The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	590804	639704	4006790	terminase,tail,tRNA,portal,integrase,protease,head	Bacillus_phage(30.95%)	70	599391:599410	643449:643468
WP_013351180.1|590804_591845_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	1.2e-62
WP_174201902.1|592069_593998_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.6	6.0e-60
WP_003155986.1|594137_594650_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013351182.1|594646_595294_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003155981.1|595312_595483_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_088030482.1|595489_596251_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|596289_596481_-	YdiK family protein	NA	NA	NA	NA	NA
WP_013351184.1|596477_597212_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013351185.1|597448_597733_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	3.7e-19
WP_013351186.1|597774_599409_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
599391:599410	attL	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
WP_013351187.1|599487_600699_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	41.8	4.0e-78
WP_041481597.1|600710_601184_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013351188.1|601375_601723_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.1	5.1e-18
WP_013351189.1|601736_602258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351190.1|602525_602906_-	helix-turn-helix domain-containing protein	NA	A8ATJ9	Listeria_phage	41.2	7.8e-12
WP_041481598.1|603075_603318_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041481599.1|603330_603645_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.5	1.6e-15
WP_013351191.1|603641_604412_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.0	1.9e-73
WP_003155916.1|604521_605094_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_013351192.1|605090_605348_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.5	3.5e-08
WP_013351193.1|605344_605542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351194.1|605643_605829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351197.1|606770_607610_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	80.9	1.8e-122
WP_013351198.1|607774_608491_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	44.5	2.1e-42
WP_013351199.1|608375_609347_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.2	4.1e-57
WP_013351200.1|609343_609487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351202.1|610071_610530_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	6.0e-59
WP_013351203.1|610649_610802_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.2e-08
WP_003155894.1|610883_611087_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_013351204.1|611118_611460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351205.1|611456_611711_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	1.1e-06
WP_013351206.1|611715_613092_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.3	1.2e-142
WP_013351207.1|613103_613427_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
WP_013351208.1|613423_614023_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	38.5	6.0e-27
WP_013351209.1|614022_614385_+	hypothetical protein	NA	H6WU17	Pseudomonas_phage	65.9	1.3e-05
WP_013351210.1|614381_614657_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	5.2e-18
WP_013351211.1|614653_615067_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	53.4	1.5e-32
WP_174201903.1|615063_615618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351213.1|615610_615991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351214.1|615987_616179_+	hypothetical protein	NA	A0A217ERD8	Bacillus_phage	67.2	4.6e-13
WP_013351215.1|616224_616443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481603.1|616448_616883_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.8e-49
WP_041481604.1|617028_617406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044051884.1|617437_618025_+	VanZ family protein	NA	NA	NA	NA	NA
WP_013351217.1|618289_618805_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.8	4.0e-27
WP_164848964.1|618909_619047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|619344_619557_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_041481605.1|619690_619879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351219.1|620014_620245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351220.1|620289_621045_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	62.0	3.4e-51
WP_013351221.1|621031_622306_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	72.3	6.5e-180
WP_013351222.1|622327_623779_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	49.4	1.3e-128
WP_013351223.1|623765_624689_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	1.0e-81
WP_013351224.1|624692_624962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351225.1|625115_625781_+	phage scaffolding protein	NA	I1TLE1	Bacillus_phage	49.3	4.5e-23
WP_013351226.1|625793_626780_+	hypothetical protein	NA	D2J006	Enterococcus_phage	37.4	2.7e-48
WP_076983707.1|626757_627042_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	65.4	3.3e-23
WP_013351227.1|627042_627234_+	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013351228.1|627238_627535_+|head,tail	phage head-tail connector protein	head,tail	Q4ZBR3	Staphylococcus_phage	40.4	5.6e-10
WP_013351229.1|627531_627870_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014471518.1|627862_628279_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_013351231.1|628297_628696_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.8	2.4e-24
WP_013351232.1|628709_629222_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013351233.1|629163_629478_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	79.0	5.4e-27
WP_076983168.1|629491_629734_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_174201904.1|629790_630297_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
WP_041481705.1|630344_630653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174202060.1|630657_635733_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	27.2	1.2e-35
WP_013351236.1|635729_636494_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013351237.1|636506_639704_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	45.9	6.3e-131
643449:643468	attR	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
>prophage 2
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	684682	694575	4006790		Synechococcus_phage(50.0%)	9	NA	NA
