876_2848065_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2848480_2848768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241297.1|2848736_2849114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089616563.1|2849113_2849266_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000233320.1|2849563_2849983_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|2850062_2850317_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_047662441.1|2850313_2850739_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262373.1|2850810_2851881_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	5.0e-64
WP_033560810.1|2851921_2852344_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.3	5.3e-62
WP_033560811.1|2852634_2853726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089616604.1|2853736_2854984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001625142.1|2854980_2855637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2856040_2856148_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813254.1|2856249_2856405_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_032154696.1|2856863_2857142_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	4.6e-06
WP_001265196.1|2857143_2858193_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_001047132.1|2858206_2858959_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_000066484.1|2859635_2859851_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2860604_2860820_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189918.1|2860824_2861136_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001092966.1|2861132_2861666_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071769.1|2861662_2862160_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2862132:2862147	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2862521_2862734_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2862744_2862933_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2862935_2863001_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2863080_2863236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2863407_2863581_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2863732_2864143_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2864200_2864434_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453580.1|2864822_2865368_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027268.1|2865342_2867268_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|2867264_2867471_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_097506759.1|2867467_2869069_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_062858187.1|2869049_2870369_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	6.2e-234
WP_074514849.1|2870378_2870711_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000063265.1|2870766_2871792_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_032249885.1|2871833_2872229_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	1.6e-55
WP_000752960.1|2872240_2872594_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985119.1|2872605_2873184_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683128.1|2873180_2873576_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001367716.1|2873583_2874324_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	5.6e-131
WP_000479142.1|2874339_2874762_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_097506760.1|2874743_2875178_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	3.4e-64
WP_097506761.1|2875170_2877750_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
WP_000847347.1|2877746_2878076_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152639.1|2878075_2878774_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194783.1|2878779_2879523_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090891.1|2879459_2880092_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_123317882.1|2880152_2883632_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001568881.1|2883699_2884299_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	2.5e-105
WP_123317881.1|2884363_2887894_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_001439069.1|2887893_2888469_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	5.5e-102
WP_000078178.1|2888566_2889157_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2889473_2889707_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2889775_2889889_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527797.1|2891864_2893325_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|2893360_2893564_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 210
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2898930	2899821	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|2898930_2899821_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 211
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2907325	2909455	4118807		Pandoravirus(50.0%)	3	NA	NA
WP_000012613.1|2907325_2908765_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.2e-28
WP_000803659.1|2908821_2909040_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2909071_2909455_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 212
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2917200	2918619	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|2917200_2918619_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 213
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2926500	2928036	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194889.1|2926500_2928036_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 214
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2931439	2936860	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_053264574.1|2931439_2936860_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	1.0e-141
>prophage 215
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2953447	2960382	4118807		Bacillus_phage(50.0%)	2	NA	NA
WP_000628556.1|2953447_2955133_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	7.7e-11
WP_057075829.1|2957598_2960382_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
>prophage 216
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2965656	2969463	4118807		Bacillus_virus(50.0%)	2	NA	NA
WP_000426265.1|2965656_2967039_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|2967063_2969463_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 217
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2973779	2975685	4118807		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193566.1|2973779_2974766_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_001285527.1|2974758_2975685_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	3.1e-14
>prophage 218
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2978959	2980401	4118807		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|2978959_2979970_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|2980116_2980401_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 219
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2986413	2986704	4118807		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|2986413_2986704_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 220
NZ_AP023205	Escherichia coli strain TUM18781	4118807	2993589	2995134	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|2993589_2995134_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 221
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3000939	3014432	4118807	transposase	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_089586260.1|3000939_3005202_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_089586261.1|3005282_3005525_-	DUF3969 family protein	NA	NA	NA	NA	NA
WP_000960006.1|3005742_3006195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136688175.1|3006224_3007133_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001001073.1|3007640_3007850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053264705.1|3008047_3012256_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_000103110.1|3012323_3014432_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	7.3e-27
>prophage 222
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3019341	3021444	4118807		Salmonella_phage(100.0%)	1	NA	NA
WP_057075932.1|3019341_3021444_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	2.8e-135
>prophage 223
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3025709	3026519	4118807		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|3025709_3026519_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 224
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3029900	3040052	4118807	transposase	Mycoplasma_phage(25.0%)	9	NA	NA
WP_000220396.1|3029900_3030914_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|3030931_3032077_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001676543.1|3032321_3033728_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3033806_3034223_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000494244.1|3034644_3034875_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|3034966_3036928_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429141.1|3037000_3037537_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_071601296.1|3037589_3038804_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_174402746.1|3038843_3040052_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	2.3e-206
>prophage 225
