The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	14944	76633	5585577	transposase,tRNA	Streptococcus_phage(26.67%)	53	NA	NA
WP_062804561.1|14944_16381_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001056973.1|16647_18078_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086403163.1|18362_18773_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|18921_20352_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086412479.1|20706_24393_-	pesticidal protein	NA	NA	NA	NA	NA
WP_002175883.1|25430_25589_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000116992.1|26411_27842_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086403163.1|27990_28401_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_001056973.1|28719_30150_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086403163.1|30434_30845_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|30993_32424_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001056973.1|32655_34086_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_062804561.1|34317_35754_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000264088.1|36365_37829_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.1	2.2e-94
WP_124749816.1|37942_39250_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	27.8	5.4e-20
WP_000186165.1|39410_40298_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000238785.1|40316_40907_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000884187.1|41234_42509_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.7	6.9e-97
WP_140159387.1|42922_43315_+	DUF3797 domain-containing protein	NA	NA	NA	NA	NA
WP_001053585.1|43350_44019_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.6	2.8e-25
WP_086412204.1|44021_44657_-	deoxynucleoside kinase	NA	A0MSS7	Spodoptera_exigua_ascovirus	25.6	4.3e-07
WP_006917832.1|44782_45322_-	cysteine hydrolase	NA	A0A1V0SEH9	Indivirus	29.5	3.4e-05
WP_000434329.1|45431_45932_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_000121587.1|46408_48097_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	30.3	2.4e-44
WP_014894853.1|48122_48449_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000559169.1|48463_49060_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000466019.1|49074_49296_+	YaaL family protein	NA	NA	NA	NA	NA
WP_001089276.1|49457_49727_+	pro-sigmaK processing inhibitor BofA family protein	NA	NA	NA	NA	NA
WP_000175076.1|55144_55324_+	sigma factor G inhibitor Gin	NA	NA	NA	NA	NA
WP_006920522.1|55395_56817_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000677218.1|56818_57445_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	49.0	1.2e-54
WP_000169561.1|57480_58464_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	31.8	1.8e-31
WP_000272429.1|58469_59297_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_000412063.1|59311_59662_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_153579212.1|59744_59909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411350.1|60023_61253_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000414350.1|62204_62495_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000267821.1|62463_63339_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.1	3.7e-65
WP_000843036.1|63359_63644_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.1	3.9e-16
WP_071732546.1|64102_66112_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.0	3.2e-96
WP_086411679.1|66278_67046_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_000692836.1|67260_67818_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_000651548.1|67814_68693_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_086411680.1|68803_69667_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_000044347.1|69893_70154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000070633.1|70266_70425_+	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_000772104.1|70621_71491_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_000702466.1|71545_72394_+	pur operon repressor	NA	NA	NA	NA	NA
WP_000869815.1|72514_72889_+	RidA family protein	NA	NA	NA	NA	NA
WP_000454041.1|73041_73335_+	septation regulator SpoVG	NA	NA	NA	NA	NA
WP_000071041.1|73648_75028_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A167R6F2	Powai_lake_megavirus	30.7	9.4e-23
WP_000107420.1|75046_76000_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.2	6.0e-45
WP_001254073.1|76009_76633_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	209324	267175	5585577	protease,transposase	Streptococcus_phage(36.36%)	55	NA	NA
WP_086411350.1|209324_210554_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086411612.1|210924_212541_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001221551.1|212565_213033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544200.1|213206_214106_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000922547.1|214124_214316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156944.1|214312_214591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000731086.1|214635_216276_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086411613.1|216681_218322_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086411614.1|218711_219545_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.9	3.2e-74
WP_025710364.1|219546_220350_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.3	3.1e-18
WP_086411615.1|220636_221488_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_000020526.1|221788_222463_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006919711.1|222468_223275_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062804561.1|223545_224982_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_006919713.1|225107_226028_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_001060017.1|226245_226347_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000423031.1|226601_227468_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002180311.1|227595_228564_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000894065.1|228585_228726_+	YrzO family protein	NA	NA	NA	NA	NA
WP_081631312.1|228786_228879_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000277778.1|229216_229822_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001059999.1|229894_229990_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_001273903.1|230295_231273_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_086412138.1|231434_231764_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_000248045.1|231882_232719_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.1	4.8e-46
WP_000728422.1|232857_233214_+	YxeA family protein	NA	NA	NA	NA	NA
WP_086412139.1|233949_234714_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_086412140.1|234830_236480_-	DUF2334 domain-containing protein	NA	NA	NA	NA	NA
WP_000713249.1|236719_237253_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_006919727.1|237264_238059_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_002023099.1|238194_238323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411350.1|238688_239918_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086411797.1|240735_242616_+	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	8.2e-46
WP_000369248.1|242959_243157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730656.1|243524_245252_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001053955.1|246080_247517_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_087874946.1|248141_249300_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_086411323.1|250212_251193_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	7.1e-17
WP_086411324.1|251189_252155_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-19
WP_000766421.1|252188_253061_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000664237.1|253502_253610_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|253644_253761_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000664237.1|253805_253913_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_103597548.1|253956_254064_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_001083690.1|254107_254218_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_086411326.1|254611_255730_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_000674004.1|255796_256753_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013141710.1|256718_257891_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_086411327.1|258122_259538_+	amino acid permease	NA	NA	NA	NA	NA
WP_000799716.1|259645_260917_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	25.3	6.6e-15
WP_086411328.1|261145_262231_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000595957.1|262293_263670_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_000206584.1|263975_265553_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
WP_000961166.1|265647_266610_+	UV DNA damage repair endonuclease UvsE	NA	NA	NA	NA	NA
WP_000908523.1|266602_267175_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	289402	297349	5585577		uncultured_virus(33.33%)	6	NA	NA
WP_086412306.1|289402_289687_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	4.4e-20
WP_001029993.1|289725_291360_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_162837404.1|291763_293305_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
WP_000833096.1|293688_295014_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929885.1|295158_295860_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_086412305.1|295843_297349_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	9.2e-32
>prophage 4
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	346784	355160	5585577		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|346784_348092_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|348180_348900_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|348892_349147_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666786.1|349143_349827_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_086412625.1|349810_352030_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	6.7e-164
WP_000879025.1|352014_353430_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|353535_354576_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|354572_355160_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 5
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	395691	409888	5585577	integrase,transposase	Bacillus_phage(84.21%)	24	392624:392640	407839:407855
392624:392640	attL	TTTTTTTATTAAATAAA	NA	NA	NA	NA
WP_086412636.1|395691_396816_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.7	6.8e-213
WP_174402529.1|396990_397149_+	hypothetical protein	NA	A0A1B0T6B0	Bacillus_phage	90.4	1.1e-15
WP_086412642.1|397437_398298_-	ribonuclease	NA	NA	NA	NA	NA
WP_000645346.1|398637_398991_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	45.5	7.7e-22
WP_086412643.1|399507_400635_+	hypothetical protein	NA	H0UST6	Bacillus_phage	52.4	2.4e-109
WP_174402530.1|400637_400781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003276353.1|400926_401109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020466.1|401119_401467_-	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	39.4	1.3e-10
WP_086412637.1|401863_402589_+	ORF6C domain-containing protein	NA	A0A1B1P7T7	Bacillus_phage	80.7	2.4e-110
WP_000798609.1|402632_402980_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	87.1	1.2e-51
WP_086412638.1|402976_403144_+	hypothetical protein	NA	A0A1B0T6C1	Bacillus_phage	73.6	8.6e-16
WP_001241128.1|403173_403350_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	93.1	2.4e-24
WP_086412639.1|403356_404244_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	43.6	1.4e-43
WP_086412640.1|404182_405058_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	46.8	2.2e-65
WP_000337977.1|405073_405268_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	82.8	2.6e-24
WP_086412641.1|405293_405467_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	1.1e-24
WP_086391644.1|405481_405736_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	92.9	2.9e-39
WP_153579236.1|405747_406167_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	44.2	1.3e-15
WP_103597377.1|406182_406638_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.4e-20
WP_086412310.1|406679_406943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412311.1|406978_407221_+	hypothetical protein	NA	A0A1B1P7A3	Bacillus_phage	59.0	1.4e-22
WP_016125860.1|407224_407374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412312.1|407404_407830_+	hypothetical protein	NA	A0A0D3MWL3	Staphylococcus_phage	34.1	1.2e-08
WP_086411350.1|408658_409888_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
407839:407855	attR	TTTATTTAATAAAAAAA	NA	NA	NA	NA
>prophage 6
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	964049	967038	5585577	integrase	Bacillus_phage(100.0%)	6	963983:964002	967894:967913
963983:964002	attL	AATCGTTCGTTCTATAAACC	NA	NA	NA	NA
WP_000135924.1|964049_965207_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	89.9	1.3e-203
WP_000253874.1|965276_965702_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	98.6	3.8e-76
WP_000102963.1|965717_966140_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	75.0	2.2e-52
WP_086412385.1|966410_966593_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	86.7	8.8e-22
WP_000127561.1|966595_966868_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	98.9	2.0e-46
WP_174402534.1|966882_967038_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	82.0	2.7e-16
967894:967913	attR	AATCGTTCGTTCTATAAACC	NA	NA	NA	NA
>prophage 7
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	1367453	1412444	5585577	protease,transposase,integrase	Bacillus_phage(35.71%)	44	1363468:1363488	1387727:1387747
1363468:1363488	attL	AAGTGAAACTTTAATCAGTGG	NA	NA	NA	NA
WP_000275580.1|1367453_1368749_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|1368738_1369491_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001053357.1|1370229_1370427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000794498.1|1370577_1371675_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_000735227.1|1371789_1372308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006915513.1|1372467_1373676_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000600589.1|1373693_1374206_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000883009.1|1374376_1374604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087874946.1|1374705_1375864_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000455762.1|1376187_1376988_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000380273.1|1377105_1378104_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000231449.1|1378115_1378736_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_006915465.1|1379047_1381090_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_006915455.1|1381169_1381598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002023636.1|1381815_1382094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937247.1|1382317_1383589_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	23.5	1.0e-15
WP_016122170.1|1383728_1384574_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_001094860.1|1384788_1384983_-	DUF3924 domain-containing protein	NA	NA	NA	NA	NA
WP_000806236.1|1385104_1385635_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	39.4	1.1e-24
WP_000797516.1|1385742_1387557_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.7	1.7e-32
WP_000110707.1|1387865_1388573_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
1387727:1387747	attR	CCACTGATTAAAGTTTCACTT	NA	NA	NA	NA
WP_016122171.1|1388750_1389539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000010845.1|1389543_1392123_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_086389308.1|1392307_1392697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067557.1|1392719_1393211_+	YpuI family protein	NA	NA	NA	NA	NA
