The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP023190	Escherichia coli strain TUM18530	4894739	1693530	1702975	4894739		Enterobacteria_phage(85.71%)	10	NA	NA
WP_174402623.1|1693530_1694457_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|1694461_1695193_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1695173_1695281_-	protein YohO	NA	NA	NA	NA	NA
WP_001240396.1|1695340_1696072_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	8.2e-111
WP_001295431.1|1696293_1697979_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1697975_1698695_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1698741_1699212_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1699252_1699714_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_170283454.1|1699838_1701842_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.9	0.0e+00
WP_001292772.1|1701838_1702975_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 2
NZ_AP023190	Escherichia coli strain TUM18530	4894739	2031098	2072496	4894739	transposase,integrase,tRNA	Escherichia_phage(45.45%)	47	2044960:2045019	2068851:2069468
WP_021556889.1|2031098_2031794_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|2031833_2032415_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|2032619_2034305_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_021556888.1|2034386_2035502_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287016.1|2035555_2036521_-	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_000067822.1|2036576_2037701_-	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001537023.1|2037732_2039343_-	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_021556887.1|2039593_2040679_-	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_001061578.1|2040781_2041705_+	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000457207.1|2041831_2042470_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000939317.1|2042642_2043002_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000513737.1|2043005_2043188_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000512153.1|2043335_2043584_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|2043642_2043717_-	protein YoaJ	NA	NA	NA	NA	NA
WP_001219350.1|2043719_2043818_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001383245.1|2043850_2044876_-	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
2044960:2045019	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000412211.1|2045950_2046610_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|2046810_2047188_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174402636.1|2047254_2050221_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|2050223_2050784_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2050909_2051260_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|2051462_2052476_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|2052620_2053118_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|2053229_2053520_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|2053525_2054317_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|2054480_2054828_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2054821_2055661_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|2055788_2055992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|2056147_2057353_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|2057363_2057669_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|2057895_2058660_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|2059152_2059737_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|2059736_2060975_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|2060971_2061877_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|2061998_2062703_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|2064092_2064761_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|2064796_2065033_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_174402637.1|2065029_2065392_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2065409_2067104_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|2067155_2067578_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|2067613_2067889_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2067902_2068253_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2068324_2068759_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|2069772_2070477_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2068851:2069468	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
WP_052463150.1|2070513_2070753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557454.1|2070765_2071626_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|2071791_2072496_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_AP023190	Escherichia coli strain TUM18530	4894739	2988054	3083770	4894739	protease,integrase,transposase,terminase,tRNA,capsid,head	Pseudomonas_phage(12.5%)	75	2987452:2987466	3084267:3084280
2987452:2987466	attL	TATTTCAGGCGGTCC	NA	NA	NA	NA
WP_000886683.1|2988054_2989347_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
2987452:2987466	attL	TATTTCAGGCGGTCC	NA	NA	NA	NA
WP_021556648.1|2989437_2990781_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.8e-80
WP_001295343.1|2990791_2991403_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_021556647.1|2991557_2995664_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2995798_2996293_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2996837_2997803_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_021556646.1|2997925_2999692_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_021556645.1|2999692_3001414_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	6.4e-21
WP_001241678.1|3001455_3002160_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3002444_3002663_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_072643849.1|3003153_3003996_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_072643848.1|3004080_3004278_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_039022338.1|3004289_3004778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854808.1|3004774_3005152_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_104213682.1|3005240_3005609_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_174402654.1|3005658_3006303_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.3	1.0e-27
WP_113847077.1|3006321_3006543_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	1.2e-09
WP_001186771.1|3006611_3007088_-	RadC family protein	NA	NA	NA	NA	NA
WP_174402655.1|3007103_3007589_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_048943269.1|3007679_3008498_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	3.0e-45
WP_000789536.1|3008908_3009322_-	hypothetical protein	NA	A0A1B2IAE4	Erwinia_phage	42.0	5.8e-21
WP_001104026.1|3009591_3010131_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_000771527.1|3010256_3010715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102620.1|3010843_3011914_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048943270.1|3011910_3012816_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_048943271.1|3012812_3015209_-	dynamin family protein	NA	NA	NA	NA	NA
WP_021527212.1|3015426_3016299_-	GTPase family protein	NA	NA	NA	NA	NA
WP_174402656.1|3016562_3018119_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	8.4e-105
WP_048943273.1|3018115_3019351_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_029396238.1|3019472_3022589_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_042631068.1|3022736_3023717_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_029364370.1|3023836_3024217_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
WP_000612591.1|3024213_3024561_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072643824.1|3024610_3026149_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	2.2e-283
WP_029396387.1|3026586_3027321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001287791.1|3028516_3028708_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124181.1|3028760_3028994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260380.1|3029089_3029713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029396382.1|3029973_3030369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002461143.1|3030665_3031439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001334840.1|3033878_3034343_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	49.0	3.3e-33
WP_103246109.1|3034335_3034683_+	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	52.2	5.8e-22
