The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046161	Ruminococcaceae bacterium LAM 19011 chromosome, complete genome	1880178	87965	97579	1880178	tRNA	Staphylococcus_phage(50.0%)	7	NA	NA
WP_086035926.1|87965_89660_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.8	5.1e-180
WP_174402975.1|90101_91190_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.5	4.8e-46
WP_086035928.1|91189_91840_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	2.2e-38
WP_086035929.1|91843_93043_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.1	1.1e-99
WP_086035930.1|93097_93565_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.0	2.6e-41
WP_174193044.1|93659_94979_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_086035932.1|95230_97579_+	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	23.4	1.6e-22
>prophage 2
NZ_CP046161	Ruminococcaceae bacterium LAM 19011 chromosome, complete genome	1880178	603559	664324	1880178	tail,head,holin,transposase,tRNA,protease,portal	Erysipelothrix_phage(21.05%)	52	NA	NA
WP_086036585.1|603559_604060_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_174193637.1|604256_605444_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_174192772.1|605566_606337_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_086036588.1|606388_607903_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_086036589.1|608068_608545_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_157658992.1|608578_609577_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_086036591.1|609719_610262_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.6	2.9e-12
WP_086036592.1|610366_611713_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_086036902.1|612098_615623_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_174403208.1|615962_617552_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	8.6e-12
WP_086036593.1|617686_619552_-	serine hydrolase	NA	NA	NA	NA	NA
WP_086036594.1|619548_619989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086036595.1|620070_621366_-	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	45.2	6.5e-18
WP_174403042.1|621389_622562_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_086036597.1|622617_623751_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.2	2.2e-25
WP_086036598.1|623862_625008_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_174403043.1|625265_626744_+	VanW family protein	NA	NA	NA	NA	NA
WP_174192766.1|626896_627883_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_086036601.1|628028_629996_+	NAD(+) synthase	NA	NA	NA	NA	NA
WP_086036602.1|630070_630508_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_086036603.1|630538_631567_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_086036604.1|631618_633163_-	phosphomannomutase/phosphoglucomutase	NA	NA	NA	NA	NA
WP_086036605.1|633447_633717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086036606.1|633781_634732_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	41.5	8.9e-57
WP_174403044.1|634809_636285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174193633.1|636476_637472_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_086036609.1|637638_638265_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_086036610.1|638327_640934_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	38.6	7.9e-63
WP_086036611.1|640955_641789_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_086036612.1|641785_642268_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_174192764.1|642354_643017_+	helix-turn-helix domain-containing protein	NA	Q6J1N3	Burkholderia_virus	34.7	6.5e-06
WP_174403045.1|643040_644054_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	1.0e-66
WP_086036614.1|644179_645949_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_086036615.1|646075_646792_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_086036616.1|646861_647566_+	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	44.7	3.9e-09
WP_157658993.1|647721_649383_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086036618.1|649548_650577_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_086036619.1|650644_652759_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	47.9	2.4e-09
WP_086036620.1|652948_653809_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_174403046.1|654593_655661_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	60.8	5.3e-90
WP_174403047.1|655675_656491_+|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	65.7	2.0e-65
WP_086036621.1|656393_657257_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	66.1	6.4e-62
WP_174192689.1|658508_658784_+|head,tail	phage head-tail connector protein	head,tail	A0A1B0RXE3	Streptococcus_phage	42.9	4.7e-11
WP_174403048.1|658795_659155_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_174403049.1|659233_659647_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.9	1.7e-49
WP_174403050.1|659854_660061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174403051.1|660112_660511_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	66.7	6.2e-44
WP_086036628.1|660621_661581_-	site-specific DNA-methyltransferase	NA	A0A1C9C5F8	Heterosigma_akashiwo_virus	32.5	8.5e-31
WP_086036629.1|661565_662330_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_086036630.1|662339_662549_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	38.2	8.9e-10
WP_086036631.1|662649_662901_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_174403209.1|662917_664324_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	57.1	4.4e-145
