The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040883	Staphylococcus epidermidis strain O47 chromosome, complete genome	2518181	968733	1041103	2518181	terminase,protease,head,holin,portal,capsid,tRNA,tail,integrase	Staphylococcus_phage(28.57%)	80	958449:958465	1042555:1042571
958449:958465	attL	TTTCCCTCTTTTTCTTT	NA	NA	NA	NA
WP_002484510.1|968733_969780_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1J0MFS3	Staphylococcus_phage	36.3	5.0e-53
WP_012088039.1|969825_970557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002446812.1|970597_970972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002446811.1|971127_971463_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	58.9	1.4e-28
WP_002446810.1|971623_971815_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	66.7	3.1e-17
WP_002446809.1|971868_972192_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002446808.1|972207_972402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446807.1|972549_973791_+	DEAD/DEAH box helicase family protein	NA	A0A1B1P7L4	Bacillus_phage	57.2	6.9e-134
WP_002484586.1|973793_974111_+	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	46.5	3.7e-23
WP_002484599.1|974103_974400_+	hypothetical protein	NA	A0A1B1P7M6	Bacillus_phage	58.2	3.6e-25
WP_002495697.1|974399_976211_+	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	57.4	1.1e-164
WP_002484592.1|976229_976436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484600.1|976487_976970_+	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	38.4	8.9e-21
WP_002484609.1|977019_978738_+	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	63.5	1.3e-207
WP_002484590.1|978751_979102_+	helix-turn-helix transcriptional regulator	NA	A0A2H4IYG5	uncultured_Caudovirales_phage	38.8	4.8e-16
WP_002484612.1|979132_979351_+	DUF3310 domain-containing protein	NA	Q4ZC12	Staphylococcus_virus	78.6	1.9e-26
WP_002484605.1|979357_980089_+	hypothetical protein	NA	H9A0T0	Staphylococcus_phage	49.2	5.4e-62
WP_002484596.1|980153_980474_+	phosphoribosyl-ATP diphosphatase	NA	A0A2H4J2H9	uncultured_Caudovirales_phage	81.6	4.6e-42
WP_002484581.1|980501_980969_-	hypothetical protein	NA	A0A1W6JPR4	Staphylococcus_phage	41.5	3.5e-22
WP_002484606.1|981036_981282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484603.1|981359_981554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484601.1|981583_983458_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	58.0	1.2e-211
WP_002484607.1|983781_984273_+	DNA-directed RNA polymerase sigma-70 factor	NA	S5MAA9	Brevibacillus_phage	28.0	2.6e-07
WP_002484574.1|984476_985094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446790.1|985375_985666_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	42.2	3.2e-18
WP_002491654.1|985988_986327_+	hypothetical protein	NA	D2XR14	Bacillus_phage	39.4	5.8e-11
WP_002484595.1|986310_987945_+|terminase	terminase large subunit	terminase	A0A0U4B089	Bacillus_phage	56.6	1.8e-182
WP_002484608.1|987960_989097_+|portal	phage portal protein	portal	A0A0U4IIQ9	Bacillus_phage	43.8	4.0e-88
WP_002484598.1|989096_989843_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	47.4	6.4e-42
WP_002484575.1|989867_991025_+|capsid	phage major capsid protein	capsid	A0A0U4JIF4	Bacillus_phage	51.7	2.2e-97
WP_002484579.1|991051_991360_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JF26	uncultured_Caudovirales_phage	39.1	1.5e-10
WP_002446783.1|991331_991661_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002446782.1|991660_991999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484584.1|991998_992436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484613.1|992441_993146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446779.1|993169_993520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002446778.1|993567_993780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002504620.1|993843_998025_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	42.6	1.9e-63
WP_002484577.1|998027_998798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484585.1|998794_1002250_+|tail	phage tail protein	tail	M1PRQ3	Streptococcus_phage	24.0	1.7e-20
WP_002484576.1|1002270_1002681_+	hypothetical protein	NA	A0A1I9KKA6	Lactobacillus_phage	31.3	4.3e-08
WP_002484582.1|1002715_1002997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484580.1|1002998_1003385_+|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	33.9	9.3e-13
WP_002484578.1|1003438_1004356_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JNM6	Staphylococcus_phage	63.4	4.9e-68
WP_012112670.1|1004468_1005071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484587.1|1005415_1005733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829860.1|1006184_1007033_+|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	31.9	3.5e-20
WP_002456347.1|1007258_1008317_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_002440300.1|1008555_1010013_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_001829838.1|1010005_1010728_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	3.6e-34