WP_001075741.1|1393316_1394231_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	40.6	2.2e-36
WP_025709309.1|1394343_1395468_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	24.3	6.9e-08
WP_000247811.1|1395460_1396057_+	spore maturation protein SbmA	NA	NA	NA	NA	NA
WP_000029514.1|1396053_1396584_+	spore maturation protein SpmB	NA	NA	NA	NA	NA
WP_086411290.1|1396873_1397602_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000742192.1|1397708_1398230_+	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
WP_000910522.1|1398351_1399977_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_000250083.1|1399991_1401149_+	cytochrome c biogenesis protein ResC	NA	NA	NA	NA	NA
WP_000426861.1|1401452_1402169_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	41.7	1.2e-42
WP_000964673.1|1402168_1403944_+	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	36.0	2.1e-35
WP_086411291.1|1404080_1404677_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_087874946.1|1404695_1405855_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000866119.1|1406036_1406651_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	41.7	5.8e-17
WP_000710837.1|1406815_1407502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000810855.1|1408053_1408632_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151993.1|1408753_1409002_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	1.2e-16
WP_086411733.1|1409300_1410362_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086411734.1|1410351_1411881_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	37.0	2.3e-54
WP_001025780.1|1411880_1412444_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	1432330	1439698	5585577	transposase	Bacillus_phage(16.67%)	8	NA	NA
WP_001043860.1|1432330_1432603_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	77.8	1.0e-29
WP_001151482.1|1432723_1433293_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.3	2.4e-49
WP_000332854.1|1433476_1434211_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_086411739.1|1434249_1434963_+	2-heptaprenyl-1,4-naphthoquinone methyltransferase	NA	NA	NA	NA	NA
WP_086411740.1|1434994_1435957_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-07
WP_086411741.1|1436081_1436528_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	9.1e-28
WP_086411350.1|1436925_1438155_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_001269384.1|1438525_1439698_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.9	2.5e-45
>prophage 9
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	1701768	1768565	5585577	transposase	Streptococcus_phage(28.57%)	57	NA	NA
WP_086411350.1|1701768_1702998_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000762273.1|1703549_1704467_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	54.9	1.7e-89
WP_061113559.1|1704545_1705058_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086388606.1|1705150_1705978_+	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_000505545.1|1706001_1706577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088187.1|1707342_1708680_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_086411623.1|1708719_1709424_-	polysaccharide deacetylase family protein	NA	A0A2I2L4G0	Orpheovirus	26.2	2.7e-10
WP_000878325.1|1709750_1710014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015543.1|1710174_1710861_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000387074.1|1710971_1711613_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_000385092.1|1711755_1712643_+	chromosome condensation regulator	NA	NA	NA	NA	NA
WP_000919314.1|1712868_1713069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291883.1|1713232_1713769_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000911822.1|1713859_1714618_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000528161.1|1715523_1716423_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_140159349.1|1716445_1718161_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.7	6.7e-71
WP_000019916.1|1718157_1718388_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_086411625.1|1718402_1719410_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_086411626.1|1719456_1721130_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_046392610.1|1721161_1722424_+	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_086411627.1|1722644_1723748_-	CapA family protein	NA	NA	NA	NA	NA
WP_000236032.1|1723951_1724668_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_103597463.1|1724686_1725547_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000179302.1|1725714_1726929_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_006918225.1|1726982_1727744_-	dioxygenase	NA	NA	NA	NA	NA
WP_001102583.1|1727955_1728879_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000390211.1|1729173_1729818_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086411628.1|1729945_1731460_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_000701909.1|1731697_1732141_+	GNAT family N-acetyltransferase	NA	A0A0P0YNR7	Yellowstone_lake_phycodnavirus	32.0	3.3e-06
WP_000342902.1|1732168_1732528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411629.1|1732622_1733894_+	bifunctional S-methyl-5'-thioadenosine deaminase/S-adenosylhomocysteine deaminase	NA	NA	NA	NA	NA
WP_140159348.1|1734047_1735676_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000484225.1|1735727_1736258_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000414517.1|1736402_1737101_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	7.0e-35
WP_164876547.1|1737066_1738167_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.2	3.6e-25
WP_000265538.1|1738238_1739099_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_001030679.1|1739158_1740454_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_086411630.1|1740932_1741892_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_086411631.1|1742091_1743567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001221912.1|1743742_1744687_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_000254900.1|1745250_1747077_+	APC family permease	NA	NA	NA	NA	NA
WP_061884005.1|1747670_1748831_+	non-hemolytic enterotoxin NHE subunit A	NA	NA	NA	NA	NA
WP_000162975.1|1748868_1750077_+	non-hemolytic enterotoxin NHE subunit B	NA	NA	NA	NA	NA
WP_001171992.1|1750184_1751264_+	non-hemolytic enterotoxin NHE subunit C	NA	NA	NA	NA	NA
WP_000060531.1|1751497_1751677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411632.1|1751870_1753646_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_086411633.1|1754759_1755989_+	aminopeptidase	NA	NA	NA	NA	NA
WP_044307028.1|1756131_1757502_+	carboxylic ester hydrolase	NA	NA	NA	NA	NA
WP_000710978.1|1757765_1758350_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001033861.1|1758413_1759037_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086403163.1|1759247_1759658_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|1759806_1761237_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001056973.1|1761468_1762899_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000116992.1|1763164_1764595_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086403163.1|1764743_1765154_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_001056973.1|1765472_1766903_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000116992.1|1767134_1768565_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	1872837	1881518	5585577		Bacillus_phage(66.67%)	8	NA	NA
WP_000755498.1|1872837_1874130_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.5e-11
WP_001194309.1|1874229_1874994_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_174402541.1|1875234_1876995_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	1.8e-273
WP_016124455.1|1877080_1877758_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.2	3.7e-121
WP_140159410.1|1877754_1878828_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	96.9	2.2e-184
WP_006929137.1|1878852_1879446_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1879636_1880356_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258539.1|1880645_1881518_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.4	2.8e-65
>prophage 11
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	1916627	1964371	5585577	protease,transposase,coat	Streptococcus_phage(20.0%)	51	NA	NA
WP_086411350.1|1916627_1917857_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_016122345.1|1918226_1918688_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000174901.1|1918737_1919556_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_001025988.1|1919826_1921707_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648324.1|1921823_1922111_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	7.6e-12
WP_000099746.1|1922386_1923334_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	58.1	2.2e-95
WP_001259906.1|1923375_1923684_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016122346.1|1923790_1924726_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082492.1|1924773_1925949_+	MFS transporter	NA	NA	NA	NA	NA
WP_000162602.1|1926243_1926468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|1926552_1926900_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_000687338.1|1927096_1927624_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_001073050.1|1927806_1928856_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_016122348.1|1929057_1931040_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	8.7e-30
WP_000539569.1|1931237_1931543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965067.1|1931865_1932231_+	DUF3979 family protein	NA	NA	NA	NA	NA
WP_006924691.1|1932265_1933306_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_086412133.1|1933546_1933990_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	2.4e-44
WP_000488210.1|1934093_1934549_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798313.1|1934762_1935707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594045.1|1935751_1936753_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683359.1|1936857_1937049_-	DUF3896 family protein	NA	NA	NA	NA	NA
WP_001168130.1|1937226_1938690_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	21.6	2.6e-15
WP_086412132.1|1938774_1939359_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049107628.1|1939383_1940286_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_049107629.1|1940546_1942016_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_086412131.1|1942113_1943064_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048677.1|1943176_1943647_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126148.1|1943785_1944736_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174402542.1|1945001_1945151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804561.1|1945203_1946640_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001042735.1|1946937_1947597_+	oxidoreductase	NA	NA	NA	NA	NA
WP_016122352.1|1947626_1948664_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283907.1|1948797_1949250_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	2.3e-26
WP_016122353.1|1949275_1950262_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824278.1|1950346_1952008_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000943774.1|1952067_1952484_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.0	1.8e-38
WP_000543106.1|1952497_1953043_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_000858832.1|1953056_1953668_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817498.1|1953713_1954292_-	exosporium protein ExsB	NA	NA	NA	NA	NA
WP_000938001.1|1954473_1955550_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000153583.1|1955654_1956272_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000880691.1|1956376_1956979_+	DedA family protein	NA	NA	NA	NA	NA
WP_086412785.1|1957076_1958456_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000932389.1|1958787_1959729_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000418716.1|1959927_1960824_+	permease	NA	NA	NA	NA	NA
WP_000488043.1|1960827_1961697_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000141164.1|1961816_1962323_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000505094.1|1962449_1962536_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_002023919.1|1962696_1963881_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000340527.1|1963912_1964371_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 12
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	2078154	2140089	5585577	bacteriocin,transposase,tRNA	Staphylococcus_phage(30.0%)	55	NA	NA
WP_001056973.1|2078154_2079585_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_062804561.1|2079782_2081219_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086411420.1|2081824_2082895_+	conserved virulence factor C family protein	NA	NA	NA	NA	NA
WP_086411350.1|2083028_2084258_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000634884.1|2084628_2085012_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_000063706.1|2085095_2085530_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000637459.1|2085579_2086356_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000384910.1|2086656_2088345_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.7	1.8e-76
WP_000621475.1|2088457_2088787_+	DUF2085 domain-containing protein	NA	NA	NA	NA	NA
WP_000498601.1|2088816_2089035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140159338.1|2089172_2090051_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_086411499.1|2090428_2094631_+|bacteriocin	bacteriocin-processing peptidase family protein	bacteriocin	NA	NA	NA	NA
WP_086385946.1|2095017_2098119_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.9	9.7e-153
WP_086411369.1|2098805_2099951_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.7	5.2e-43
WP_000045224.1|2100827_2101412_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086411909.1|2101742_2103254_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_001167910.1|2103360_2103840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411910.1|2104380_2105679_+|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.7	3.6e-77
WP_086411911.1|2106252_2107593_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_086411912.1|2107638_2108544_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_086411913.1|2108580_2109156_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_000028911.1|2109191_2109989_-	DUF2837 family protein	NA	NA	NA	NA	NA
WP_000278491.1|2110179_2110842_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000424327.1|2111049_2112489_+	GntP family permease	NA	NA	NA	NA	NA
WP_086411914.1|2112567_2113770_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_086411915.1|2113942_2114635_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_000493252.1|2114730_2115204_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006925117.1|2115200_2115641_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006925119.1|2115816_2116302_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_000152534.1|2116312_2116531_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000181785.1|2116772_2117300_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_006925122.1|2117330_2117762_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006925123.1|2117915_2118626_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	8.2e-15
WP_086411916.1|2118618_2119833_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001134421.1|2120100_2120688_+	YpjP family protein	NA	NA	NA	NA	NA