WP_013351276.1|684682_685975_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_013351277.1|686052_686772_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.3e-47
WP_013351278.1|686771_687026_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	37.0	4.2e-06
WP_013351279.1|687022_687706_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013351280.1|687689_689918_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	7.7e-160
WP_013351281.1|689893_691324_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_013351282.1|691415_692456_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
WP_013351283.1|692452_693040_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	7.7e-27
WP_013351284.1|693036_694575_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.4	1.5e-77
>prophage 3
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	886396	962141	4006790	terminase,tail,capsid,portal,integrase,holin,plate,protease,head	Bacillus_phage(30.23%)	86	917875:917889	951170:951184
WP_013351438.1|886396_887311_-|protease	serine protease	protease	NA	NA	NA	NA
WP_003155495.1|887447_887600_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_013351439.1|887723_887993_+	YfhJ family protein	NA	NA	NA	NA	NA
WP_013351440.1|888124_888652_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_157862696.1|888637_888790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351445.1|890012_890993_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.7	1.5e-59
WP_013351446.1|891029_893615_+	YfhO family protein	NA	NA	NA	NA	NA
WP_013351447.1|893611_894595_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_013351448.1|894815_895964_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.7	1.2e-34
WP_013351449.1|896031_896496_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.0	9.1e-39
WP_013351450.1|896510_896816_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	50.5	2.0e-18
WP_013351451.1|897087_897288_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	65.6	3.3e-14
WP_014471597.1|897274_897547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471598.1|897596_897746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351453.1|897742_898024_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	41.9	8.0e-14
WP_052364749.1|898062_898323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351454.1|898313_898961_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	41.6	1.9e-34
WP_013351455.1|898973_899819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481614.1|899953_900349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351457.1|900360_901134_+	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	46.5	2.6e-38
WP_013351458.1|901126_901483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351459.1|901484_902813_+	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.4	1.2e-136
WP_041481616.1|903289_903490_+	hypothetical protein	NA	A0A1D6X868	Bacillus_phage	53.4	9.0e-12
WP_013351461.1|903486_903714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351462.1|903700_903901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351463.1|904120_904636_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	1.4e-27
WP_013351464.1|904650_905067_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	57.3	1.4e-38
WP_013351465.1|905093_905279_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	67.8	6.0e-18
WP_013351466.1|905523_906249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351467.1|906254_906833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481617.1|907332_907647_+	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	46.6	1.5e-16
WP_127721078.1|907874_908330_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBQ3	Clostridium_phage	35.2	2.4e-12
WP_013351469.1|908319_910110_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	61.1	7.7e-211
WP_013351470.1|910121_911342_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	36.8	1.3e-65
WP_045507553.1|911316_912039_+|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	65.2	1.1e-67
WP_013351472.1|912035_913241_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	49.0	4.8e-100
WP_041481618.1|913254_913569_+|head,tail	phage head-tail connector protein	head,tail	H9A116	Staphylococcus_phage	41.7	9.6e-08
WP_013351473.1|913575_913905_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_013351474.1|913901_914330_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	44.3	2.0e-08
WP_013351475.1|914326_914716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351476.1|914773_915349_+|tail	tail protein	tail	A0A1I9KKC4	Lactobacillus_phage	36.4	6.0e-24
WP_013351477.1|915424_915745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174201912.1|915927_921684_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	32.7	1.2e-15
917875:917889	attL	TTTGTTGCGAAATCA	NA	NA	NA	NA
WP_013351480.1|921686_922526_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	32.8	9.7e-31
WP_013351481.1|922535_923690_+|tail	phage tail protein	tail	A0A1W6JQ67	Staphylococcus_phage	33.6	1.9e-24
WP_013351482.1|923682_923991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721179.1|924182_924998_+	SGNH/GDSL hydrolase family protein	NA	Q4ZE16	Staphylococcus_virus	44.8	4.3e-60
WP_013351484.1|925013_926300_+|plate	BppU family phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	38.9	4.9e-82
WP_013351485.1|926300_926636_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_013351486.1|926642_926885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351487.1|926921_927137_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	2.0e-12
WP_013351488.1|927148_927415_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.5	4.4e-22
WP_013351489.1|927471_928629_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	1.9e-69
WP_013351490.1|928674_929622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471625.1|929685_930240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164463356.1|931647_931797_+	PhrK family phosphatase-inhibitory pheromone	NA	Q9ZXD2	Bacillus_phage	97.3	2.8e-10
WP_013351494.1|932135_933233_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_013351495.1|933239_933464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351496.1|933546_934299_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_013351497.1|934366_934537_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_003155476.1|934697_934964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155475.1|935099_935630_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013351498.1|935711_937454_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	9.6e-49