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3051854	3052803	4118807		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|3051854_3052028_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|3052272_3052803_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 226
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3056742	3060645	4118807		Klosneuvirus(100.0%)	1	NA	NA
WP_089586193.1|3056742_3060645_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 227
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3091930	3092920	4118807		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3091930_3092920_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 228
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3097880	3105150	4118807	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_174402747.1|3097880_3099014_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	7.0e-117
WP_001082294.1|3099154_3099589_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000081418.1|3099764_3100700_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123738.1|3100828_3102202_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3102679_3103663_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|3103917_3105150_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 229
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3111476	3111992	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|3111476_3111992_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 230
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3130173	3131256	4118807		Planktothrix_phage(100.0%)	1	NA	NA
WP_174402748.1|3130173_3131256_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 231
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3145259	3146525	4118807		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|3145259_3146525_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 232
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3159440	3165098	4118807		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|3159440_3160247_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968853.1|3160314_3160668_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3161035_3161824_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|3161968_3163096_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|3163163_3165098_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 233
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3172913	3173504	4118807		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3172913_3173504_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 234
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3178428	3183720	4118807	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|3178428_3181026_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|3181405_3181657_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3181692_3182742_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|3182961_3183720_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
>prophage 235
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3188653	3191611	4118807		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|3188653_3190249_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983906.1|3190249_3191611_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
>prophage 236
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3203269	3205284	4118807		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3203269_3204274_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|3204270_3205284_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 237
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3213694	3223704	4118807		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|3213694_3214312_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|3214916_3215330_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3215473_3216382_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_089586160.1|3216583_3217597_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|3217688_3218594_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|3218706_3219165_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|3219214_3220057_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|3220781_3221459_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|3221458_3222169_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|3222165_3223704_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 238
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3234958	3235189	4118807		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|3234958_3235189_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 239
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3238290	3242298	4118807		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|3238290_3239145_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|3239180_3239990_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|3239993_3240386_-	SirB family protein	NA	NA	NA	NA	NA
WP_086629227.1|3240382_3241216_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|3241215_3242298_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 240
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3245434	3248186	4118807		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|3245434_3246382_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3246506_3248186_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 241
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3274855	3276543	4118807		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|3274855_3276124_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|3276123_3276543_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 242
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3285077	3287399	4118807		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|3285077_3287399_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 243
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3293266	3296995	4118807		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|3293266_3293998_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3294218_3294623_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|3294675_3294786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|3295318_3295642_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|3295744_3296995_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 244
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3300131	3301502	4118807		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|3300131_3301502_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 245
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3306622	3308600	4118807		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531601.1|3306622_3307759_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799401.1|3307742_3308600_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 246
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3311876	3315599	4118807		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|3311876_3312698_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|3312713_3313625_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251389.1|3313653_3314898_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|3314897_3315599_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 247
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3322888	3323146	4118807		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3322888_3323146_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 248
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3335477	3337120	4118807		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267941.1|3335477_3336482_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|3336478_3337120_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 249
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3340392	3341574	4118807		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|3340392_3340629_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|3340839_3341574_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 250
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3353932	3354874	4118807		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|3353932_3354874_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 251
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3370720	3370966	4118807		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3370720_3370966_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 252
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3375628	3376549	4118807		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3375628_3376549_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 253
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3385857	3386391	4118807		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|3385857_3386391_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 254
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3390525	3391359	4118807		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3390525_3391359_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 255
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3396410	3398972	4118807	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_087599250.1|3396410_3397572_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409849.1|3397613_3398972_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