WP_025687389.1|2120794_2121430_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_001094666.1|2121431_2121818_+	VOC family protein	NA	NA	NA	NA	NA
WP_086411917.1|2121829_2122762_+	phosphotransferase	NA	NA	NA	NA	NA
WP_086411918.1|2122812_2124270_-	serine hydrolase	NA	NA	NA	NA	NA
WP_000679609.1|2124468_2125425_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.0	3.8e-124
WP_000637205.1|2125444_2125933_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	47.5	2.5e-39
WP_001227243.1|2126088_2128074_+	penicillin-binding protein 3	NA	NA	NA	NA	NA
WP_000170025.1|2128315_2128951_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_086411919.1|2129061_2129781_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_000136889.1|2129822_2130479_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000492443.1|2130692_2130878_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_000431523.1|2130920_2131661_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_000629012.1|2131990_2132242_+	DUF2535 family protein	NA	NA	NA	NA	NA
WP_086411920.1|2132396_2133239_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	43.8	1.0e-24
WP_001129630.1|2133568_2134543_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000833335.1|2134878_2135466_+	SCO family protein	NA	NA	NA	NA	NA
WP_001288085.1|2135500_2135965_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_000333816.1|2136182_2138084_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	30.3	3.0e-35
WP_086411921.1|2138177_2138540_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062804561.1|2138652_2140089_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	2345129	2352203	5585577	transposase	Bacillus_phage(28.57%)	8	NA	NA
WP_086412531.1|2345129_2346494_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.6	2.0e-57
WP_086411350.1|2347914_2349144_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000033159.1|2349681_2349894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086385263.1|2350580_2350859_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	1.1e-12
WP_016122507.1|2350851_2351211_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	51.7	1.9e-31
WP_006923988.1|2351229_2351397_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	66.0	5.2e-13
WP_006923989.1|2351422_2351674_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.8	3.8e-07
WP_086412443.1|2351693_2352203_+	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	43.8	6.7e-27
>prophage 14
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	2468803	2530781	5585577	transposase,tRNA	Bacillus_phage(33.33%)	54	NA	NA
WP_000499525.1|2468803_2470000_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_086411362.1|2470765_2471122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990082.1|2471227_2471761_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411364.1|2471815_2472376_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376554.1|2473026_2473164_-	DUF3956 domain-containing protein	NA	NA	NA	NA	NA
WP_140159327.1|2473344_2473440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006917594.1|2473502_2474519_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_001243307.1|2474694_2475852_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	6.0e-31
WP_001038807.1|2475841_2476537_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.3	2.2e-44
WP_140159326.1|2477352_2478027_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_000151939.1|2478023_2478761_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_086411360.1|2478904_2479753_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001059022.1|2479944_2480319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411359.1|2480494_2483176_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_140159325.1|2483508_2484735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086411350.1|2485458_2486688_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_087874946.1|2488664_2489824_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_174402576.1|2489921_2490011_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_086412680.1|2490098_2490899_+	class C sortase	NA	NA	NA	NA	NA
WP_086412679.1|2491055_2493011_+	choice-of-anchor A family protein	NA	NA	NA	NA	NA
WP_086412678.1|2493170_2493731_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000559843.1|2493971_2494451_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_086412677.1|2494530_2497701_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000376286.1|2498087_2498429_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001244707.1|2498425_2498938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751427.1|2498937_2500389_+	serine hydrolase	NA	S5Z991	Mycobacterium_phage	23.8	1.9e-13
WP_000798699.1|2501060_2501813_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|2501802_2503098_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_086411831.1|2503574_2504801_-	MFS transporter	NA	A0A1B0RXA6	Streptococcus_phage	22.3	6.4e-07
WP_086411832.1|2505141_2505858_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_086411833.1|2506208_2506547_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086411834.1|2506680_2507433_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000833454.1|2507569_2508403_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_086411835.1|2508520_2509315_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_086411836.1|2510262_2510589_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
WP_121868543.1|2510609_2511392_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085960089.1|2512187_2513532_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	2.8e-112
WP_086412433.1|2514705_2515299_+	DUF4030 domain-containing protein	NA	NA	NA	NA	NA
WP_048535372.1|2515369_2516740_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	42.1	7.5e-73
WP_048535495.1|2516765_2517080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412434.1|2517212_2518646_-	4-hydroxyphenylacetate 3-hydroxylase	NA	NA	NA	NA	NA
WP_001176008.1|2518664_2519108_-	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_000279694.1|2519318_2519519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412435.1|2519679_2520606_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_006929510.1|2520687_2521545_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001021411.1|2521600_2522098_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_086412436.1|2522354_2522984_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048558496.1|2523237_2523939_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048558495.1|2523935_2524838_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000551048.1|2524982_2525153_+	DUF2197 domain-containing protein	NA	NA	NA	NA	NA
WP_086412437.1|2525565_2527119_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001128402.1|2527178_2527607_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000029415.1|2528131_2528941_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087942375.1|2529220_2530781_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
>prophage 15
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	2607334	2660920	5585577	bacteriocin,transposase	Bacillus_phage(27.27%)	57	NA	NA
WP_103627277.1|2607334_2608216_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.7	2.6e-42
WP_006929674.1|2608376_2608838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048656837.1|2609004_2609535_+	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_086412059.1|2609580_2611014_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_025709387.1|2611166_2612081_+	DMT family transporter	NA	NA	NA	NA	NA
WP_086412060.1|2612271_2613633_+	chitosanase	NA	NA	NA	NA	NA
WP_086412061.1|2613795_2614719_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001160791.1|2615285_2615633_+	divalent cation tolerance protein CutA	NA	K7YGE2	Megavirus	36.0	2.7e-11
WP_000836831.1|2615649_2616096_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_127063985.1|2616295_2616532_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000288894.1|2616633_2617650_+	serine hydrolase	NA	NA	NA	NA	NA
WP_000653680.1|2617681_2617825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412063.1|2618104_2619313_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_086412064.1|2619443_2619869_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000757601.1|2620148_2620592_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_016122605.1|2620622_2621753_+	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_042866981.1|2621972_2622896_+	hypothetical protein	NA	A0A0E3DF67	Bacillus_phage	54.2	1.6e-74
WP_001037065.1|2622959_2623922_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000546826.1|2624218_2624989_+	hypothetical protein	NA	A0A0K2CNR4	Brevibacillus_phage	31.9	6.2e-16
WP_000799810.1|2625748_2626564_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_086412067.1|2628335_2628701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412068.1|2628979_2629339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412069.1|2629351_2630203_-	patatin family protein	NA	NA	NA	NA	NA
WP_000522472.1|2630382_2630760_+	PH domain-containing protein	NA	A6N235	Microbacterium_phage	36.4	5.5e-10
WP_086412070.1|2630880_2631354_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000999082.1|2631355_2631877_-	bacillithiol transferase BstA	NA	NA	NA	NA	NA
WP_086412071.1|2631893_2632421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086388194.1|2632484_2633807_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_049108018.1|2633889_2634669_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000265477.1|2634801_2635008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001048941.1|2635065_2635446_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_000185957.1|2635523_2636087_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086412072.1|2636126_2636699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412073.1|2636881_2638312_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_000587700.1|2638447_2638705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026325.1|2638796_2638976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006929730.1|2639165_2639828_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_062804561.1|2639991_2641428_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_062804561.1|2641663_2643100_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_016122617.1|2643525_2643966_-	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
WP_000844396.1|2644182_2645298_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000110841.1|2645424_2646078_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_086411711.1|2646221_2646404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202756.1|2646423_2647191_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411710.1|2647368_2647893_-	MepB family protein	NA	A0A2H4UW84	Bodo_saltans_virus	35.1	8.5e-17
WP_086411709.1|2647980_2648334_-	DUF4180 domain-containing protein	NA	NA	NA	NA	NA
WP_000751389.1|2648566_2650015_-	serine hydrolase	NA	NA	NA	NA	NA
WP_140159353.1|2650512_2651205_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_086411707.1|2651652_2652318_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	2.7e-36
WP_086411712.1|2652331_2653783_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	9.8e-23
WP_046392780.1|2654104_2654641_+	DinB family protein	NA	NA	NA	NA	NA
WP_000273238.1|2654842_2655025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447855.1|2655320_2655998_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	4.9e-25
WP_086411706.1|2656009_2657434_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086411705.1|2658004_2659006_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_087874946.1|2659415_2660574_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_174402546.1|2660617_2660920_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	54.3	1.2e-20
>prophage 16
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	2754991	2809263	5585577	transposase,coat	Bacillus_phage(44.44%)	60	NA	NA
WP_087874946.1|2754991_2756151_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000877572.1|2756338_2756791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000503004.1|2756791_2756965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411305.1|2757232_2757541_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174402548.1|2757736_2758417_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.7	2.0e-42
WP_086412049.1|2758484_2759315_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	81.5	7.6e-137
WP_086412050.1|2759758_2760493_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	61.0	1.1e-78
WP_000820904.1|2760783_2761233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789485.1|2761476_2761665_+	DUF4017 family protein	NA	NA	NA	NA	NA
WP_000416873.1|2761988_2762918_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_086412051.1|2763078_2763744_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	41.8	2.1e-28
WP_016122672.1|2763990_2764494_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086412052.1|2764599_2765241_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_000398282.1|2765302_2765599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174402549.1|2765752_2766145_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_025709486.1|2766217_2767708_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000920975.1|2767838_2769323_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001169448.1|2769340_2770237_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001025560.1|2770259_2771201_-	proline racemase family protein	NA	NA	NA	NA	NA
WP_016122676.1|2771197_2772235_-	proline racemase family protein	NA	NA	NA	NA	NA
WP_001215265.1|2772231_2773407_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000885731.1|2773587_2775249_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_000182620.1|2775361_2775634_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_000087063.1|2775630_2775963_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_001286091.1|2775959_2777195_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000447758.1|2777219_2777528_-	YxcD family protein	NA	NA	NA	NA	NA
WP_000914478.1|2777515_2777965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411350.1|2778339_2779569_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000447231.1|2779956_2780721_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000952913.1|2780955_2781561_+	DedA family protein	NA	NA	NA	NA	NA
WP_000558695.1|2781729_2781954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000782297.1|2781994_2783176_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_000061618.1|2783444_2783978_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000758260.1|2784092_2785715_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006921880.1|2785735_2786737_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_086411350.1|2787106_2788336_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_016122681.1|2788509_2789571_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_086411668.1|2789757_2790084_-	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_001228729.1|2790380_2790737_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_016122682.1|2791020_2791947_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000981438.1|2791966_2792563_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_000456154.1|2792559_2793051_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000789031.1|2793587_2793818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000432429.1|2794191_2794455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002024301.1|2794505_2794751_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016122683.1|2794852_2795614_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016122684.1|2795841_2797581_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_002204764.1|2797902_2798745_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_006922096.1|2798934_2800311_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	1.7e-16