WP_013351499.1|937530_938595_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_013351500.1|938804_940094_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013351501.1|940250_940724_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013351502.1|940848_941286_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_013351503.1|941320_941674_-	YgzB family protein	NA	NA	NA	NA	NA
WP_013351504.1|941876_942761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351505.1|949753_950719_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	49.4	3.3e-83
WP_029974764.1|950906_951359_+	hypothetical protein	NA	NA	NA	NA	NA
951170:951184	attR	TGATTTCGCAACAAA	NA	NA	NA	NA
WP_013351506.1|951355_951805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481620.1|951820_952240_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
WP_013351507.1|952478_952802_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	33.0	6.0e-05
WP_013351508.1|953016_953352_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.0	9.9e-11
WP_041481621.1|953351_953597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721081.1|953721_953964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481622.1|953950_954319_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	47.4	1.1e-23
WP_041056591.1|955547_955727_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	68.8	1.1e-11
WP_013351512.1|955719_956499_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.8	1.6e-75
WP_013351513.1|956495_957023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351514.1|957019_957766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351515.1|957765_959160_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.7	2.2e-128
WP_174201913.1|959294_960290_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.7	7.9e-72
WP_013351517.1|960306_960546_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.2e-07
WP_013351518.1|960956_962141_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	34.7	5.0e-57
>prophage 4
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	965246	1016098	4006790	tail,portal,integrase,holin,plate	Bacillus_phage(46.67%)	67	981589:981606	993662:993679
WP_013351523.1|965246_966509_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	27.1	4.5e-24
WP_157862697.1|966674_966839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351525.1|966873_969159_+	DNA polymerase I-3'-5' exonuclease and polymerase domains	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.4	5.9e-123
WP_013351526.1|969159_969456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351527.1|969452_970511_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.3	7.3e-76
WP_013351528.1|970510_970825_+	hypothetical protein	NA	A0A0F6YQ61	Sinorhizobium_phage	42.1	1.4e-19
WP_013351529.1|970821_971385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351530.1|971385_971748_+	hypothetical protein	NA	A0A0K2D038	Bacillus_phage	32.5	6.5e-08
WP_013351531.1|971752_971998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481624.1|971994_972180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351532.1|972184_972541_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	53.4	1.6e-27
WP_127721085.1|972530_973319_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	82.8	2.9e-122
WP_013351534.1|973470_974202_+	GIY-YIG nuclease family protein	NA	A0A024FSJ1	Bacillus_phage	72.5	1.2e-72
WP_041481714.1|975714_976680_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.6	6.8e-145
WP_157670119.1|976833_976980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481625.1|976976_977540_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	1.6e-42
WP_013351538.1|977871_978567_+	FAD-dependent thymidylate synthase	NA	U5PWA7	Bacillus_virus	65.9	1.1e-83
WP_013351539.1|978593_979160_+	SPBc2 prophage-derived protein YorM	NA	A0A142F1S8	Bacillus_phage	54.9	4.1e-25
WP_052585535.1|979178_979682_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_041481628.1|979665_980589_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	44.0	1.4e-27
WP_013351541.1|980585_981158_+	dephospho-CoA kinase dephosphoCoA kinase	NA	J9Q953	Bacillus_phage	43.5	6.8e-36
WP_162145047.1|981424_982375_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	4.2e-139
981589:981606	attL	TTTCGGCGATTACGTTGA	NA	NA	NA	NA
WP_013351543.1|982347_982737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351544.1|982806_983196_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.2	8.8e-19
WP_041481631.1|983188_983677_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	47.0	4.9e-19
WP_013351546.1|983764_984565_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	9.1e-71
WP_157862698.1|984693_984855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174201914.1|984894_985707_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.5	1.0e-98
WP_041481632.1|985798_986158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351549.1|986172_986352_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_013351550.1|986482_986920_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.4	2.8e-50
WP_013351551.1|987025_987226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164848956.1|987431_987578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351553.1|987693_987924_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013351554.1|988014_988788_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	57.8	1.5e-73
WP_013351555.1|990003_990285_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	57.5	7.5e-20
WP_013351556.1|990271_990433_+	hypothetical protein	NA	R4JMM6	Bacillus_phage	86.3	5.2e-18
WP_013351557.1|990887_991178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351558.1|991375_991924_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	1.8e-38
WP_041481633.1|992006_993761_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.6	9.8e-251
993662:993679	attR	TTTCGGCGATTACGTTGA	NA	NA	NA	NA
WP_013351560.1|993777_994209_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	3.8e-31
WP_174201915.1|994211_995843_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	56.8	2.6e-165
WP_013351562.1|995842_996667_+	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	51.6	2.9e-72
WP_013351563.1|996757_997429_+	molecular chaperone ClpB	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