WP_064783702.1|1011242_1011380_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	73.8	9.8e-10
WP_001829814.1|1011589_1012720_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001829836.1|1012716_1013187_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002456349.1|1013344_1013944_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002468490.1|1013967_1014147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829818.1|1014302_1014707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829862.1|1014891_1016277_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001829804.1|1016637_1017462_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_001829819.1|1017620_1018754_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001829810.1|1018746_1019370_+	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	28.2	5.2e-05
WP_001829807.1|1019640_1020105_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002485606.1|1020286_1021417_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001829805.1|1021489_1021834_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	30.6	5.8e-06
WP_001829843.1|1022104_1023301_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_002456350.1|1023290_1026230_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002456351.1|1026226_1027168_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_161375074.1|1027342_1027444_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002456352.1|1027593_1028571_-	foldase	NA	NA	NA	NA	NA
WP_001829837.1|1028772_1029333_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_002456353.1|1029498_1029870_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_001829828.1|1029946_1030372_-	HIT family protein	NA	NA	NA	NA	NA
WP_001829855.1|1030501_1031242_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.0e-25
WP_002456354.1|1031234_1032458_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001829861.1|1032516_1033134_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_001829811.1|1033695_1034199_-	signal transduction protein TRAP	NA	NA	NA	NA	NA
WP_002456355.1|1034491_1035553_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_001829846.1|1035629_1036553_+	ferrochelatase	NA	NA	NA	NA	NA
WP_002469574.1|1036696_1038094_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_002456357.1|1038229_1038784_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_002484688.1|1040032_1041103_-|integrase	site-specific integrase	integrase	A0A1J0MFS3	Staphylococcus_phage	42.1	1.6e-70
1042555:1042571	attR	AAAGAAAAAGAGGGAAA	NA	NA	NA	NA
>prophage 2
NZ_CP040883	Staphylococcus epidermidis strain O47 chromosome, complete genome	2518181	1078445	1126668	2518181	integrase,transposase,tRNA	Staphylococcus_phage(81.25%)	39	1067212:1067228	1080018:1080034
1067212:1067228	attL	AATATAATAATAAAGAA	NA	NA	NA	NA
WP_174168253.1|1078445_1078940_-|integrase	site-specific integrase	integrase	B7T092	Staphylococcus_virus	76.1	6.4e-67
WP_002456423.1|1079098_1079311_+	hypothetical protein	NA	A0A2H4JCA1	uncultured_Caudovirales_phage	72.9	7.3e-20
WP_002456424.1|1079690_1080425_-	hypothetical protein	NA	NA	NA	NA	NA
1080018:1080034	attR	TTCTTTATTATTATATT	NA	NA	NA	NA
WP_002456426.1|1080951_1081239_-	hypothetical protein	NA	A0A2H4JGN1	uncultured_Caudovirales_phage	50.0	5.5e-18
WP_002456427.1|1081400_1082066_-	Ltp family lipoprotein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	41.8	7.0e-08
WP_002456429.1|1083316_1084741_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	63.9	6.6e-173
WP_001829851.1|1084730_1085732_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	50.2	6.9e-92
WP_002457867.1|1085728_1085977_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	83.1	6.5e-36
WP_002456430.1|1086047_1086515_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	57.4	5.5e-44
WP_002456431.1|1086501_1087287_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.3	2.0e-99
WP_002469572.1|1087517_1089110_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	83.6	1.6e-268
WP_001829830.1|1089479_1090679_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	85.4	4.1e-192
WP_002456434.1|1090781_1091690_+	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	80.6	1.8e-102
WP_002456435.1|1091869_1092706_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.6	6.1e-110
WP_049385659.1|1093008_1093146_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	79.1	1.8e-11
WP_104832471.1|1093375_1094554_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.0	3.7e-60
WP_002484462.1|1095032_1095386_-	CrcB family protein	NA	NA	NA	NA	NA
WP_001830726.1|1095382_1095748_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	57.0	4.1e-34
WP_002446728.1|1095784_1096093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002484454.1|1096369_1097083_+	transaldolase	NA	M1PR54	Cyanophage	37.4	7.0e-22
WP_002467846.1|1097222_1097666_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	43.5	4.1e-20
WP_001830734.1|1097652_1098096_-	competence protein ComK	NA	NA	NA	NA	NA
WP_002484457.1|1098101_1098581_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	42.9	9.1e-26