WP_000865970.1|2800303_2800951_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	1.0e-35
WP_006922097.1|2801072_2801489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116344779.1|2801687_2802182_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000916870.1|2802469_2803174_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_086411667.1|2803228_2803888_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_001079720.1|2803890_2804604_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_006922103.1|2804621_2805371_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_086411666.1|2805383_2806967_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_000538278.1|2807257_2808118_-	DegV family protein	NA	NA	NA	NA	NA
WP_000361676.1|2808595_2809048_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_000342253.1|2809062_2809263_-|coat	spore coat protein W	coat	NA	NA	NA	NA
>prophage 17
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	2977357	3099540	5585577	transposase,coat	Streptococcus_phage(20.83%)	110	NA	NA
WP_174402550.1|2977357_2978516_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_121868300.1|2978587_2979253_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000366230.1|2979253_2979721_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000449119.1|2979914_2980706_+	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_000265342.1|2980770_2981202_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_016122748.1|2981254_2982280_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016122749.1|2982380_2983316_-	serine hydrolase	NA	NA	NA	NA	NA
WP_086411503.1|2983340_2984231_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016122751.1|2984279_2984750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006927580.1|2984767_2985175_-	DUF3980 domain-containing protein	NA	NA	NA	NA	NA
WP_016122753.1|2985758_2986670_-	EamA family transporter	NA	NA	NA	NA	NA
WP_086411502.1|2986795_2988247_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000708760.1|2988318_2988759_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000358161.1|2988840_2989155_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_006926031.1|2989235_2990060_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_086411501.1|2990177_2990849_-	uridine kinase	NA	NA	NA	NA	NA
WP_000357656.1|2991019_2991763_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_086411500.1|2991776_2992706_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_006926038.1|2992720_2993518_-	VOC family protein	NA	NA	NA	NA	NA
WP_002024365.1|2993615_2994626_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000764607.1|2994662_2995112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411350.1|2995482_2996712_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_001083386.1|2997471_2998938_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026167.1|2999051_2999357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411908.1|2999390_3000161_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_086411907.1|3002045_3002807_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033692730.1|3002988_3003513_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_006926048.1|3003719_3004295_+	cephalosporin hydroxylase family protein	NA	NA	NA	NA	NA
WP_016122761.1|3004330_3004852_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001249192.1|3004933_3007087_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_001183793.1|3007411_3008140_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_000859708.1|3008215_3008863_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_001021658.1|3008879_3009842_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_086411369.1|3010755_3011901_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.7	5.2e-43
WP_000207317.1|3012131_3012893_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_086411961.1|3012911_3013901_-	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_000672280.1|3013891_3014605_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_000026361.1|3014619_3015372_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000662501.1|3015527_3016079_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000895119.1|3016102_3016780_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_086411962.1|3016977_3017685_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_086411350.1|3017887_3019117_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_006927766.1|3019487_3019958_+	DinB family protein	NA	NA	NA	NA	NA
WP_001218366.1|3020131_3021280_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_000662215.1|3021434_3022067_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000402586.1|3022396_3022984_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411305.1|3023405_3023714_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086411306.1|3023710_3024268_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.9	2.9e-23
WP_000798699.1|3024316_3025069_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|3025058_3026354_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_174402546.1|3026477_3026780_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	54.3	1.2e-20
WP_001206771.1|3026866_3028195_-	YjiH family protein	NA	NA	NA	NA	NA
WP_000553380.1|3028306_3029185_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_063536752.1|3029185_3029701_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006916820.1|3029724_3030189_-	DUF2691 family protein	NA	NA	NA	NA	NA
WP_140159372.1|3030405_3030840_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001139524.1|3031148_3031655_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411305.1|3032749_3033058_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103627277.1|3033054_3033936_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.7	2.6e-42
WP_002024352.1|3034387_3035035_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086412556.1|3035138_3037526_-	immune inhibitor A	NA	NA	NA	NA	NA
WP_006920798.1|3037768_3040375_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.0	9.3e-48
WP_086412555.1|3040527_3041730_-	glycosyl transferase	NA	E5KJ78	Phthorimaea_operculella_granulovirus	31.5	1.7e-12
WP_006920795.1|3042066_3042924_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060851962.1|3044054_3044534_-|coat	spore coat protein CotF	coat	NA	NA	NA	NA
WP_006920793.1|3045032_3045791_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_033692229.1|3045882_3046509_+	LysE family transporter	NA	NA	NA	NA	NA
WP_086412553.1|3046561_3047911_-	amino acid permease	NA	NA	NA	NA	NA
WP_006920787.1|3047925_3048078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069660.1|3048298_3048511_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	1.6e-14
WP_006920770.1|3048794_3049271_+	YndM family protein	NA	NA	NA	NA	NA
WP_001986359.1|3049306_3049822_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_000517671.1|3050116_3050329_-	small acid-soluble spore protein, SasP family	NA	Q77YX0	Bacillus_phage	60.0	1.6e-14
WP_000649085.1|3050594_3051728_+	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.5	1.3e-14
WP_000500358.1|3051961_3052816_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_103597424.1|3053076_3054507_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000722302.1|3054560_3055565_-	asparaginase	NA	NA	NA	NA	NA
WP_000893569.1|3055749_3056127_+	HTH-type transcriptional regulator AnsR	NA	A8ATJ9	Listeria_phage	35.8	1.9e-10
WP_071679802.1|3056485_3056590_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033689824.1|3056715_3056892_-	hypothetical protein	NA	D2XPX7	Bacillus_virus	60.0	1.3e-06
WP_086411350.1|3058031_3059261_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000809697.1|3059792_3060875_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_006920984.1|3060895_3062395_-	spore germination protein	NA	NA	NA	NA	NA
WP_086411397.1|3062755_3065161_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_086388591.1|3065840_3067241_-	hemolytic enterotoxin HBL binding subunit HblA	NA	NA	NA	NA	NA
WP_086411398.1|3067615_3068743_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_000714435.1|3068779_3070000_-	hemolytic enterotoxin HBL lytic component L1	NA	NA	NA	NA	NA
WP_086411399.1|3070061_3071381_-	hemolytic enterotoxin HBL lytic component L2	NA	NA	NA	NA	NA
WP_001097903.1|3072561_3073791_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_076876078.1|3074215_3074347_+	peptidase	NA	NA	NA	NA	NA
WP_000897403.1|3075053_3075284_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	49.3	1.2e-10
WP_086411400.1|3075465_3076092_-	excinuclease ABC subunit C	NA	D2XPX7	Bacillus_virus	48.4	3.8e-56
WP_016122783.1|3076257_3077673_-	amino acid permease	NA	NA	NA	NA	NA
WP_001041290.1|3077806_3078625_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.1	1.6e-33
WP_086411401.1|3078939_3079287_-	DoxX family protein	NA	NA	NA	NA	NA
WP_000074777.1|3079454_3080699_-	NAD-dependent malic enzyme 4	NA	NA	NA	NA	NA
WP_000275580.1|3081710_3083006_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|3082995_3083748_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_174402527.1|3083723_3083969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411672.1|3084204_3085398_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000628606.1|3085394_3086486_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_103597474.1|3086512_3088087_-	spore germination protein	NA	NA	NA	NA	NA
WP_086411671.1|3088767_3089712_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000584790.1|3089716_3091033_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000588656.1|3091266_3092247_-	glutaminase GlsA	NA	NA	NA	NA	NA
WP_086411670.1|3092371_3093796_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_016122788.1|3094756_3095908_+	anion transporter	NA	NA	NA	NA	NA
WP_049108388.1|3096169_3096430_-	cytochrome P450	NA	NA	NA	NA	NA
WP_086411669.1|3096782_3097940_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.0	6.6e-22
WP_086411350.1|3098310_3099540_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
>prophage 18
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	3306628	3335238	5585577	transposase	Staphylococcus_phage(37.5%)	31	NA	NA
WP_000499525.1|3306628_3307825_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_103597485.1|3308117_3308252_-	BA3454 family stress response protein	NA	NA	NA	NA	NA
WP_086412362.1|3308299_3308695_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_000860831.1|3309273_3309618_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078994371.1|3309670_3310408_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016123067.1|3310440_3311502_-	oxidoreductase	NA	NA	NA	NA	NA
WP_006924209.1|3311715_3312888_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L0U7	Tupanvirus	37.2	6.2e-52
WP_006924211.1|3313173_3313500_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086412363.1|3313691_3314036_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006924216.1|3314449_3315460_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023522577.1|3315540_3315957_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_001053955.1|3316488_3317925_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_016098750.1|3319625_3320192_-	SGNH/GDSL hydrolase family protein	NA	A0A0N9RRL9	Staphylococcus_phage	30.8	9.5e-06
WP_012593290.1|3320209_3321037_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016123071.1|3321062_3321620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069604223.1|3321648_3322488_-	phosphotransferase	NA	NA	NA	NA	NA
WP_086411998.1|3322653_3323403_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000801642.1|3323486_3323696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411997.1|3323778_3324678_-	PhzF family phenazine biosynthesis isomerase	NA	NA	NA	NA	NA
WP_103597362.1|3324689_3325466_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263474.1|3325462_3326167_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_086411995.1|3326163_3326727_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411994.1|3326909_3327458_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087942375.1|3327659_3329220_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
WP_140159370.1|3329300_3330803_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	3.6e-36
WP_016123075.1|3330937_3331471_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001072981.1|3331595_3331919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001121202.1|3332112_3332268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411986.1|3332399_3332744_+|transposase	transposase	transposase	A0A0N7GFG6	Staphylococcus_phage	42.9	3.6e-16
WP_000499525.1|3332893_3334090_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_174402551.1|3334398_3335238_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.1	7.2e-34
>prophage 19
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	3633207	3643365	5585577	bacteriocin	Bacillus_phage(54.55%)	14	NA	NA
WP_000413738.1|3633207_3633828_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_006920048.1|3633918_3634722_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031384.1|3634722_3635265_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3635257_3635581_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392444.1|3635952_3636183_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	73.7	1.5e-23
WP_016123244.1|3636244_3637141_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	52.1	4.6e-79
WP_006920050.1|3637413_3638256_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	6.1e-33
WP_033692154.1|3638374_3639361_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.9	1.7e-34
WP_000464425.1|3639599_3639986_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_016123249.1|3640104_3640971_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	63.3	6.8e-96
WP_001189065.1|3641123_3641318_-	hypothetical protein	NA	A0A1C8E9A1	Bacillus_phage	71.0	1.7e-15
WP_086412708.1|3641329_3642088_-	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.0	2.0e-96
WP_000283431.1|3642290_3642503_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_033692152.1|3642705_3643365_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	6.6e-35
>prophage 20
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	4327156	4431403	5585577	head,terminase,tail,transposase,protease,holin,coat,tRNA,capsid,portal	Bacillus_phage(42.62%)	114	NA	NA
WP_000840898.1|4327156_4328932_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	7.1e-15
WP_000027084.1|4328944_4330216_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001242605.1|4330570_4330747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001266965.1|4330912_4331353_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001262795.1|4331369_4333553_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.5	2.4e-12
WP_000346215.1|4333763_4334276_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	8.5e-30
WP_086411435.1|4334323_4336663_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.0	1.7e-85
WP_086411434.1|4336764_4337658_-	cation transporter	NA	NA	NA	NA	NA
WP_086389511.1|4337814_4340079_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.9	9.6e-33