>prophage 256
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3405791	3406580	4118807		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|3405791_3406580_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 257
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3421615	3423890	4118807		Enterobacteria_phage(100.0%)	3	NA	NA
WP_053264600.1|3421615_3422110_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_053264599.1|3422130_3423459_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	8.2e-234
WP_001273658.1|3423716_3423890_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 258
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3428195	3440451	4118807		Klosneuvirus(20.0%)	13	NA	NA
WP_000420617.1|3428195_3429116_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|3429115_3429421_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_053264598.1|3429513_3430113_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062089.1|3430109_3432656_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	3.4e-71
WP_001230242.1|3432655_3433828_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3433957_3434650_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|3434622_3435651_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_089586128.1|3435733_3438478_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	7.8e-37
WP_000818477.1|3438549_3439623_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3439671_3439845_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021292990.1|3439834_3440065_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|3440039_3440228_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066498.1|3440238_3440451_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 259
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3459716	3460376	4118807	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3459716_3460376_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 260
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3464609	3466664	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_053264594.1|3464609_3466664_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 261
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3479263	3481171	4118807		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|3479263_3481171_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 262
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3497092	3508225	4118807	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090508.1|3497092_3497860_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193844.1|3498066_3500679_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|3500944_3502147_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3502315_3503716_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3504317_3505406_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3505590_3506781_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|3507002_3507650_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3507676_3508225_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 263
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3522930	3527471	4118807		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|3522930_3524679_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|3524715_3526980_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3527186_3527471_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 264
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3532557	3533646	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|3532557_3533646_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 265
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3537744	3540959	4118807		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|3537744_3540027_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3540218_3540959_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 266
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3547269	3571071	4118807	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|3547269_3547887_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850313.1|3547897_3550342_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000886683.1|3550580_3551873_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067751.1|3551963_3553307_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_001295343.1|3553317_3553929_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_053289127.1|3554087_3558194_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3558328_3558823_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3559367_3560333_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_024243447.1|3560455_3562222_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3562222_3563944_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3563985_3564690_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3564974_3565193_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3565877_3568154_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3568184_3568505_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3568827_3569052_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|3569124_3571071_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
>prophage 267
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3580330	3582049	4118807		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|3580330_3582049_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 268
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3585636	3588374	4118807		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|3585636_3586467_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3586463_3586787_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3586912_3587428_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3587645_3588374_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 269
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3591711	3600861	4118807		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149703.1|3591711_3592839_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3592879_3593368_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3593427_3594273_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|3594269_3595223_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|3595232_3596366_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126053.1|3596460_3597573_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3597923_3598400_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3598487_3599390_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3599450_3600173_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3600156_3600444_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3600603_3600861_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 270
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3609427	3610630	4118807		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3609427_3610630_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 271
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3621971	3623843	4118807		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|3621971_3623843_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 272
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3627058	3631189	4118807		Synechococcus_phage(50.0%)	3	NA	NA
WP_000424890.1|3627058_3627721_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001295295.1|3627851_3628751_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|3628756_3631189_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 273
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3635081	3636674	4118807		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|3635081_3636674_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 274
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3641672	3646897	4118807		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|3641672_3642188_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3642240_3642306_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|3642540_3643428_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3643726_3644230_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3644633_3645380_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3645518_3646178_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3646174_3646897_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 275
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3650434	3665244	4118807		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|3650434_3650695_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430045.1|3650958_3653241_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|3653282_3653960_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146369.1|3654033_3654300_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3654564_3654825_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|3655052_3656138_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|3656278_3657241_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001307069.1|3657268_3659419_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_001145128.1|3659538_3660021_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|3660252_3661617_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001315358.1|3661845_3662517_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|3662519_3663515_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|3663507_3665244_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 276