>prophage 3
NZ_CP046161	Ruminococcaceae bacterium LAM 19011 chromosome, complete genome	1880178	738718	811060	1880178	tail,head,holin,capsid,tRNA,protease,portal	Streptococcus_phage(33.33%)	61	NA	NA
WP_086036732.1|738718_739819_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_086036733.1|739923_741201_-	chloride channel protein	NA	NA	NA	NA	NA
WP_174193593.1|741242_741785_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086036735.1|742117_743818_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	41.0	3.9e-111
WP_086036736.1|743904_744372_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_086036737.1|744450_744663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086036738.1|744666_745041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174403059.1|745070_745466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086036740.1|745473_746724_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.1	2.3e-108
WP_086036741.1|746769_747576_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.6	4.2e-47
WP_086036742.1|747724_747946_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_086036743.1|748001_750173_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_086036744.1|750361_750625_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_157659004.1|750749_751676_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_086036746.1|751644_752583_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_174403060.1|752579_753536_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	G3MA01	Bacillus_virus	26.0	2.3e-20
WP_086036748.1|753516_753885_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_086036749.1|753996_756444_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.3	3.1e-21
WP_086036750.1|756465_756774_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_157659013.1|756760_757042_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
WP_086036752.1|757150_758269_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_086036753.1|758255_758759_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_174193601.1|758906_759446_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	66.7	1.6e-10
WP_086036755.1|759577_760216_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_086036756.1|760430_760790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086036757.1|761014_762235_-	G5 domain-containing protein	NA	F8WPX7	Bacillus_phage	41.2	7.5e-08
WP_086036758.1|763030_763432_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_086036759.1|763452_763881_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_174403061.1|764129_764423_-	DUF1284 domain-containing protein	NA	NA	NA	NA	NA
WP_086036761.1|764505_765075_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_086036762.1|765185_765398_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_086036763.1|765528_766542_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_157658886.1|772093_773332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086035083.1|773485_775624_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_086035082.1|775854_777042_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_086035081.1|777451_778471_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_174403062.1|778590_779751_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_174403063.1|779801_782432_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.6	2.4e-67
WP_086035079.1|782901_783144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035078.1|783207_783372_+	rubredoxin	NA	NA	NA	NA	NA
WP_174403064.1|783645_783807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035076.1|784115_784850_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_174193536.1|784828_786505_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	3.5e-16
WP_157658884.1|786432_787332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174403065.1|787606_792712_-	alpha-glucosidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_174403066.1|793118_793517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086035071.1|793916_794627_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_086035070.1|794698_796363_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_086035069.1|796355_798347_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_174403067.1|798862_800341_+	Lsa family ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	27.5	8.8e-27
WP_086035067.1|800455_801448_-	serine hydrolase	NA	NA	NA	NA	NA
WP_174403068.1|801623_802319_+|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	65.7	1.3e-65
WP_086036621.1|802221_803085_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	66.1	6.4e-62
WP_174403069.1|803100_804297_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	49.6	2.3e-102
WP_086036623.1|804337_804613_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXK2	Streptococcus_phage	42.9	3.1e-10
WP_086036624.1|804624_804984_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_086036625.1|805052_805466_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.9	2.3e-49
WP_174403070.1|805673_805880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174403071.1|805931_807491_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	51.9	1.3e-142
WP_174403072.1|807911_809480_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	56.3	2.2e-161
WP_174403073.1|809944_811060_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	40.3	3.0e-35
>prophage 4