WP_000886979.1|4340348_4340633_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_000198301.1|4340818_4342378_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_000454838.1|4342458_4343106_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_086411350.1|4343340_4344570_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000349148.1|4344942_4345326_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_000991115.1|4345362_4345623_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.8	1.3e-05
WP_000125365.1|4345650_4346790_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354034.1|4346802_4347855_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|4347874_4348075_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344449.1|4348071_4349073_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000464511.1|4349078_4349696_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_086411573.1|4349884_4350829_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871175.1|4350843_4351374_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_062804561.1|4351572_4353009_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_140159386.1|4353477_4353912_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001093537.1|4353945_4354590_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_086412190.1|4354768_4356580_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025336.1|4356805_4357912_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092209.1|4357942_4358776_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138531.1|4358795_4360325_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973766.1|4360477_4361620_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.5	3.8e-30
WP_000812275.1|4361619_4362162_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510698.1|4362241_4362889_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621701.1|4363121_4363973_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_086389516.1|4364069_4365983_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086412191.1|4366032_4367955_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114529.1|4367929_4368706_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_086412192.1|4368799_4369882_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002082113.1|4369871_4370579_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497127.1|4370719_4372006_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003587.1|4372005_4372554_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|4372617_4372908_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|4372911_4373256_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4373267_4373576_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_086389519.1|4373745_4375134_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_086412193.1|4375201_4376062_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797471.1|4376054_4376801_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4376935_4377733_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391521.1|4377735_4378422_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975766.1|4378457_4379003_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_086412194.1|4379017_4379869_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4379910_4380930_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_033692863.1|4381087_4381492_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_103597523.1|4381599_4382430_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	84.1	3.1e-122
WP_103597525.1|4382447_4382741_-	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	90.7	1.9e-42
WP_086412149.1|4382765_4382984_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000119478.1|4383123_4383447_+	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	62.7	1.9e-27
WP_153579224.1|4383657_4384374_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	93.3	1.5e-85
WP_016099116.1|4384373_4384799_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.2	8.3e-71
WP_086385679.1|4384833_4385214_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	79.2	2.3e-48
WP_174402557.1|4385225_4390568_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	43.4	0.0e+00
WP_086412727.1|4390564_4392028_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	58.4	3.6e-166
WP_086412539.1|4394740_4395955_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	74.6	3.1e-155
WP_086412417.1|4396185_4396548_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	6.8e-42
WP_086412416.1|4396554_4397148_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.8	1.8e-103
WP_016123345.1|4397148_4397481_-	hypothetical protein	NA	D2XR22	Bacillus_phage	88.2	1.2e-48
WP_000997561.1|4397477_4397822_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	94.7	3.0e-55
WP_001247292.1|4397823_4398189_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	93.4	7.6e-57
WP_000450787.1|4398190_4398490_-	hypothetical protein	NA	D2XR19	Bacillus_phage	86.9	2.1e-41
WP_086412415.1|4398495_4399659_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.4	4.9e-198
WP_086412414.1|4399662_4400406_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	84.6	1.7e-111
WP_172451981.1|4400405_4401554_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	95.3	9.6e-207
WP_086411890.1|4401558_4403214_-|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	98.5	0.0e+00
WP_000763336.1|4403210_4403567_-	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_086411891.1|4403719_4404055_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.7	6.5e-55
WP_086411892.1|4404020_4404395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174402558.1|4404385_4404643_-	hydrolase	NA	NA	NA	NA	NA
WP_174402559.1|4404649_4404859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411895.1|4404926_4405361_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	61.5	9.8e-19
WP_016099130.1|4405366_4405570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650576.1|4405583_4405808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499525.1|4406173_4407370_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_081206614.1|4407666_4407849_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	7.9e-15
WP_174402560.1|4407900_4408320_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	96.4	3.5e-74
WP_098369173.1|4408679_4409189_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J8J4	uncultured_Caudovirales_phage	82.2	1.9e-58
WP_086412579.1|4409325_4409649_-	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	87.9	1.9e-51
WP_086412580.1|4409645_4410173_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	96.0	9.5e-93
WP_086412581.1|4410212_4410416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412582.1|4410452_4410752_-	hypothetical protein	NA	Q3HKX6	Bacillus_phage	79.8	1.0e-38
WP_086412583.1|4410787_4410982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174402561.1|4411628_4413452_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.2	9.2e-26
WP_153579223.1|4414028_4414178_-	hypothetical protein	NA	A0A109ZRI8	Bacillus_phage	52.1	6.5e-07
WP_061664074.1|4414225_4414423_-	hypothetical protein	NA	H0USU7	Bacillus_phage	95.2	9.5e-30
WP_086412110.1|4414452_4414989_-	dUTP diphosphatase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	89.9	2.2e-89
WP_086390243.1|4415113_4415548_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	95.8	1.0e-76
WP_001245738.1|4415586_4416144_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_000139235.1|4416167_4416398_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_103597703.1|4416390_4416870_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	99.4	2.7e-86
WP_103597704.1|4416881_4417835_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	4.9e-148
WP_086412577.1|4417928_4418267_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	1.7e-50
WP_038413184.1|4418199_4418415_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	94.4	3.6e-30
WP_015670531.1|4418414_4419128_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	99.2	5.5e-128
WP_103597705.1|4419146_4419581_-	replication terminator protein	NA	A0A1C8E9A2	Bacillus_phage	98.6	1.8e-73
WP_001187283.1|4419607_4419796_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_086412557.1|4419807_4420563_-	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	86.2	9.1e-113
WP_000788391.1|4420579_4420738_-	hypothetical protein	NA	A0A0S2MVC5	Bacillus_phage	89.8	1.3e-18
WP_086412558.1|4420852_4421107_-	transcriptional regulator	NA	A0A2H4JEY2	uncultured_Caudovirales_phage	85.7	4.8e-34
WP_000806799.1|4421277_4421964_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J386	uncultured_Caudovirales_phage	89.0	5.2e-115
WP_000215778.1|4422047_4423445_+	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	78.3	9.6e-209
WP_001013397.1|4423448_4423847_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226293.1|4423893_4424469_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_086412559.1|4424701_4425652_-	stage II sporulation protein B	NA	NA	NA	NA	NA
WP_000582071.1|4425817_4427119_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072250.1|4427212_4429858_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.8	1.2e-164
WP_000350658.1|4430377_4431403_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
>prophage 21
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	4495715	4503401	5585577		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221061.1|4495715_4496639_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_016125943.1|4496764_4497700_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.9	4.3e-11
WP_000018056.1|4497701_4498394_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.7	6.3e-36
WP_001293578.1|4498562_4498736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4498736_4498931_+	YwbE family protein	NA	NA	NA	NA	NA
WP_006916399.1|4498969_4500169_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	4.7e-71
WP_000587818.1|4500464_4500788_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086120.1|4500860_4501625_-	class B sortase	NA	NA	NA	NA	NA
WP_000403758.1|4501657_4502428_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	3.7e-13
WP_086411783.1|4502417_4503401_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	4.2e-17
>prophage 22
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	4857697	4950425	5585577	head,terminase,tail,protease,transposase,holin,coat,tRNA,capsid,integrase,plate,portal	Bacillus_phage(67.24%)	101	4887949:4887964	4923969:4923984
WP_000287147.1|4857697_4859074_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_001140612.1|4859113_4859497_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810326.1|4859592_4860336_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001253379.1|4860386_4860980_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4861025_4861913_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_086412241.1|4862020_4863745_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	7.8e-176
WP_000545252.1|4863888_4864494_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_025710385.1|4864880_4866134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016123673.1|4866149_4866572_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_001183889.1|4866583_4866928_-	EamA family transporter	NA	NA	NA	NA	NA
WP_016123674.1|4867030_4867918_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000487952.1|4868092_4869577_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_006922360.1|4869722_4870349_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.8e-14
WP_000027016.1|4870435_4870753_-	YuiB family protein	NA	NA	NA	NA	NA
WP_000415315.1|4870749_4871256_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|4871376_4872585_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829785.1|4873046_4874036_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	2.3e-31
WP_174402567.1|4874150_4884122_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000606648.1|4884564_4885044_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391940.1|4885262_4886510_+	MFS transporter	NA	NA	NA	NA	NA
WP_086412682.1|4886533_4887409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016123681.1|4887488_4887950_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
4887949:4887964	attL	GACCCTGTTCGTCAAT	NA	NA	NA	NA
WP_086412683.1|4888272_4889100_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.1	1.9e-100
WP_086412684.1|4889109_4889730_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	92.7	5.5e-108
WP_086412685.1|4889671_4890853_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.6	3.8e-214
WP_086412686.1|4890968_4891151_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	7.9e-23
WP_086412687.1|4891153_4891456_-	hypothetical protein	NA	H0USY0	Bacillus_phage	95.9	2.9e-46
WP_086412688.1|4891638_4891836_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	75.0	4.4e-19
WP_086412689.1|4891844_4892024_+	hypothetical protein	NA	A0A288WFV9	Bacillus_phage	81.6	5.1e-14
WP_086412690.1|4892029_4892608_+	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.5	7.7e-96
WP_000119485.1|4892661_4893000_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	1.2e-48
WP_086412691.1|4893545_4894247_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.4	2.1e-119
WP_000373913.1|4894246_4894672_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000390482.1|4894747_4894972_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_001243323.1|4895097_4896273_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	80.4	4.6e-172
WP_086412094.1|4896287_4898630_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	95.1	0.0e+00
WP_000884123.1|4898626_4899310_-|tail	phage tail family protein	tail	A0A1B0T6A0	Bacillus_phage	96.0	2.1e-124
WP_086412095.1|4899310_4902835_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	96.5	0.0e+00
WP_015406517.1|4902851_4903040_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	96.8	4.1e-30
WP_086412096.1|4903078_4903465_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	98.4	4.0e-64
WP_000151366.1|4903476_4904112_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000157921.1|4904123_4904501_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	87.2	2.5e-55
WP_001166633.1|4904500_4904830_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_140159334.1|4904819_4905152_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	95.5	2.7e-53
WP_000342229.1|4905129_4905390_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	96.5	1.4e-41
WP_086411468.1|4905391_4906705_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	85.9	2.9e-183
WP_000687902.1|4906706_4907288_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	95.9	5.4e-97
WP_000603760.1|4907358_4907616_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_086411467.1|4907784_4908957_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	98.7	5.9e-220
WP_086411466.1|4908972_4910697_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.1	0.0e+00
WP_000113444.1|4910693_4911119_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_086411465.1|4911201_4911591_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	1.7e-70
WP_000627439.1|4911587_4911902_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	5.2e-46
WP_000074276.1|4911898_4912117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411464.1|4912163_4912361_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	84.6	3.0e-23
WP_000930966.1|4912418_4912643_-	hypothetical protein	NA	H0USV5	Bacillus_phage	93.2	6.1e-33
WP_000895342.1|4912927_4913317_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	60.5	2.9e-38
WP_001284975.1|4913334_4913457_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847112.1|4913600_4913786_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	51.6	5.1e-09
WP_000826294.1|4913821_4914031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159774.1|4914247_4914994_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFZ8	Bacillus_phage	72.2	6.5e-95