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3675841	3676750	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3675841_3676750_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 277
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3683231	3684521	4118807		Klosneuvirus(100.0%)	1	NA	NA
WP_001542764.1|3683231_3684521_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 278
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3694783	3701358	4118807		Planktothrix_phage(33.33%)	7	NA	NA
WP_089586183.1|3694783_3695842_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	3.3e-20
WP_000604034.1|3695844_3696534_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101997.1|3696533_3697307_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|3697473_3697623_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|3697751_3698540_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096871.1|3698607_3700080_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	4.7e-12
WP_001265443.1|3700341_3701358_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 279
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3705715	3709235	4118807		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109199.1|3705715_3706768_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
WP_000784351.1|3707083_3707464_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|3707577_3708519_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|3708515_3709235_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 280
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3745273	3746065	4118807		Kaumoebavirus(100.0%)	1	NA	NA
WP_001542755.1|3745273_3746065_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 281
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3749443	3769569	4118807		Hokovirus(28.57%)	14	NA	NA
WP_001032690.1|3749443_3750925_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.4e-45
WP_032217027.1|3750966_3752385_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	4.0e-61
WP_001076004.1|3752381_3752891_-	YbgA family protein	NA	NA	NA	NA	NA
WP_021564973.1|3754405_3754975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174402749.1|3754971_3756405_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	1.5e-26
WP_000873944.1|3756522_3756849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174402750.1|3756848_3761042_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|3761284_3761491_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|3761803_3761893_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|3761892_3763566_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087967.1|3763588_3765637_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_001297248.1|3765645_3766218_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001331457.1|3766210_3768895_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_000186103.1|3768891_3769569_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 282
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3776224	3776989	4118807		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773296.1|3776224_3776989_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	5.8e-06
>prophage 283
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3781139	3784953	4118807	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|3781139_3782804_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|3783006_3784953_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 284
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3789579	3791244	4118807		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|3789579_3791244_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 285
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3795379	3796420	4118807		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|3795379_3796420_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 286
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3804316	3807849	4118807		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|3804316_3805042_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|3805159_3806095_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367857.1|3806178_3807849_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
>prophage 287
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3814787	3817370	4118807	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3814787_3817370_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 288
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3824380	3826820	4118807		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|3824380_3825469_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|3825608_3826820_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 289
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3831635	3832282	4118807		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|3831635_3832019_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3832072_3832282_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 290
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3847693	3849808	4118807		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|3847693_3848122_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|3848242_3849808_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 291
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3852917	3854740	4118807		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029824.1|3852917_3854138_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
WP_000502945.1|3854110_3854740_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 292
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3869366	3875409	4118807		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|3869366_3870182_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096744.1|3870178_3871312_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077711.1|3871527_3875409_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.4e-62
>prophage 293
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3886838	3889982	4118807		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|3886838_3889982_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 294
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3893127	3904678	4118807		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000770941.1|3893127_3893811_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253830.1|3893800_3895249_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103240.1|3895985_3897887_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-26
WP_001160804.1|3897914_3898376_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_137504052.1|3898395_3903249_+	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.3e-18
WP_000003345.1|3903245_3903635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122998029.1|3903664_3904678_+	AHH domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	35.9	1.0e-18
>prophage 295
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3922426	3925557	4118807	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|3922426_3923293_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3923294_3923507_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3923614_3924136_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3924171_3925557_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 296
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3936977	3938123	4118807		Streptococcus_phage(100.0%)	1	NA	NA
WP_001676376.1|3936977_3938123_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 297
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3944313	3946095	4118807		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_053264558.1|3944313_3946095_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	4.6e-38
>prophage 298
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3953002	3953689	4118807		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|3953002_3953689_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 299
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3956825	3957503	4118807		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3956825_3957503_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 300
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3962042	3965002	4118807		uncultured_virus(50.0%)	2	NA	NA
WP_089586107.1|3962042_3964547_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
WP_001377883.1|3964660_3965002_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	5.1e-39
>prophage 301
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3973246	3981808	4118807		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801846.1|3973246_3974206_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
WP_001250088.1|3974202_3975165_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|3975400_3976045_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|3976225_3978100_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|3978209_3978815_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3978814_3979144_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|3979196_3981128_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|3981256_3981808_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 302