WP_000255946.1|3034869_3035892_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001297096.1|3035891_3036671_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_077249079.1|3037366_3038818_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000995974.1|3038810_3040853_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_063084449.1|3041039_3046775_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_063084450.1|3047534_3049043_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
WP_001373172.1|3050205_3051357_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
WP_063082219.1|3052821_3054180_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_104213618.1|3056373_3056760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|3056768_3056960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174402657.1|3057037_3059977_+	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.5	7.1e-12
WP_023285886.1|3059973_3061398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174402658.1|3061584_3062553_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	9.4e-179
WP_000282094.1|3063219_3063783_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072643827.1|3064993_3066817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072643828.1|3066917_3067166_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065304405.1|3067181_3068747_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_072643829.1|3068970_3070179_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	2.9e-44
WP_000934041.1|3070757_3073034_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
3070327:3070341	attR	TATTTCAGGCGGTCC	NA	NA	NA	NA
WP_000520781.1|3073064_3073385_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
3070327:3070341	attR	TATTTCAGGCGGTCC	NA	NA	NA	NA
WP_001710151.1|3074171_3074456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548686.1|3074713_3075256_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_001179421.1|3075457_3075841_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190777.1|3075852_3076194_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228102.1|3076203_3077244_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.6	7.5e-65
WP_000126656.1|3077461_3077884_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_063112633.1|3077880_3078126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063112632.1|3078412_3080230_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.1	2.2e-128
WP_001710148.1|3080226_3080526_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113144.1|3080532_3080853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001710147.1|3080845_3081892_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001206975.1|3081902_3082112_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_063112630.1|3082531_3083770_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	6.9e-126
3084267:3084280	attR	TTCCACCATTCAGA	NA	NA	NA	NA
>prophage 4
NZ_AP023190	Escherichia coli strain TUM18530	4894739	3686505	3791034	4894739	holin,integrase,lysis,tail,portal,terminase,capsid,head	Escherichia_phage(30.0%)	102	3741246:3741301	3787123:3787178
WP_000131044.1|3686505_3688539_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|3688667_3689255_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_021556526.1|3689268_3690741_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021556525.1|3690754_3692443_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.8e-61
WP_174402671.1|3693120_3693255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001362381.1|3693498_3694062_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_001362383.1|3694392_3695187_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213049.1|3695340_3696102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089078564.1|3697247_3698441_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_021556522.1|3698624_3699293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021556521.1|3699535_3700231_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023918.1|3700223_3701651_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|3701661_3702381_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_021556520.1|3702909_3703764_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_021556519.1|3703989_3705315_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	3.6e-112
WP_000474077.1|3705423_3705660_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3705671_3706265_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_021556518.1|3706424_3707294_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621020.1|3707541_3708393_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021556517.1|3708513_3712767_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174462.1|3713332_3714184_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.4e-47
WP_001172290.1|3714210_3715200_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910719.1|3715231_3716125_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021556516.1|3716325_3717252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|3717408_3718329_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021556515.1|3718563_3719706_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662258.1|3720179_3720281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3720644_3720908_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3720907_3721048_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|3721117_3721309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|3722132_3722675_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730968.1|3722749_3723337_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_174402672.1|3723394_3724063_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131058.1|3724088_3726614_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_021556514.1|3726603_3728247_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_021556513.1|3728215_3728926_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001307600.1|3729238_3729568_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019915.1|3729814_3730429_-	YagU family protein	NA	NA	NA	NA	NA
WP_120314245.1|3730475_3730724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021556512.1|3730846_3731536_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001624636.1|3731532_3732489_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_040234559.1|3732485_3734684_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
WP_021556510.1|3734693_3735650_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001612427.1|3735827_3736955_-	MFS transporter	NA	NA	NA	NA	NA
WP_021556509.1|3737096_3738155_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001119037.1|3738419_3739304_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024227134.1|3740006_3740285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021556507.1|3740721_3741129_+	transcriptional regulator	NA	NA	NA	NA	NA
3741246:3741301	attL	TTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_052978476.1|3741684_3746139_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	4.8e-44
WP_064226540.1|3746676_3747261_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	1.4e-105
WP_071785654.1|3747260_3750659_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001460792.1|3750723_3751323_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	3.7e-109
WP_174402673.1|3751393_3754891_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
WP_000090891.1|3754951_3755584_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|3755520_3756264_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152624.1|3756269_3756968_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847331.1|3756967_3757297_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_069903526.1|3757293_3759855_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000459457.1|3759847_3760282_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|3760263_3760686_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001317730.1|3760701_3761442_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000683117.1|3761449_3761845_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
WP_001398561.1|3761841_3762420_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000752960.1|3762431_3762785_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_023566743.1|3762796_3763192_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	7.4e-58