WP_000002744.1|4914990_4915215_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	74.0	2.3e-24
WP_086411463.1|4915214_4916096_-	ATP-binding protein	NA	A0A0S2SXI8	Bacillus_phage	33.6	5.2e-27
WP_086411462.1|4916107_4916881_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	45.5	1.4e-52
WP_000425248.1|4917014_4917896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372559.1|4917919_4918591_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	65.6	9.6e-82
WP_000788372.1|4918628_4918784_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	82.4	1.7e-18
WP_000277641.1|4918800_4918989_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	5.9e-21
WP_000379206.1|4919133_4919379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004989.1|4919627_4919957_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_001164934.1|4920359_4921490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411472.1|4921657_4921888_-	hypothetical protein	NA	H0UST5	Bacillus_phage	89.5	1.9e-29
WP_000237487.1|4922849_4923911_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_086411461.1|4923999_4924353_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	41.8	2.0e-14
4923969:4923984	attR	GACCCTGTTCGTCAAT	NA	NA	NA	NA
WP_001084691.1|4924987_4925551_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573821.1|4925656_4926010_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	6.3e-16
WP_000077396.1|4926051_4926918_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4927188_4927428_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682079.1|4927779_4928850_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054091.1|4929083_4929257_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470316.1|4929311_4929971_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	4.9e-22
WP_000679254.1|4929954_4930752_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212735.1|4930951_4931293_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_140159335.1|4931452_4931734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411350.1|4932504_4933734_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086411700.1|4934633_4936292_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_086411701.1|4936332_4936680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006918885.1|4936716_4936971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411330.1|4937419_4939294_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.3	1.2e-36
WP_069604585.1|4940328_4940967_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_076876496.1|4941784_4942453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411331.1|4942575_4943370_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_086411332.1|4943421_4943730_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4943925_4944162_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4944357_4944573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614215.1|4944634_4945636_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_086411333.1|4945756_4946248_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_006918864.1|4946271_4946751_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086411334.1|4946912_4948016_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_086411335.1|4947960_4949307_+	phosphoribosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000239908.1|4949312_4950425_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 23
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	5058506	5133983	5585577	head,terminase,tail,transposase,protease,holin,tRNA,capsid,integrase,plate,portal	Bacillus_phage(74.07%)	89	5061897:5061916	5134277:5134296
WP_001021096.1|5058506_5059769_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	5.3e-89
WP_001057102.1|5060137_5061055_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573649.1|5061438_5061834_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
5061897:5061916	attL	TTGGTGAGGGCTAATAATCA	NA	NA	NA	NA
WP_086412648.1|5062042_5063545_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_086412647.1|5063577_5064636_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_174402580.1|5064982_5065387_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568587.1|5065383_5065740_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_074618690.1|5065772_5066012_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_140159424.1|5066091_5066343_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_086412646.1|5066459_5066975_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834708.1|5067117_5067522_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_081631303.1|5067571_5068528_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_006918757.1|5069005_5069563_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	28.1	9.3e-06
WP_016079774.1|5069603_5070038_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086412645.1|5070394_5071360_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000608841.1|5071512_5071944_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103597638.1|5071940_5072228_-	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_086412644.1|5072422_5073961_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590061.1|5074384_5075137_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631245.1|5075133_5076198_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042075.1|5076194_5077211_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.5	6.6e-58
WP_000749446.1|5077230_5078247_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016123738.1|5078631_5079309_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016123739.1|5079804_5080572_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001123920.1|5081379_5081847_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_071739841.1|5081973_5084400_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_086411369.1|5085031_5086177_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.7	5.2e-43
WP_062804561.1|5086551_5087988_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_062804561.1|5088223_5089660_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086402930.1|5089802_5090684_+	helix-turn-helix domain-containing protein	NA	I7ILW0	Bacillus_phage	90.4	1.8e-144
WP_000842170.1|5090688_5091297_-	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	98.5	2.4e-111
WP_086402929.1|5091286_5092453_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	94.1	1.5e-210
WP_000495115.1|5092463_5092784_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	98.1	2.1e-50
WP_127057661.1|5092803_5092935_-	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000264500.1|5093258_5093483_+	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_086402928.1|5093859_5094678_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	97.1	2.8e-160
WP_000373895.1|5094677_5095103_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.0	7.0e-70
WP_140159426.1|5095118_5096078_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLC8	Bacillus_phage	96.6	3.9e-177
WP_086411369.1|5096424_5097570_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.7	5.2e-43
WP_086402933.1|5097771_5098950_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	73.9	1.9e-157
WP_086412692.1|5098950_5101311_-|tail	phage tail protein	tail	A0A1B0T695	Bacillus_phage	81.4	0.0e+00
WP_086412693.1|5101307_5101991_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	72.1	3.2e-93
WP_086412694.1|5101993_5105809_-|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	27.0	3.4e-38
WP_086402899.1|5105991_5106342_-	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	35.4	7.4e-09
WP_086402900.1|5106403_5106973_-|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	45.5	2.4e-41
WP_086402901.1|5106974_5107385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086402902.1|5107374_5107755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086402903.1|5107741_5108098_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_086402904.1|5108066_5108411_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	45.3	3.4e-14
WP_086412695.1|5108424_5109573_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	52.2	3.3e-98
WP_086412696.1|5109589_5110306_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	46.8	2.0e-40
WP_086412697.1|5110253_5111489_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	37.4	1.6e-74
WP_086412698.1|5111505_5113164_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.6	8.2e-183
WP_086412703.1|5113147_5113648_-	helix-turn-helix domain-containing protein	NA	A0A1S7FYW6	Listeria_phage	41.2	8.1e-09
WP_174402568.1|5113985_5114294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412699.1|5114298_5114625_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	51.0	1.7e-20
WP_086412700.1|5114771_5115266_-	hypothetical protein	NA	A0A288WG64	Bacillus_phage	33.7	2.3e-08
WP_086412701.1|5115665_5115884_-	hypothetical protein	NA	H0USV5	Bacillus_phage	64.9	7.5e-20
WP_086411973.1|5116095_5116638_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	2.9e-89
WP_000166181.1|5116637_5117120_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.1e-71
WP_086412702.1|5117147_5117318_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	78.6	3.2e-10
WP_000645586.1|5117433_5117556_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_086389782.1|5117560_5117749_-	hypothetical protein	NA	G9J1S8	Bacillus_phage	49.2	1.5e-08
WP_086402465.1|5117777_5118194_-	hypothetical protein	NA	Q9XJF2	Lactococcus_phage	33.3	3.7e-07
WP_086402466.1|5118471_5118663_-	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	59.3	1.2e-10
WP_086402471.1|5118700_5118907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016111358.1|5118980_5119205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086402467.1|5119201_5119606_-	hypothetical protein	NA	D0R7I0	Paenibacillus_phage	50.0	1.4e-11
WP_086402468.1|5119705_5119918_-	hypothetical protein	NA	A0A068EMC2	Bacillus_phage	90.7	1.4e-23
WP_086411985.1|5119939_5120344_-	hypothetical protein	NA	Q5YA89	Bacillus_phage	36.8	1.8e-11
WP_086411350.1|5120714_5121944_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086411355.1|5122120_5122339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016098383.1|5122374_5122539_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
WP_000436951.1|5122610_5122877_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_016098382.1|5122918_5123731_-	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	99.6	1.0e-154
WP_086402972.1|5123693_5124710_-	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	96.4	1.7e-183
WP_086402971.1|5124952_5125600_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	94.9	9.5e-111
WP_086402892.1|5125932_5126247_-	hypothetical protein	NA	H0USU0	Bacillus_phage	91.2	1.1e-43
WP_086402891.1|5126409_5127171_-	ORF6C domain-containing protein	NA	A0A0S2GLP8	Bacillus_phage	72.1	2.1e-96
WP_172448378.1|5127208_5127364_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	94.1	1.3e-21
WP_086402890.1|5127387_5127576_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	96.8	3.6e-26
WP_086402889.1|5127626_5127854_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	71.8	2.6e-23
WP_086402894.1|5128004_5128367_+	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	82.6	2.1e-46
WP_086402893.1|5128732_5129983_-	hypothetical protein	NA	W8CYT9	Bacillus_phage	81.1	5.2e-190
WP_086402888.1|5130572_5131634_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	79.6	1.8e-162
WP_000761976.1|5131695_5132436_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557264.1|5132597_5132831_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078309.1|5132925_5133618_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5133614_5133983_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
5134277:5134296	attR	TGATTATTAGCCCTCACCAA	NA	NA	NA	NA
>prophage 24
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	5144622	5193747	5585577	head,terminase,tail,transposase,protease,holin,capsid,integrase,portal	Bacillus_phage(46.15%)	64	5144319:5144339	5189146:5189166
5144319:5144339	attL	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_086402580.1|5144622_5145441_+	helix-turn-helix domain-containing protein	NA	A0A1C8EA76	Bacillus_phage	88.7	2.8e-131
WP_000100788.1|5145458_5145749_-	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_086412149.1|5145773_5145992_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000119478.1|5146131_5146455_+	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	62.7	1.9e-27
WP_153579224.1|5146665_5147382_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	93.3	1.5e-85
WP_016099116.1|5147381_5147807_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.2	8.3e-71
WP_086385679.1|5147841_5148222_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	79.2	2.3e-48
WP_062804561.1|5148394_5149831_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174402569.1|5149943_5155247_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	43.4	0.0e+00
WP_086412727.1|5155243_5156707_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	58.4	3.6e-166
WP_086412539.1|5159419_5160634_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	74.6	3.1e-155
WP_086412417.1|5160864_5161227_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	6.8e-42
WP_086412416.1|5161233_5161827_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.8	1.8e-103
WP_016123345.1|5161827_5162160_-	hypothetical protein	NA	D2XR22	Bacillus_phage	88.2	1.2e-48
WP_000997561.1|5162156_5162501_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	94.7	3.0e-55
WP_001247292.1|5162502_5162868_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	93.4	7.6e-57
WP_000450787.1|5162869_5163169_-	hypothetical protein	NA	D2XR19	Bacillus_phage	86.9	2.1e-41
WP_086412415.1|5163174_5164338_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.4	4.9e-198
WP_086412414.1|5164341_5165085_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	84.6	1.7e-111
WP_000499525.1|5165382_5166579_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_174402570.1|5166763_5167930_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	95.0	1.3e-203
WP_086411890.1|5167913_5169569_-|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	98.5	0.0e+00
WP_000763336.1|5169565_5169922_-	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_086411891.1|5170074_5170410_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.7	6.5e-55
WP_086411892.1|5170375_5170750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016099127.1|5170740_5170998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016099128.1|5171004_5171214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411893.1|5171334_5171556_-	hypothetical protein	NA	A0A1B1P874	Bacillus_phage	72.9	4.5e-20
WP_086411894.1|5171557_5171803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246335.1|5171978_5172161_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	2.7e-15
WP_086402601.1|5172212_5172632_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	95.7	7.9e-74
WP_086402602.1|5172992_5173502_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J8J4	uncultured_Caudovirales_phage	82.8	5.1e-59
WP_086411698.1|5173638_5173962_-	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	84.1	8.0e-50
WP_033699649.1|5173958_5174486_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	93.7	1.5e-90
WP_170924501.1|5174522_5174672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086411697.1|5174713_5175007_-	hypothetical protein	NA	A0A1B1P8C3	Bacillus_phage	58.8	4.9e-22
WP_086411696.1|5175046_5176027_-	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.8	2.9e-119