WP_013351564.1|997440_998544_+	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.3	2.2e-30
WP_013351566.1|998852_999071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351567.1|999084_999471_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	3.5e-20
WP_080565292.1|999486_999807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351569.1|999803_1000211_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
WP_041481634.1|1000217_1000607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351570.1|1000631_1001186_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_013351571.1|1001244_1001616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351573.1|1001948_1002557_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_013351574.1|1002805_1005031_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.7	1.8e-55
WP_013351575.1|1005034_1006459_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	43.2	2.6e-60
WP_013351576.1|1006470_1007871_+|tail	phage tail protein	tail	A0A0U4JID8	Exiguobacterium_phage	30.1	1.4e-34
WP_013351577.1|1007885_1010450_+	peptidase G2	NA	D6R401	Bacillus_phage	74.1	0.0e+00
WP_157862700.1|1010465_1011899_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.4	3.4e-68
WP_013351579.1|1011913_1012183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351580.1|1012183_1012372_+	XkdX family protein	NA	NA	NA	NA	NA
WP_013351581.1|1012375_1012585_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_013351582.1|1012664_1013603_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.3	8.1e-95
WP_174201916.1|1013624_1013882_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	1.9e-22
WP_041481635.1|1013974_1014535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351585.1|1014550_1014886_-	YolD-like family protein	NA	O64030	Bacillus_phage	35.7	8.9e-12
WP_013351586.1|1014945_1015152_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013351587.1|1015288_1016098_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.7	1.3e-16
>prophage 5
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	1265370	1297892	4006790	coat,tRNA,protease	Planktothrix_phage(16.67%)	37	NA	NA
WP_012117281.1|1265370_1266363_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013351824.1|1267107_1268742_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351825.1|1268848_1269784_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_151282460.1|1269787_1270705_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_013351827.1|1270717_1271794_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_014470613.1|1271786_1272704_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_013351829.1|1272811_1273999_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_013351830.1|1274116_1274695_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003327578.1|1274872_1275268_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_013351831.1|1275325_1275982_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
WP_014470612.1|1276257_1276914_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_013351833.1|1277065_1278226_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_013351834.1|1278454_1280284_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1280319_1280487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351835.1|1280771_1281674_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_013351836.1|1281670_1282069_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_013351837.1|1282293_1282980_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
WP_013351838.1|1282984_1283557_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_013351839.1|1283681_1284047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351840.1|1284074_1284710_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013351841.1|1284727_1285528_+	NAD kinase	NA	NA	NA	NA	NA
WP_013351842.1|1285542_1286436_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
WP_013351843.1|1286469_1287219_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.0	2.9e-10
WP_013351845.1|1288482_1289193_+	thiaminase II	NA	NA	NA	NA	NA
WP_014470610.1|1289167_1289785_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_013351847.1|1289768_1290878_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013351848.1|1290874_1291078_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1291074_1291845_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013351849.1|1291841_1292852_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_013351850.1|1292874_1293687_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013351851.1|1293817_1294594_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_164848957.1|1294685_1295279_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|1295336_1295780_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|1295928_1296411_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351855.1|1296560_1297061_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|1297153_1297468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470608.1|1297505_1297892_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	1319252	1322258	4006790		Bacillus_phage(100.0%)	6	NA	NA
WP_013351882.1|1319252_1319411_-	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
WP_013351883.1|1319570_1319900_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351884.1|1319892_1320285_+	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351885.1|1320934_1321210_-	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_014470521.1|1321660_1321870_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351886.1|1321883_1322258_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
>prophage 7
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	1357606	1393663	4006790	terminase,tail,capsid,portal,holin,plate	Bacillus_phage(34.38%)	46	NA	NA
WP_013351926.1|1357606_1358959_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	6.0e-14
WP_014470507.1|1359385_1359577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351927.1|1359744_1360509_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013351928.1|1360652_1361120_-	DinB family protein	NA	NA	NA	NA	NA