NZ_CP046161	Ruminococcaceae bacterium LAM 19011 chromosome, complete genome	1880178	1345148	1404260	1880178	tail,terminase,transposase,integrase,tRNA,portal	Bacillus_phage(19.05%)	59	1384085:1384107	1397974:1397996
WP_174403137.1|1345148_1346573_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_174193411.1|1346742_1347324_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_086036818.1|1347591_1348425_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	35.8	4.5e-28
WP_086035342.1|1348545_1349385_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	29.1	1.2e-20
WP_174193696.1|1349475_1350552_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_086035343.1|1350636_1351161_-	spore maturation protein	NA	NA	NA	NA	NA
WP_086035344.1|1351153_1351738_-	spore maturation protein A	NA	NA	NA	NA	NA
WP_086035345.1|1351911_1352175_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	44.7	8.8e-15
WP_086035346.1|1352297_1352483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157658896.1|1352578_1353346_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_086035348.1|1353622_1354840_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_174193409.1|1354864_1355692_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_174193408.1|1355706_1356495_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_086035351.1|1356699_1356903_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_086035352.1|1356981_1358070_+	peptide chain release factor 1	NA	A0A2I2MPK0	Mycobacterium_phage	45.9	2.5e-07
WP_086035353.1|1358104_1359124_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	37.8	5.8e-46
WP_086035354.1|1359116_1359719_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_157658897.1|1359715_1360384_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	39.9	3.1e-16
WP_086035356.1|1360414_1361824_+	aminopeptidase	NA	NA	NA	NA	NA
WP_086035357.1|1361869_1363054_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_086035358.1|1363125_1363533_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_086035359.1|1363529_1363967_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_174193406.1|1364236_1364917_+	response regulator	NA	W8CYM9	Bacillus_phage	42.0	4.9e-41
WP_086035361.1|1364861_1366454_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.9	4.3e-19
WP_174403138.1|1366450_1367410_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_174403139.1|1367588_1368422_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_157658898.1|1368496_1369438_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_174403140.1|1369535_1370891_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.9	1.3e-13
WP_086035366.1|1370862_1371618_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	1.9e-33
WP_174193403.1|1371961_1374094_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_086035368.1|1374137_1376579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035369.1|1376772_1377144_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_086035370.1|1377127_1377571_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_086035371.1|1377563_1378211_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A0RV91	Bacillus_phage	32.3	1.2e-25
1384085:1384107	attL	GATGCAAGTCAGATGCAAGTCAA	NA	NA	NA	NA
WP_086036820.1|1384207_1384486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174193402.1|1384612_1385800_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_086035373.1|1385845_1386469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174403141.1|1386482_1389272_-|tail	phage tail tape measure protein	tail	D9ZNE6	Clostridium_phage	54.9	1.4e-89
WP_086035375.1|1389460_1389793_-	hypothetical protein	NA	A0A1U9WR68	Streptococcus_virus	30.8	1.6e-05
WP_086035376.1|1389921_1390488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174403142.1|1390501_1390798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086035378.1|1390860_1391202_-	hypothetical protein	NA	G1JWD8	Mycobacterium_phage	34.7	6.1e-08
WP_086035379.1|1391203_1391548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086035380.1|1392702_1393281_-	phage scaffolding protein	NA	A0A1S5SA01	Streptococcus_phage	45.9	1.5e-06
WP_157658900.1|1393451_1393610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086035381.1|1393585_1395097_-	hypothetical protein	NA	A0A0A7RU06	Clostridium_phage	42.1	3.3e-61
WP_086035382.1|1395096_1396038_-|portal	phage portal protein	portal	A0A0A8WIB1	Clostridium_phage	43.6	2.2e-63
WP_086035383.1|1396041_1396566_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_086035384.1|1396570_1397386_-|terminase	PBSX family phage terminase large subunit	terminase	A0A059NT69	Lactococcus_phage	52.2	1.2e-73
WP_157658901.1|1397384_1397885_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A090EUH1	Clostridium_phage	27.9	4.9e-06
WP_157658902.1|1397992_1398286_-	hypothetical protein	NA	NA	NA	NA	NA
1397974:1397996	attR	GATGCAAGTCAGATGCAAGTCAA	NA	NA	NA	NA
WP_174403143.1|1398309_1398687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035386.1|1398641_1399349_+	hypothetical protein	NA	A0A1X9I626	Streptococcus_phage	33.1	5.7e-08
WP_086035387.1|1399350_1399551_+	hypothetical protein	NA	A0A2K9V3N9	Faecalibacterium_phage	49.1	8.8e-07
WP_157658904.1|1399757_1400264_+	DUF2213 domain-containing protein	NA	NA	NA	NA	NA
WP_086035388.1|1400484_1401345_+	class B sortase	NA	NA	NA	NA	NA
WP_086035389.1|1401409_1402099_+	starch-binding protein	NA	NA	NA	NA	NA
WP_086035390.1|1402170_1403082_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_174402966.1|1403222_1404260_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