WP_086411695.1|5176070_5176655_-	hypothetical protein	NA	A0A219UQR9	Bacillus_phage	34.6	1.7e-10
WP_086411350.1|5177025_5178255_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086412108.1|5178423_5178642_-	DUF3797 domain-containing protein	NA	NA	NA	NA	NA
WP_061663806.1|5178638_5178977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412107.1|5179061_5179838_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	97.7	3.8e-138
WP_174402571.1|5179839_5179980_-	hypothetical protein	NA	A0A1C8E9B6	Bacillus_phage	76.1	5.3e-11
WP_086412106.1|5179999_5180536_-	dUTP diphosphatase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	91.6	1.5e-90
WP_086412105.1|5180660_5181095_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	96.5	2.7e-77
WP_016099141.1|5181133_5181682_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	62.0	1.7e-55
WP_000139235.1|5181705_5181936_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_086412111.1|5181928_5182408_-	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	95.6	1.1e-82
WP_016099143.1|5182419_5183334_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	99.0	1.8e-139
WP_016099144.1|5183427_5183769_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	1.7e-50
WP_033669560.1|5183698_5183914_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_086412578.1|5183913_5184627_-	hypothetical protein	NA	A0A1C8EA84	Bacillus_phage	99.2	2.1e-127
WP_000453491.1|5184645_5185080_-	hypothetical protein	NA	A0A1C8E9A2	Bacillus_phage	99.3	3.7e-74
WP_001186272.1|5185106_5185295_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_086402612.1|5185306_5186062_-	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	87.0	2.2e-114
WP_172448344.1|5186076_5186232_-	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	90.0	3.8e-18
WP_000410023.1|5186309_5186543_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|5186578_5186809_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086402613.1|5186973_5187366_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	2.5e-13
WP_001037137.1|5187376_5187844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086402614.1|5187874_5189011_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	47.7	1.5e-95
WP_086412833.1|5189646_5189871_-	hypothetical protein	NA	NA	NA	NA	NA
5189146:5189166	attR	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_086412832.1|5189863_5190241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412831.1|5190387_5193747_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	47.5	5.6e-05
>prophage 25
NZ_CP050183	Bacillus thuringiensis strain HER1410 chromosome, complete genome	5585577	5517750	5553250	5585577	transposase,holin	Tupanvirus(15.38%)	27	NA	NA
WP_062804561.1|5517750_5519187_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086412012.1|5521952_5522891_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	42.3	6.3e-63
WP_000055410.1|5523046_5524600_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.9	6.6e-49
WP_000659648.1|5524651_5525527_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086412011.1|5525667_5528784_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.1	6.9e-74
WP_086412010.1|5528812_5529778_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_001166010.1|5529869_5530913_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016123911.1|5531235_5531928_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_086412009.1|5531963_5532395_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_000921842.1|5532527_5533268_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000933561.1|5533245_5535015_-	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	30.6	1.7e-64
WP_001103412.1|5535341_5536640_+	MFS transporter	NA	NA	NA	NA	NA
WP_016123913.1|5536692_5538261_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.2	2.4e-14
WP_000047627.1|5538622_5539693_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000094037.1|5539910_5540537_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	2.6e-57
WP_103597579.1|5540625_5541513_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000542569.1|5541612_5542203_-	acetamide transporter	NA	NA	NA	NA	NA
WP_000996540.1|5542648_5543665_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.6	3.6e-96
WP_000995363.1|5543849_5544497_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000427879.1|5544661_5545222_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000039350.1|5545262_5546708_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.4	4.5e-60
WP_000432447.1|5547182_5548166_+	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	3.4e-160
WP_086412008.1|5548301_5550119_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.0	2.2e-120
WP_174402573.1|5550180_5550390_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000798699.1|5550470_5551223_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|5551212_5552508_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_174402574.1|5552587_5553250_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.9	4.2e-29
>prophage 1
NZ_CP050184	Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence	368179	110917	190412	368179	integrase,transposase	Bacillus_phage(33.33%)	56	189228:189243	190840:190855
WP_174402583.1|110917_112036_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	6.4e-171
WP_000524427.1|112527_112863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088950.1|113122_113497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412575.1|114265_115393_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_047387432.1|116478_117987_-	spore germination protein	NA	NA	NA	NA	NA
WP_001204220.1|118845_119889_-	Fic family protein	NA	NA	NA	NA	NA
WP_086412572.1|121279_122656_+	lytic polysaccharide monooxygenase	NA	G1FGA4	Mycobacterium_phage	39.2	1.0e-08
WP_086412571.1|123220_124636_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_061662966.1|125019_125589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412576.1|126552_127044_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000275580.1|127283_128579_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|128568_129321_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_061664233.1|129565_129826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061664234.1|130176_130368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411943.1|130863_132096_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	3.6e-18
WP_086411942.1|132100_132793_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_086411941.1|133501_134302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065230008.1|134323_135037_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	7.9e-34
WP_086411940.1|135033_137502_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_086411939.1|138076_138397_-	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	40.9	9.4e-11
WP_086411938.1|139117_140245_+	copper amine oxidase	NA	NA	NA	NA	NA
WP_086411937.1|140463_141045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187351.1|141155_142409_-	MFS transporter	NA	NA	NA	NA	NA
WP_086411936.1|143363_145448_+	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_086411935.1|145626_146949_+	esterase	NA	NA	NA	NA	NA
WP_086411934.1|146976_148065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411933.1|148230_148548_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_086411932.1|148586_149939_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_174402584.1|150121_150529_-	DoxX family protein	NA	NA	NA	NA	NA
WP_086411930.1|150653_151415_-	hydralysin-2	NA	NA	NA	NA	NA
WP_086411929.1|152689_152881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411927.1|154834_156328_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	41.0	1.1e-82
WP_086411926.1|156698_156890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103597412.1|158816_160199_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001250593.1|160714_160906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411369.1|161636_162782_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.7	5.2e-43
WP_174402552.1|163265_164428_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.1	7.9e-39
WP_086411792.1|164784_165402_+	ATP F0F1 synthase subunit alpha	NA	NA	NA	NA	NA
WP_053512377.1|166537_166786_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
WP_053512376.1|167093_167342_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
WP_174402585.1|167650_167899_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
WP_086412513.1|168137_168386_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
WP_174402586.1|168550_171622_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_086412515.1|172069_172993_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.3	1.7e-36
WP_086412516.1|172985_173732_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053512393.1|173744_174455_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086412517.1|175080_177297_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	1.1e-49
WP_174402587.1|177289_178678_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_086412519.1|178909_179356_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086412520.1|180152_180959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412521.1|181972_183049_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000798699.1|183772_184525_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|184514_185810_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_086411876.1|186656_187103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411877.1|187788_189006_-	hypothetical protein	NA	NA	NA	NA	NA
189228:189243	attL	TAAATTTGATAAAATA	NA	NA	NA	NA
WP_153579093.1|189965_190412_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	5.3e-20
WP_153579093.1|189965_190412_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	5.3e-20
190840:190855	attR	TATTTTATCAAATTTA	NA	NA	NA	NA
>prophage 2
NZ_CP050184	Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence	368179	202603	240930	368179	integrase,transposase,protease	Bacillus_phage(75.0%)	32	192972:192987	225800:225815
192972:192987	attL	TAATTCTTTATAGATT	NA	NA	NA	NA
WP_062804561.1|202603_204040_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_140159407.1|204280_204613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001056973.1|205151_206582_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086403163.1|206866_207277_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|207425_208856_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001056973.1|209121_210552_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086412715.1|211227_211416_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000788719.1|211438_211774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710778.1|212135_212795_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086412725.1|212805_213774_+	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_086412716.1|214070_214346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255396.1|214413_214608_-	YuzF family protein	NA	NA	NA	NA	NA
WP_000337607.1|215286_216273_-	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	31.4	3.3e-30
WP_065845740.1|217462_218413_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000737862.1|218780_219227_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033667260.1|219887_220496_-	Fic family protein	NA	NA	NA	NA	NA
WP_000331757.1|220476_220665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372880.1|220834_221275_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000193984.1|221425_222721_+	amino acid permease	NA	NA	NA	NA	NA
WP_086412717.1|223032_224205_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	1.2e-05
WP_000189827.1|224608_225610_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000950361.1|226276_226615_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
225800:225815	attR	TAATTCTTTATAGATT	NA	NA	NA	NA
WP_086412718.1|226724_227198_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_086412719.1|227935_228400_-	RidA family protein	NA	NA	NA	NA	NA
WP_086412720.1|228418_229195_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_000472449.1|229251_229671_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_086412721.1|230037_231516_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001068972.1|233849_234056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412722.1|236118_236739_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_086412723.1|236758_237523_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_174402588.1|238170_239289_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.1	1.2e-169
WP_103597490.1|239576_240930_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	2.1e-128
>prophage 3
NZ_CP050184	Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence	368179	254960	335587	368179	transposase,protease	Streptococcus_phage(25.0%)	53	NA	NA
WP_086411350.1|254960_256190_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086412537.1|256454_258809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174402589.1|258931_260356_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_001181729.1|260554_260950_-	DUF4320 family protein	NA	NA	NA	NA	NA
WP_086412662.1|260974_261424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412661.1|261439_262933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412660.1|262965_263913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572539.1|266475_267216_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086412659.1|267250_268705_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001006726.1|268709_269132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|270148_270901_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|270890_272186_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_001291941.1|273033_274311_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_080019643.1|274418_274892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411871.1|274909_276055_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001245659.1|276655_278479_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.4	1.7e-24
WP_086411872.1|279445_281236_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.5	1.1e-34
WP_076776018.1|281301_281571_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_086411330.1|284958_286833_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.3	1.2e-36
WP_016090246.1|287065_288766_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_000228952.1|289024_290008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804561.1|290872_292309_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002083359.1|292830_293118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086411350.1|293284_294514_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000633825.1|295184_295469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087874946.1|295533_296693_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000589633.1|297436_297559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153579183.1|298615_300325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412588.1|301335_303015_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086412589.1|303642_304962_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_086412590.1|305023_306253_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_001063467.1|306284_307418_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_153579181.1|308894_310604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369380.1|312515_314213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412289.1|314374_314842_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000688774.1|315195_316845_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	24.1	1.6e-08