WP_088030497.1|1361324_1362461_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_003154881.1|1362450_1362585_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_013351930.1|1362728_1363682_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_013351931.1|1363719_1364097_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351932.1|1364206_1364809_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351933.1|1364951_1365542_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351934.1|1365689_1366028_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1366218_1366398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470504.1|1366387_1367215_+	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_013351937.1|1367114_1367915_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.3	2.3e-58
WP_003154863.1|1367914_1368082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351938.1|1368179_1368521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351939.1|1368510_1368714_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351940.1|1368826_1369336_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_013351941.1|1369450_1370248_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.0	1.2e-59
WP_013351942.1|1370244_1371543_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_044051899.1|1371591_1372983_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351944.1|1373002_1373845_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_013351945.1|1373871_1374807_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_013351946.1|1375202_1375559_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_013351947.1|1375555_1376059_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_174201930.1|1376055_1376502_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_013351949.1|1376498_1376708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351950.1|1376707_1378105_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_003154837.1|1378106_1378550_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1378624_1379071_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1379112_1379265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030498.1|1379252_1384457_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	9.0e-42
WP_013351953.1|1384449_1385109_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_013351954.1|1385122_1386100_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351955.1|1386099_1386366_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_041481725.1|1386515_1386941_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	34.1	5.6e-11
WP_013351957.1|1386933_1387974_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	9.4e-68
WP_013351958.1|1387957_1388536_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	2.4e-12
WP_013351959.1|1388532_1388805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721186.1|1390310_1390772_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	47.9	2.2e-32
WP_174201931.1|1390784_1391183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351962.1|1391169_1391367_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	1.5e-14
WP_013351963.1|1391415_1392177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351964.1|1392230_1392494_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_013351965.1|1392507_1392771_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	5.2e-23
WP_013351966.1|1392784_1393663_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
>prophage 8
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	2067875	2078284	4006790		Bacillus_phage(71.43%)	14	NA	NA
WP_007611720.1|2067875_2068496_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_013352414.1|2068844_2069273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352413.1|2069429_2069879_+	YndM family protein	NA	NA	NA	NA	NA
WP_013352412.1|2069906_2070737_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352411.1|2070723_2070873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352410.1|2070979_2071801_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352409.1|2072006_2072192_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352408.1|2072242_2072677_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352407.1|2072847_2073087_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_013352406.1|2073374_2075792_+	peptidase G2	NA	D6R401	Bacillus_phage	50.1	6.5e-221
WP_174201869.1|2075957_2076131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352404.1|2076459_2076996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016935991.1|2077412_2077502_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352403.1|2077663_2078284_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
>prophage 9
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	2320254	2326507	4006790		Staphylococcus_phage(66.67%)	9	NA	NA
WP_013352726.1|2320254_2320848_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_013352727.1|2320837_2321593_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_076983148.1|2321800_2321890_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352728.1|2321977_2322499_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_013352729.1|2322564_2322939_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352730.1|2323055_2323520_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352731.1|2323552_2324749_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_013352732.1|2324763_2325411_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352733.1|2325391_2326507_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 10
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	2639595	2699005	4006790	protease,tRNA,coat	uncultured_Mediterranean_phage(25.0%)	58	NA	NA
WP_013353029.1|2639595_2640039_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_013353030.1|2640051_2642256_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_013353031.1|2642414_2642927_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	7.2e-29
WP_013353032.1|2642932_2645290_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	2.8e-91
WP_013353033.1|2645345_2645672_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_013353034.1|2645735_2646233_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_013353035.1|2646363_2648583_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.9	3.5e-27
WP_013353036.1|2648619_2648916_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_013353037.1|2649030_2650587_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_013353038.1|2650594_2651251_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013353039.1|2651417_2651804_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2651856_2652117_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_013353040.1|2652148_2653294_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	1.3e-89