NZ_AP023205	Escherichia coli strain TUM18781	4118807	3988816	3991966	4118807		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3988816_3991966_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 303
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4000801	4004348	4118807		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|4000801_4002583_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235598.1|4002575_4004348_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.8e-50
>prophage 304
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4007671	4008367	4118807		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|4007671_4008367_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 305
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4011495	4016542	4118807	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|4011495_4011768_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|4011976_4014331_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|4014518_4015793_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|4015918_4016542_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 306
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4040373	4049354	4118807	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|4040373_4040844_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|4040932_4042036_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|4042039_4042489_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|4042639_4043179_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|4043477_4044362_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|4044538_4044886_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|4045014_4045986_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|4045996_4047844_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|4047871_4048204_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|4048226_4049354_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 307
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4056306	4066278	4118807		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|4056306_4057602_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|4057659_4058349_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_089586108.1|4058538_4059741_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	3.1e-06
WP_000698921.1|4059737_4062881_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|4063006_4064191_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|4064333_4065242_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|4065366_4066278_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 308
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4070567	4071683	4118807		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|4070567_4071683_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 309
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4079098	4080256	4118807		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|4079098_4080256_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 310
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4087193	4087961	4118807		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939394.1|4087193_4087961_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 311
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4093255	4094365	4118807		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4093255_4094365_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 312
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4097443	4099404	4118807		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|4097443_4098457_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|4098453_4099404_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 313
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4104814	4109094	4118807		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805905.1|4104814_4105897_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.7	1.4e-191
WP_053286804.1|4106019_4109094_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.0	0.0e+00
>prophage 314
NZ_AP023205	Escherichia coli strain TUM18781	4118807	4113635	4114535	4118807		Lactobacillus_phage(100.0%)	1	NA	NA
WP_033560934.1|4113635_4114535_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16

>prophage 1
NZ_AP023208	Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence	70209	31856	69917	70209	protease,portal,integrase,tail,terminase,plate,holin,head,capsid	Shigella_phage(35.85%)	58	33167:33180	37391:37404
WP_000749881.1|31856_32912_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
33167:33180	attL	ATCATTTTTCCTAA	NA	NA	NA	NA
WP_001285288.1|33199_34303_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|34314_35568_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_123055303.1|35772_36936_-|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	99.7	3.5e-228
WP_000488409.1|37134_37413_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
37391:37404	attR	TTAGGAAAAATGAT	NA	NA	NA	NA
WP_000763385.1|37460_37679_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_021557045.1|37832_38897_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_000149533.1|38893_39052_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_000186829.1|39048_39729_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.6e-132
WP_000100847.1|39725_40511_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_097734380.1|40516_40813_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
WP_053286002.1|40888_41095_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	2.4e-28
WP_097734400.1|41576_41951_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	53.9	1.4e-13
WP_023307713.1|41989_42388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024181969.1|42463_43156_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.3e-110
WP_000184665.1|43266_43494_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182883.1|43524_44064_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_097734381.1|44060_45080_+	replication protein	NA	M1FN81	Enterobacteria_phage	66.7	1.8e-108
WP_087906126.1|45076_45778_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	2.1e-127
WP_087898272.1|45774_46068_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
WP_074468307.1|46173_46482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087898273.1|46640_46844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077757380.1|46929_47031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097734382.1|47027_47483_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.1e-60
WP_000224914.1|47482_47653_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	63.6	1.8e-13
WP_074526698.1|47645_47936_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	2.5e-47
WP_097734383.1|47932_48295_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	91.5	1.2e-57
WP_032324749.1|48291_48432_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	1.1e-08
WP_097734384.1|48428_49118_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	6.5e-57
WP_000136427.1|49339_50143_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.6	8.6e-69
WP_000544528.1|50371_50677_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_097734385.1|50663_51140_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.2	9.2e-87
WP_097734386.1|51123_51516_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.7	5.0e-54
WP_021530159.1|51870_52122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097734387.1|52161_52512_+	HNH endonuclease	NA	S5FKR6	Shigella_phage	91.4	2.0e-59
WP_000929175.1|52637_53132_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_072011717.1|53365_54862_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605604.1|54873_55056_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_001393070.1|55055_56297_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|56274_56925_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_072646345.1|56939_58145_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.8	7.7e-223
WP_000601365.1|58193_58394_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927711.1|58396_58720_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_032224590.1|58716_59127_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	8.8e-70
WP_000224832.1|59101_59608_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	97.0	6.8e-88
WP_001569335.1|59604_60165_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|60173_60344_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_097734388.1|60327_61824_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.4	9.5e-271
WP_001526906.1|61823_62180_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_000661054.1|62179_62449_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_097734389.1|62590_64426_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.7	1.1e-305
WP_001514801.1|64478_64856_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	38.6	3.9e-16
WP_000219915.1|64919_66248_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.1	2.5e-246
WP_000999520.1|66244_67324_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_001544766.1|67323_67872_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	1.1e-96
WP_000424732.1|67871_68297_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_097734391.1|68283_69342_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.8e-199
WP_000383548.1|69332_69917_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