WP_000063238.1|3763233_3764259_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001295978.1|3764314_3764647_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_089625925.1|3764656_3765976_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	99.1	7.4e-235
WP_001345555.1|3765956_3767558_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|3767554_3767761_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027289.1|3767757_3769683_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|3769657_3770203_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001663509.1|3770591_3770825_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079507.1|3770882_3771293_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	2.8e-52
WP_001283920.1|3771881_3772145_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	98.6	1.1e-33
WP_000839225.1|3772141_3772639_-	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_174402674.1|3772840_3773302_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	90.8	2.0e-70
WP_001075798.1|3773298_3773913_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.0	1.4e-111
WP_000422366.1|3773912_3774194_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|3774180_3774567_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000220228.1|3774657_3775254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609696.1|3775360_3775939_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	1.6e-45
WP_001471961.1|3775953_3776943_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_001061444.1|3776950_3777760_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|3777779_3778169_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210171.1|3778165_3778492_-	LexA family transcriptional regulator	NA	Q8SBE8	Shigella_phage	99.1	9.2e-54
WP_001373735.1|3778488_3779142_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	4.7e-126
WP_074513063.1|3779141_3779636_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_000104943.1|3779632_3780574_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|3780563_3780743_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_024017504.1|3780918_3781476_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	3.7e-95
WP_000649477.1|3781519_3781720_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|3781810_3782485_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000135680.1|3783153_3783516_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081297.1|3783581_3784406_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000008202.1|3784533_3785070_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|3785060_3785423_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3785422_3785728_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_000051893.1|3785954_3787118_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893267.1|3787322_3788576_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3787123:3787178	attR	TTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3788587_3789691_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3789978_3791034_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 1
NZ_AP023191	Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence	272842	60534	162615	272842	integrase,transposase,protease	Escherichia_phage(40.0%)	104	55181:55194	65978:65991
55181:55194	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_174402695.1|60534_61710_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|61880_62093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255946.1|63022_64045_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001297096.1|64044_64824_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001284313.1|65661_67161_-	kinase	NA	NA	NA	NA	NA
65978:65991	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|67186_68824_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|68823_69864_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|69949_70588_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|70587_71229_-	TerD family protein	NA	NA	NA	NA	NA
WP_024179285.1|71251_71890_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|72352_72820_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|72837_74046_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|74056_75013_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|75012_76092_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|76093_76867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|76859_78002_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|78011_79070_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254136.1|79393_79975_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|79974_81132_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007448.1|81154_81610_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|81632_82673_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|82721_83300_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|83367_83943_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|84371_85613_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000077926.1|86175_86457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|86506_86698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|86789_87131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|87503_87896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|88499_88793_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|88797_90123_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|90183_90390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|90491_90902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|90914_91730_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|91983_92409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|92957_93266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|93281_94139_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194555.1|94200_94404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|95092_95797_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018321.1|95972_96788_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_001067855.1|97081_97786_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_065311128.1|98826_99336_+	peptidase M14	NA	NA	NA	NA	NA
WP_065311127.1|99441_101343_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000347021.1|101729_101909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202492.1|103599_103941_+	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
WP_000105383.1|104974_106411_+	glutathione synthase	NA	NA	NA	NA	NA
WP_021546935.1|106828_107833_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|108099_108804_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|108809_108950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|109435_110173_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|110169_110394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|110604_112098_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_112934501.1|112128_113013_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_065311137.1|113229_114444_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001255015.1|114471_114777_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110459201.1|115043_115361_-	tetracycline resistance protein	NA	NA	NA	NA	NA
WP_001067858.1|115385_116090_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000480968.1|116495_117332_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|117637_117880_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|117921_118572_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|118677_119877_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|119908_120793_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|120930_121338_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_031613424.1|123187_123538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|123914_124232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|124282_124690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|124719_125181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|125517_125748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|126409_126643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|126864_127761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|127763_128279_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|128493_129921_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|129981_130149_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078514.1|130171_131491_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|131770_132976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|132972_133791_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|134433_134814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|134871_135537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|136499_137291_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|137759_138005_-	GrpB family protein	NA	NA	NA	NA	NA