WP_174202065.1|2653321_2654350_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013353042.1|2654375_2654576_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013353043.1|2654568_2655573_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	5.2e-07
WP_003152683.1|2655583_2656189_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038463270.1|2656323_2656800_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013353047.1|2657924_2659076_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_013353048.1|2659202_2660306_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_013353049.1|2660305_2661154_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_013353050.1|2661135_2662701_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013353051.1|2662806_2663958_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.5	5.1e-30
WP_013353052.1|2663954_2664497_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013353053.1|2664523_2665381_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2665396_2665840_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_013353054.1|2665893_2667180_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013353055.1|2667211_2667790_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2668106_2668391_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038462961.1|2668403_2668745_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2668747_2669056_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013353057.1|2669201_2670068_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_174201973.1|2670060_2670864_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2670992_2671796_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013353059.1|2671798_2672479_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014470782.1|2672532_2673051_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013353061.1|2673047_2673911_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013353062.1|2673941_2674955_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_013353063.1|2675046_2675742_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013353064.1|2675773_2676343_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013353065.1|2676484_2677486_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013353066.1|2677612_2678365_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013353067.1|2678504_2679797_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013353068.1|2679855_2682498_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_013353069.1|2682948_2683140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353070.1|2683154_2684177_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013353071.1|2684210_2685734_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353072.1|2685866_2687156_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_151282478.1|2687184_2688159_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013353074.1|2688161_2688944_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013353075.1|2688933_2689875_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2689909_2690740_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_013353076.1|2690747_2692115_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013353077.1|2692311_2692803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353078.1|2692835_2693423_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013353079.1|2693419_2695744_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	8.8e-183
WP_013353080.1|2695942_2697601_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_013353081.1|2697751_2699005_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.6	1.4e-147
>prophage 11
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	2923682	2999228	4006790	terminase,tail,capsid,holin,portal,integrase,plate,protease,head	Bacillus_phage(28.57%)	79	2961633:2961680	2999400:2999447
WP_014470850.1|2923682_2924087_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2924222_2924660_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2924784_2924934_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2924930_2925374_-	FixH family protein	NA	NA	NA	NA	NA
WP_013353278.1|2925490_2925964_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2926089_2926317_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2926313_2926883_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2927009_2927258_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2927454_2928786_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2928808_2929849_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2929906_2930065_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2930237_2931353_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_013353286.1|2931349_2932813_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	2.4e-77
WP_013353287.1|2932900_2933719_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2933777_2934602_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_013353289.1|2934589_2936326_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2936322_2937735_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2938018_2938738_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013353292.1|2938881_2939352_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_014470856.1|2946699_2947281_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2947312_2948842_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2948861_2949392_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013353296.1|2949538_2950027_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2950028_2950610_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2950680_2951889_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|2951906_2953379_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|2953579_2954140_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|2954306_2954846_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_013353302.1|2955009_2955678_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|2955701_2956547_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|2956686_2957862_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|2958778_2959102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|2959794_2960925_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|2961312_2961516_+	hypothetical protein	NA	NA	NA	NA	NA