WP_000822911.1|317055_317403_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	37.0	7.8e-11
WP_000577224.1|317740_318148_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000787540.1|318137_318551_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_086412290.1|318967_319378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074790503.1|320094_320574_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_086412291.1|321541_323284_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.6	2.6e-06
WP_001167047.1|323450_323666_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
WP_086412292.1|323735_324155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174402590.1|324648_324810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100605.1|325005_326100_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.3	8.0e-94
WP_086411350.1|326528_327758_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_046945696.1|328169_328331_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_086412243.1|328449_329208_-	protein TolA	NA	NA	NA	NA	NA
WP_000823375.1|329520_329904_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_086412242.1|330369_331116_+	zeta toxin family protein	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	40.7	7.5e-35
WP_062804561.1|331782_333219_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_086411350.1|334357_335587_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
>prophage 4
NZ_CP050184	Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence	368179	349472	359897	368179	transposase,holin	Bacillus_phage(76.92%)	13	NA	NA
WP_000673778.1|349472_349901_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	7.3e-35
WP_000579788.1|349923_350352_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_000527101.1|350488_350725_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	9.7e-13
WP_086411689.1|350797_351694_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	65.2	5.1e-78
WP_000460733.1|351796_352183_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_086411690.1|352420_353407_+	lysozyme family protein	NA	A0A218KCJ1	Bacillus_phage	47.5	3.2e-33
WP_086411691.1|353529_354372_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	1.1e-31
WP_086411692.1|354647_355544_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	51.8	6.0e-79
WP_000377825.1|355613_355850_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	84.6	3.0e-14
WP_076775817.1|355849_356089_+|holin	holin	holin	A0A0A7AR38	Bacillus_phage	77.2	1.6e-26
WP_086411693.1|356085_357141_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	72.4	6.9e-151
WP_000275580.1|357859_359155_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|359144_359897_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
>prophage 1
NZ_CP050185	Bacillus thuringiensis strain HER1410 plasmid pLUSID2, complete sequence	155569	46204	126953	155569	transposase,holin,integrase,portal,terminase,protease,capsid,coat,tail,tRNA,head	Bacillus_phage(41.46%)	77	45843:45902	125362:127104
45843:45902	attL	CTCCTCGTATATTAATATTTAAGCCCTATCTCAGGCTTAGTTTTACTCTCTAATAAGAGT	NA	NA	NA	NA
WP_086411350.1|46204_47434_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_086411525.1|47716_48400_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001081906.1|48556_49246_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000113953.1|49447_50410_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000503412.1|50447_51863_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_000930291.1|51962_52961_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	25.5	1.0e-15
WP_000682331.1|52991_54224_-	arginine deiminase	NA	NA	NA	NA	NA
WP_086411524.1|54492_54942_-	arginine repressor	NA	NA	NA	NA	NA
WP_086411350.1|55312_56542_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
WP_000410233.1|56821_58114_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.7	9.1e-12
WP_086412116.1|58324_59026_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.5e-32
WP_086412115.1|59169_59964_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_116269189.1|60007_60763_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000661226.1|60816_61902_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_062804561.1|63250_64687_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_033695443.1|65824_67126_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_086412249.1|67139_67922_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.5	2.4e-44
WP_006926177.1|68033_69143_-	ATPase	NA	NA	NA	NA	NA
WP_086412250.1|69490_70123_+	cyclase family protein	NA	NA	NA	NA	NA
WP_000424116.1|70151_70532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412251.1|70761_71988_-	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.3	9.5e-11
WP_000434716.1|72125_73391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004284.1|73629_74298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000432509.1|74460_74910_-|coat	spore coat protein B	coat	NA	NA	NA	NA
WP_000051525.1|74930_75446_-|coat	spore coat protein B	coat	NA	NA	NA	NA
WP_002025240.1|75681_75921_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000235476.1|76107_76476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412253.1|76671_77721_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	28.0	3.4e-17
WP_086412254.1|78054_78975_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002025239.1|79023_80064_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000983753.1|80060_81068_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000926554.1|81112_81754_-	L-fuculose-phosphate aldolase	NA	A0A077SK32	Escherichia_phage	30.5	2.8e-14
WP_086385321.1|81807_82854_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_086412255.1|82863_84093_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_000924420.1|84679_85243_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_086412256.1|85257_86784_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.3	1.1e-37
WP_001005627.1|86818_87424_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000853516.1|87658_88774_-	M20 peptidase aminoacylase family protein	NA	NA	NA	NA	NA
WP_086412257.1|89067_90489_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_000972797.1|90477_91749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086412258.1|91842_92952_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_086412259.1|92966_93662_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078438914.1|93963_94671_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_086412260.1|94766_95285_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	35.9	3.6e-20
WP_000566710.1|95636_96626_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_103597693.1|97222_97933_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	93.3	2.3e-86
WP_059303816.1|97949_98180_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	96.1	3.7e-33
WP_000499525.1|98475_99672_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_001115042.1|99898_100138_-	hemolysin XhlA family protein	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_140159416.1|100154_101114_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.3	3.6e-175
WP_086412551.1|101213_101588_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	70.8	4.1e-42
WP_086412549.1|101599_105964_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	53.4	0.0e+00
WP_103597478.1|105960_107418_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	58.5	1.6e-169
WP_086411983.1|107457_112455_-|tail	phage tail tape measure protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	79.0	0.0e+00
WP_086411982.1|112619_112994_-	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	85.1	1.5e-52
WP_086411981.1|113050_113635_-|tail	phage tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.8	1.5e-99
WP_086411980.1|113650_114013_-	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.0	7.1e-55
WP_086411979.1|114009_114447_-	HK97 gp10 family phage protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	92.4	2.4e-73
WP_001182260.1|114434_114809_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_000536353.1|114810_115104_-	hypothetical protein	NA	D2XR19	Bacillus_phage	83.5	6.8e-40
WP_000234879.1|115109_116264_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	97.7	1.1e-213
WP_086411978.1|116267_117056_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	61.5	6.7e-58
WP_086411977.1|117039_118206_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	92.4	1.2e-199
WP_086411976.1|118210_119869_-|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	80.4	2.9e-260
WP_086390825.1|119865_120201_-	hypothetical protein	NA	E2ELI1	Clostridium_phage	35.6	3.4e-11
WP_086411975.1|120351_120687_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	90.1	8.0e-53
WP_033669590.1|120652_120967_-	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	60.0	3.0e-09
WP_086411974.1|120980_121199_-	hypothetical protein	NA	A0A288WG15	Bacillus_phage	48.1	1.5e-07
WP_086411973.1|122319_122862_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	2.9e-89
WP_086411972.1|122861_123344_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	76.9	1.4e-66
WP_086411971.1|123371_123542_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	75.0	6.1e-09
WP_086411970.1|123653_123776_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_086411969.1|123787_124138_-	hypothetical protein	NA	A0A218KDG0	Bacillus_phage	50.4	1.9e-25
WP_086411968.1|124166_124448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086402466.1|124725_124917_-	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	59.3	1.2e-10
WP_086411531.1|124949_125354_-	hypothetical protein	NA	W8EIC5	Pseudomonas_phage	45.3	4.4e-21
WP_086411350.1|125723_126953_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	2.2e-84
125362:127104	attR	CTCCTCGTATATTAATATTTAAGCCCTATCTCAGGCTTAGTTTTACTCTCTAATAAGAGTCCAGTAATAAAGAAAATACTTGGACGTCTCAAGATATTTCTAGATAATGGTCTTAGGATCATTTGGGACAATTCTGCATTCCCCTGTGGATTTACCACACGAAAAGAGTGTTTCTCAGTGAACGCGCGGGGCTCCCTACTCGCAGGCTGAGCAGCCTGATCCTCGAACCTAGATGTTAGTAGCTCTAGGGCGGCTTTCGATTCAGGACTAGCTCTTATACACGAGGTTGTTGGTCGGCGTACACACTAGAGATATCTCGAGACGTCCAAGCAATGATTCTAAATCGAAAGGAGGTCTCTTACGTGAGATTATTTGTTGGTCTAGATGTAAGTTCGTTTGATATGAAAGTTTGCTTTTTGAATGGTGAAGGAGAAAAGCTAGATTCTTTTTCAGTCAGTAATGACTTACCAGGTGCACAGGTGCTTAAAGAACGATTATTACAGTGTACAACCAATCAAGAGGTTGAAATTTTAAAAATCGGCTTAGAATCTACATCTGTTTATAGTTTTCACCCATCCATGTTTCTCCACCATGACGAAGACTTAAAAAGATTTGGCACAAAGGTATTTCTTCTAAATCCAAAACAAGTCGCAAACTTCAAGAAAAGTTATTCAGACATGAATAAGACTGACGAAATTGATGCCTTTGTCATCGCTGATTACTTACGATTTGGGCGAAATCAAATGTCCATCGTGAAAGAAAGTCAATACGTGGCATTACAGCAATTAACAAGATCTCGTTATCAACTCGTTAGAATGTTGACAAAGGAGAAGCAACATTTTCTACAACACCTAAGTTATAAATGTAATACGTTCTCACAAAAAGTCGATTCTTCTATATTTGGTAACGCCATGATGGAATTGTTCCTTGAAAAATTCAGTCTAGAAGAGCTAGCTGACATGCCTTTAGAGGAACTCGCTGAGTTCCTACAGGAAAAGAGTAAAAACCGATTTGGTGACCCGAAATGTGTCGCATCAACCATTCAAAAGGCTGTTCGCACGTCGTACCGTTTAGATAAGGTGGTAGAAGACTCAATCGATATTCTTTTAGGAACATCAATCGAAATCATTCGTACCTATCAAAAACAAATTAAAGAACTAGAAAAATCTATTAAGCGGATCATGGCTGGATTAACGCAAACATTAGAATCCATTCCTGGAATCGGACCTATATATGCCGCTGGTATTATCGCTGAAATTGGCCAAATCGAAAGATTTGACGATGAAACCAAAATCGCAAAGTATGCCGGGTTATATTGGCGTACATACCAGTCTGGCCGGTTCACTGCTGAAAATACTTCATTATCTCGTAATGGGAATCATTACTTGCGGTATTACTTAGTTGAAGCCGCCAACTCTGTAAGGAAGCATGTATTGGAATACCAAGAATATTACGCAAAAAAGTATAATGAAGTACCAAAACATCAACACAAACGTGCACTCGTTCTAACCGCAAGAAAATTTGTGCGATTGGTGGATGCGCTACTACGTAATCACCAACTCTTTACGCCTGAAAGGTGTGTGAAAGTGTGACATAAAACCTGTCATCGCTACCTTTCAATAAATTCCAGTATTTTACATAAAATACTGGTCTAGTTTCGTGATGTCTTTTTTAAGCAATTTGTCCTTTGATAACTTCAAAAGATATTATTTTTCAGTTGACATACTACCGCAGGTCTTTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP050186	Bacillus thuringiensis strain HER1410 plasmid pLUSID3, complete sequence	38150	55	30036	38150	protease,capsid,terminase,head,tail,portal	Bacillus_phage(37.14%)	43	NA	NA
WP_086412617.1|55_1459_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	2.4e-114
WP_000289676.1|1571_1790_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086412616.1|1805_2489_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	33.9	3.5e-23
WP_016097902.1|2639_2912_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174402596.1|2977_3133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412615.1|3205_3406_+	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	75.0	1.4e-12
WP_086412614.1|3420_3771_+	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	81.0	4.3e-49
WP_086412613.1|3791_4439_+	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	78.1	5.8e-92
WP_001262629.1|4675_4873_+	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	100.0	5.6e-30
WP_086412612.1|4869_5220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412611.1|5219_5537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080336255.1|5484_5685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990505.1|5686_5878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412610.1|5883_6555_+	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	91.0	1.3e-115
WP_086412609.1|6575_7049_+	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	93.0	7.0e-79
WP_086412608.1|7120_9475_+	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	86.8	0.0e+00
WP_086412607.1|9755_9998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086412623.1|9994_10423_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	86.6	1.4e-70
WP_086412606.1|10425_10833_+	hypothetical protein	NA	A0A0K1LKF1	Vibrio_phage	38.9	9.2e-11
WP_086412605.1|10829_11369_+	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	53.1	1.8e-46
WP_086412604.1|11442_11880_+	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	95.9	1.0e-71
WP_086412603.1|12261_12552_+	hypothetical protein	NA	A0A2H4J820	uncultured_Caudovirales_phage	78.1	8.5e-35
WP_086412602.1|12731_13127_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	85.5	1.6e-55
WP_079246249.1|13392_13596_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.0e-22
WP_086412601.1|13636_13978_+	hypothetical protein	NA	A0A1C8E9B7	Bacillus_phage	92.0	2.3e-55
WP_086412600.1|14096_14378_+	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	84.2	1.1e-36
WP_000872542.1|14374_14740_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	9.0e-42
WP_000101699.1|14861_15296_+	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	95.1	8.7e-68
WP_042596409.1|15292_17017_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	96.7	0.0e+00
WP_086412599.1|17032_18238_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	94.8	1.4e-216
WP_001140505.1|18206_18785_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	82.5	4.2e-86
WP_079245190.1|18786_20160_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	77.2	5.3e-151
WP_000998745.1|20163_20424_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	93.0	1.3e-39
WP_140159420.1|20404_20734_+|head,tail	head-tail adaptor protein	head,tail	A0A1B0T691	Bacillus_phage	99.1	4.9e-55
WP_086412597.1|20723_21053_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	98.2	5.8e-56
WP_086412596.1|21052_21430_+	HK97 gp10 family phage protein	NA	A0A1B1P7P3	Bacillus_phage	99.2	6.6e-64
WP_000215488.1|21441_22077_+	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	98.1	6.3e-115
WP_087875877.1|22088_22475_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	98.4	2.8e-65
WP_000383691.1|22513_22702_+	hypothetical protein	NA	A0A1B0T6A1	Bacillus_phage	100.0	1.6e-31
WP_086412395.1|22718_26000_+|tail	phage tail tape measure protein	tail	A0A1B2APW4	Phage_Wrath	80.6	5.5e-239
WP_086412394.1|26000_26720_+|tail	phage tail protein	tail	A0A1B2APY0	Phage_Wrath	76.2	1.7e-105
WP_086412393.1|26720_28244_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	64.4	8.6e-179
WP_086412392.1|28230_30036_+	hypothetical protein	NA	A0A1B2APZ7	Phage_Wrath	39.4	1.4e-10