WP_000612791.1|138042_138906_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|139051_139291_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067855.1|139363_140068_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000939727.1|140220_141042_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_032491824.1|141173_141965_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_001067855.1|142963_143668_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|143704_144832_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|144882_145110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|145133_145325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|145806_146349_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|146361_147222_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|147538_148243_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|148378_149239_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|149408_150164_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067855.1|150289_150994_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|151003_151474_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|151493_152282_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|152281_152800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|152804_153221_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|153606_154311_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032623598.1|155512_157243_+	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_174402696.1|157307_158165_+	LAP family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	60.7	5.9e-92
WP_001067858.1|159356_160061_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|160231_160789_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|161352_162615_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 2
NZ_AP023191	Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence	272842	261004	269282	272842	transposase	Salmonella_phage(57.14%)	8	NA	NA
WP_000654806.1|261004_261973_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	4.4e-176
WP_001000406.1|262289_263825_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_000609174.1|263874_264222_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|264218_264602_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000070863.1|264824_265001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096324.1|264997_266689_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	2.6e-67
WP_000114859.1|266936_268100_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_001121575.1|268469_269282_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
>prophage 1
NZ_AP023192	Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence	115543	1262	61285	115543	transposase,bacteriocin,tRNA,integrase,protease	Escherichia_phage(27.27%)	56	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|2685_3588_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001298859.1|7652_9194_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|9208_9955_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_174402698.1|10008_10170_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|10353_11566_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_001259759.1|12747_12951_-|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014640552.1|12928_13165_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|13628_13910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|14267_14795_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|15038_15854_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|15903_16257_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|16434_17226_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|17222_17912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|17955_18306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952217.1|18850_19939_+	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000698737.1|19940_22166_+	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000963206.1|22215_23115_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000111771.1|23104_23395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|23690_23921_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|23917_24334_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350638.1|24495_26634_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|26987_27245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|27244_27835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000521603.1|29845_30463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089727.1|30755_31835_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|31939_32263_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|32796_33501_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|35138_35381_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039045916.1|35412_36048_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|36153_37353_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|37384_38269_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|38406_38814_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|40433_41138_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015387340.1|41742_42618_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|42664_42997_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|45318_46023_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|47333_47735_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|47667_47925_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|48017_48671_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001333237.1|48768_48909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774297.1|49609_50467_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001273588.1|50459_50942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|50934_51009_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|51240_51498_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001351576.1|51781_51988_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299730.1|52611_52824_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139315.1|52959_53520_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704513.1|53622_54483_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205749.1|54541_55288_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000986962.1|55307_60578_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|60659_60887_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911313.1|60886_61285_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 1
NZ_AP023193	Escherichia coli strain TUM18530 plasmid pMTY18530-3_incFll, complete sequence	112963	0	112220	112963	portal,tRNA,integrase,terminase,transposase,tail	Salmonella_phage(87.25%)	120	12853:12870	28543:28560
WP_072651234.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	1.6e-171
WP_001229345.1|1545_1758_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|1757_2093_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001755515.1|2308_2584_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
WP_000125192.1|2639_3065_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_000715581.1|3156_3987_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_021520138.1|3990_4191_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_001051807.1|4283_6623_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_174402701.1|6625_6892_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.3e-31
WP_072647773.1|6891_7836_-	exonuclease	NA	J9Q7S6	Salmonella_phage	86.9	3.1e-158
WP_072647774.1|7896_8925_-	regulator	NA	J9Q7Z3	Salmonella_phage	86.0	9.7e-142
WP_000627054.1|9042_9474_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_072647775.1|9599_13118_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.3	0.0e+00
12853:12870	attL	AATGATTCCATACATCTC	NA	NA	NA	NA
WP_072647776.1|13298_14534_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	80.8	2.4e-195
WP_072647777.1|14629_16738_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.7	7.4e-229
WP_001098353.1|16836_17049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|17300_17687_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021520132.1|17681_18785_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.9	8.5e-27