2961633:2961680	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_013353310.1|2964208_2964604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353311.1|2964593_2965007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470866.1|2965192_2965417_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
WP_014470867.1|2965539_2965842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470868.1|2965897_2966203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353313.1|2966217_2967633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470869.1|2967683_2968049_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_014470870.1|2968079_2968322_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
WP_013353316.1|2968785_2969457_-	M15 family metallopeptidase	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
WP_013353317.1|2969498_2969906_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	67.2	1.6e-39
WP_013353318.1|2969943_2970117_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
WP_013353319.1|2970119_2970401_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
WP_038463007.1|2970397_2971675_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	52.9	1.8e-81
WP_013353321.1|2971688_2974277_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
WP_013353322.1|2974291_2976172_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	26.8	8.5e-51
WP_013353323.1|2976186_2977020_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_174201977.1|2977031_2980805_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	55.7	6.2e-109
WP_013353325.1|2980871_2981057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353326.1|2981068_2981419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353327.1|2981506_2982091_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
WP_013353328.1|2982123_2982507_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014470873.1|2982503_2982887_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
WP_013353329.1|2982886_2983210_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
WP_014470874.1|2983196_2983493_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
WP_013353330.1|2983548_2984742_-|capsid	phage major capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
WP_014470875.1|2984779_2985376_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
WP_013353331.1|2985368_2986613_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
WP_014470876.1|2986617_2986821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353332.1|2986832_2988536_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
WP_013353333.1|2988532_2989006_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_013353334.1|2989277_2989511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353335.1|2989525_2989909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470877.1|2989923_2990214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470878.1|2990207_2990399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353336.1|2990785_2991064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353337.1|2991060_2991240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470882.1|2991662_2991854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470883.1|2992034_2992205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174201978.1|2992219_2992969_-	Bro-N domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	39.2	3.6e-21
WP_014470884.1|2995391_2995565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470885.1|2995831_2995966_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_013353340.1|2996010_2996973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470886.1|2997177_2997357_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174201979.1|2997543_2998077_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174201980.1|2998076_2999228_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.5	1.0e-30
2999400:2999447	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
>prophage 12
NZ_CP054415	Bacillus amyloliquefaciens strain 205 chromosome, complete genome	4006790	3118216	3209723	4006790	terminase,tail,capsid,holin,portal,integrase,plate,protease,head,coat	Bacillus_phage(37.21%)	102	3153526:3153545	3190992:3191011
WP_014472214.1|3118216_3119233_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_013353454.1|3119386_3119887_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.0	5.7e-39
WP_013353455.1|3119913_3120684_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_013353456.1|3120717_3121152_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3121177_3121453_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3121671_3122568_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_013353457.1|3122770_3123748_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_013353458.1|3123785_3124544_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_013353459.1|3124650_3126045_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013353460.1|3126062_3126884_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013353461.1|3126903_3127755_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_013353462.1|3127781_3128135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353463.1|3128208_3129573_-	allantoinase	NA	NA	NA	NA	NA
WP_013353464.1|3129753_3131349_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014472216.1|3131543_3131723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470983.1|3131755_3132064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353465.1|3132495_3132939_-	hypothetical protein	NA	A0A1U9WQP1	Geobacillus_phage	58.4	4.0e-28
WP_013353466.1|3134047_3135244_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_013353467.1|3135366_3136620_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_013353468.1|3136638_3137880_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_014472219.1|3138098_3138965_+	endonuclease	NA	NA	NA	NA	NA
WP_013353470.1|3139009_3140116_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.6	3.3e-18
WP_013353471.1|3140269_3140998_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_013353472.1|3141022_3141877_-	fructosamine kinase	NA	NA	NA	NA	NA
WP_013353473.1|3141890_3142775_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_041481667.1|3142778_3143657_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041481740.1|3143693_3144962_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013353476.1|3145035_3146022_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.2	7.7e-11
WP_013353477.1|3146219_3147146_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013353478.1|3147179_3147770_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_013353479.1|3147762_3148707_-	membrane protein	NA	NA	NA	NA	NA