WP_021520131.1|19050_19566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072647779.1|19580_21977_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_024189750.1|21954_22623_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_112026172.1|22675_23317_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_112026171.1|23428_23716_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_159194943.1|24813_25059_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	43.6	4.5e-13
WP_001718056.1|25233_26496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067985.1|28119_28410_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_000636536.1|28555_28771_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
28543:28560	attR	GAGATGTATGGAATCATT	NA	NA	NA	NA
WP_023145134.1|28767_30090_-	ATP-dependent DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	1.8e-241
WP_164717859.1|30086_30569_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	70.6	1.1e-50
WP_021520122.1|30624_31407_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	3.4e-54
WP_021520121.1|31482_32598_-	hypothetical protein	NA	J9Q720	Salmonella_phage	94.1	6.9e-210
WP_000137333.1|32745_34086_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_021520120.1|34129_34870_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	8.3e-127
WP_021520119.1|35050_35473_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	39.0	1.2e-18
WP_021520118.1|35465_36218_-	hypothetical protein	NA	J9Q719	Salmonella_phage	36.5	3.9e-07
WP_160378290.1|36269_36623_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|36628_37297_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_159194942.1|37473_38226_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	30.6	1.3e-15
WP_000931257.1|38210_38594_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_000901561.1|38966_39218_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_000856758.1|39219_39912_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_000064175.1|39925_40249_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_049592659.1|40452_43128_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	50.0	3.2e-67
WP_024269791.1|43264_43948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097733807.1|44583_49311_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
WP_001293195.1|49328_49922_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_000526939.1|49909_50707_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_000511445.1|50699_51398_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|51480_51816_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_159194946.1|51858_56406_-	tape measure protein	NA	J9Q712	Salmonella_phage	68.7	0.0e+00
WP_000952686.1|56413_56638_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_159194945.1|56763_57081_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	4.3e-48
WP_000072377.1|57136_57883_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
WP_021512326.1|57957_58341_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	2.3e-56
WP_000523628.1|58342_58816_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|58806_59151_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057118.1|59230_60064_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_000801187.1|60063_60498_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_001308872.1|60542_61463_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.6	1.4e-131
WP_001130339.1|61536_62412_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_001055285.1|62437_63325_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
WP_000422362.1|63346_64921_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	6.4e-286
WP_001007299.1|64947_66204_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_021520109.1|66203_66836_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	2.4e-90
WP_000176292.1|67032_67299_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|67308_68199_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_001717191.1|68195_68861_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_072651720.1|68857_69526_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.2	9.5e-106
WP_063091540.1|69525_70206_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_072651721.1|70288_71848_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.1	2.4e-277
WP_001291061.1|71850_72129_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_001308871.1|72161_72761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072651722.1|72905_73481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072651723.1|73509_73863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072651724.1|73975_74776_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	32.5	9.3e-07
WP_072651725.1|74878_75397_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	68.2	7.2e-53
WP_159194944.1|75693_76344_+	hypothetical protein	NA	J9Q754	Salmonella_phage	86.1	5.3e-101
WP_000470243.1|76391_76622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|77237_77720_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_021512333.1|78070_78445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717183.1|78562_78958_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.6e-31
WP_000749407.1|79084_79396_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_021533329.1|79549_79879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512335.1|81362_81548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890917.1|81584_81806_-	hypothetical protein	NA	J9Q750	Salmonella_phage	56.7	3.2e-18
WP_001067855.1|81879_82584_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072651261.1|82705_82948_-	DUF1380 family protein	NA	J9Q7H8	Salmonella_phage	78.4	1.5e-29
WP_072647770.1|83107_85141_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.2	1.7e-44
WP_174402702.1|85298_86399_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_089619671.1|86436_86826_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	91.5	6.2e-65
WP_089619672.1|87624_88257_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	71.1	3.6e-06
WP_174402703.1|88253_88637_-	hypothetical protein	NA	A0A088FQU9	Escherichia_phage	67.5	6.2e-09
WP_089619673.1|88633_88855_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	52.1	9.4e-10
WP_089619674.1|88847_89519_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	43.1	1.0e-46
WP_089619675.1|90022_91708_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.0	0.0e+00
WP_000467662.1|91811_92426_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
WP_021533177.1|92428_92710_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
WP_001718087.1|92765_93335_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_014962273.1|93474_93633_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_174402704.1|93632_94058_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.0	3.6e-58
WP_021533180.1|94151_94349_-	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
WP_032203382.1|94358_94853_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	54.5	5.7e-23
WP_165403129.1|95001_95646_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.3	1.1e-98
WP_032203380.1|96176_96407_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_000559568.1|96592_97186_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_053902537.1|97369_98179_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	1.3e-64
WP_016607532.1|98337_98895_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_053271994.1|98904_99324_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	1.2e-50
WP_000386469.1|99385_100030_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_000781810.1|100029_100506_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
WP_000289389.1|100502_100904_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.2	5.1e-62
WP_072652674.1|100917_102021_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.7	1.3e-192
WP_001011861.1|102192_103062_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_112026176.1|103139_104282_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.4	4.5e-196
WP_000623683.1|104388_106704_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|106777_107347_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_000008655.1|107356_108100_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
WP_021520140.1|108089_110006_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.0	4.9e-248
WP_000174803.1|110235_111321_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|111575_112220_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