WP_041481668.1|3148703_3149234_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_013353481.1|3149356_3149629_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_013353482.1|3149668_3150043_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_013353483.1|3150110_3151226_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013353485.1|3152041_3152506_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_013353486.1|3152640_3153477_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.0	3.4e-20
3153526:3153545	attL	CCTTCCATTTCGAATTTGAT	NA	NA	NA	NA
WP_017418248.1|3153936_3154089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353487.1|3154121_3154484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353488.1|3154499_3154979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353489.1|3155142_3156156_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	95.3	5.4e-185
WP_013353490.1|3156204_3156627_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.9	2.7e-58
WP_013353491.1|3156677_3156866_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_013353492.1|3156862_3157225_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.1	5.1e-53
WP_013353493.1|3157221_3158358_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	77.6	3.3e-135
WP_013353494.1|3158370_3160935_-	peptidase G2	NA	D6R401	Bacillus_phage	57.6	2.4e-290
WP_013353495.1|3160967_3162686_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	69.4	2.5e-222
WP_013353496.1|3162698_3163535_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	8.0e-110
WP_013353497.1|3163535_3167282_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	58.4	3.1e-113
WP_014472226.1|3167342_3167525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353499.1|3167536_3167899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353500.1|3167956_3168535_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	39.9	9.6e-30
WP_013353501.1|3168554_3168947_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013353502.1|3168943_3169333_-	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	35.0	2.2e-09
WP_013353503.1|3169332_3169659_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014472232.1|3169648_3169942_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_013353505.1|3169993_3170434_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.3	1.7e-10
WP_013353506.1|3170461_3171661_-|capsid	phage major capsid protein	capsid	A0A2H4J3W9	uncultured_Caudovirales_phage	49.8	3.1e-75
WP_013353507.1|3171709_3172306_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	52.2	3.1e-47
WP_013353508.1|3172298_3173525_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	1.2e-66
WP_041481669.1|3173529_3173736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353509.1|3173752_3175486_-|terminase	terminase large subunit	terminase	A0A1W6JPU1	Staphylococcus_phage	48.2	8.1e-141
WP_013353510.1|3175475_3175961_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	36.5	4.8e-14
WP_013353512.1|3177045_3177426_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
WP_013353513.1|3177422_3178778_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.1	5.3e-180
WP_127721194.1|3179324_3181739_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	56.0	7.6e-278
WP_164848961.1|3181761_3181935_-	hypothetical protein	NA	M4ZR07	Bacillus_phage	50.9	9.6e-10
WP_013353515.1|3182050_3183997_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	66.9	5.4e-250
WP_013353516.1|3183993_3184542_-	hypothetical protein	NA	Q38587	Bacillus_phage	62.8	4.8e-23
WP_013353517.1|3184600_3185170_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	74.9	1.3e-76
WP_032864197.1|3185225_3185570_-	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	50.0	5.7e-22
WP_013353518.1|3185569_3186748_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.4	1.5e-133
WP_013353519.1|3186744_3187140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353520.1|3187152_3187554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481670.1|3187744_3188014_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.7	1.3e-18
WP_164848962.1|3188010_3188157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353523.1|3188400_3188586_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	68.9	6.8e-14
WP_013353524.1|3188854_3189283_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	58.9	6.9e-41
WP_041481672.1|3189291_3189714_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	60.9	8.0e-42
WP_013353525.1|3189758_3190916_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	67.8	2.6e-151
WP_003151878.1|3190978_3192376_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3190992:3191011	attR	CCTTCCATTTCGAATTTGAT	NA	NA	NA	NA
WP_003151877.1|3192395_3192839_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_013353526.1|3192828_3194049_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.3	1.2e-117
WP_013353527.1|3194048_3195362_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|3195379_3196165_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.7	3.5e-06
WP_003151857.1|3196341_3196494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030652.1|3196686_3197073_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013353529.1|3197156_3197972_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013353530.1|3197985_3198654_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013353531.1|3198646_3199672_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.7e-32
WP_013353532.1|3199994_3200345_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353533.1|3200442_3200763_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013353535.1|3201201_3201438_-	YusG family protein	NA	NA	NA	NA	NA
WP_013353536.1|3201492_3201876_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013353537.1|3201935_3202292_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	50.0	1.1e-20
WP_013353538.1|3202405_3204190_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013353539.1|3204208_3205384_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_013353540.1|3205394_3207764_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_013353541.1|3207954_3208095_+	YuzL family protein	NA	NA	NA	NA	NA
WP_013353542.1|3208123_3209032_-	proline dehydrogenase	NA	NA	NA	NA	NA
WP_013353543.1|3209121_3209379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353544.1|3209390_3209723_+|coat	spore coat protein	coat	NA	NA	NA	NA