WP_002456441.1|1098788_1099004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830727.1|1099381_1100233_+	glucosaminidase domain-containing protein	NA	A0A1J0MFB0	Staphylococcus_phage	35.6	1.0e-32
WP_002484471.1|1100580_1102065_+	FAD/NAD(P)-binding protein	NA	A0A2H4PQX2	Staphylococcus_phage	65.6	2.5e-13
WP_002494782.1|1102500_1103544_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	66.8	8.9e-135
WP_002467848.1|1103550_1104183_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	77.6	1.1e-87
WP_002484458.1|1104195_1105377_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	75.8	5.7e-178
WP_002456446.1|1105389_1105851_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	84.2	1.2e-59
WP_002484452.1|1106108_1107110_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	69.7	5.8e-131
WP_002484455.1|1107352_1108180_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002484465.1|1108669_1109086_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001830894.1|1109307_1109871_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	66.5	1.9e-67
WP_001830802.1|1109867_1110821_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	84.7	3.3e-67
WP_001830884.1|1110927_1112142_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	83.7	4.6e-183
WP_002484468.1|1112430_1114848_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	87.3	0.0e+00
WP_001830891.1|1114873_1115185_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	71.8	4.1e-35
WP_002484464.1|1115589_1126668_+	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2H4PQU6	Staphylococcus_phage	26.2	3.2e-28
>prophage 3
NZ_CP040883	Staphylococcus epidermidis strain O47 chromosome, complete genome	2518181	1596096	1648751	2518181	terminase,protease,head,holin,portal,capsid,tRNA,tail,plate,integrase	Staphylococcus_phage(48.48%)	61	1597334:1597393	1628371:1628493
WP_002456552.1|1596096_1596450_-	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	47.0	2.2e-21
1597334:1597393	attL	AAAAAAGAAGCTAAGGCAAAATGCCTTAACTCCTTACCCCTATTAGGTTTCCCCTGAAAT	NA	NA	NA	NA
WP_002457563.1|1597642_1597855_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	62.3	6.4e-16
WP_002484791.1|1598244_1598976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002458418.1|1598982_1599756_-	hypothetical protein	NA	Q4ZAU0	Staphylococcus_virus	41.4	2.8e-48
WP_002458419.1|1599934_1600852_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JNM6	Staphylococcus_phage	56.1	5.0e-65
WP_002484783.1|1600891_1601287_-|holin	phage holin family protein	holin	A0A1S6KVE0	Staphylococcus_phage	37.9	1.7e-17
WP_002484785.1|1601310_1602588_-|plate	BppU family phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	52.2	1.8e-124
WP_002458423.1|1602605_1603622_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	56.0	1.9e-97
WP_002458424.1|1603634_1604231_-	hypothetical protein	NA	A0A1J0MFD6	Staphylococcus_phage	49.1	5.8e-54
WP_002484790.1|1604214_1604436_-	hypothetical protein	NA	A0A1J0MF94	Staphylococcus_phage	64.1	9.7e-07
WP_002458425.1|1604422_1605601_-|tail	phage tail protein	tail	A0A1W6JQ67	Staphylococcus_phage	32.1	2.2e-60
WP_002458426.1|1605613_1606438_-|tail	phage tail family protein	tail	A0A1D6Z283	Staphylococcus_phage	37.6	2.1e-46
WP_002484786.1|1606439_1610930_-|tail	phage tail tape measure protein	tail	A0A075M036	Staphylococcus_phage	46.8	4.8e-217
WP_002484788.1|1611102_1611453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002458430.1|1611476_1612136_-|tail	tail protein	tail	A0A059T7Y4	Listeria_phage	39.6	5.6e-26
WP_002484779.1|1612147_1612537_-	hypothetical protein	NA	Q4ZCL5	Staphylococcus_virus	38.4	9.1e-16
WP_002484776.1|1612533_1612947_-	hypothetical protein	NA	A0A059T5F3	Listeria_phage	39.8	7.9e-18
WP_002458432.1|1612946_1613243_-|head	phage head closure protein	head	G4KNQ4	Staphylococcus_phage	32.2	1.8e-08
WP_002458433.1|1613295_1613634_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002458434.1|1613643_1613931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002458435.1|1613944_1615195_-|capsid	phage major capsid protein	capsid	R9TQG7	Paenibacillus_phage	37.8	2.5e-67
WP_002484782.1|1615187_1615832_-|head,protease	HK97 family phage prohead protease	head,protease	V5USG3	Enterococcus_phage	38.5	9.1e-21
WP_002458436.1|1615821_1617048_-|portal	phage portal protein	portal	A0A290G4I4	Caldibacillus_phage	40.1	1.6e-58
WP_002458437.1|1617062_1618778_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	60.1	1.7e-207
WP_002458438.1|1618770_1619172_-	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	59.3	1.4e-27
WP_002458439.1|1619292_1619649_-	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	53.6	1.3e-21
WP_002458440.1|1619703_1620546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002484781.1|1620573_1621074_-	positive control factor	NA	A0A0S2MVE1	Bacillus_phage	31.2	3.5e-12
WP_002457319.1|1621248_1621473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002457320.1|1622143_1622443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002504544.1|1622493_1622841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002457322.1|1622846_1623749_-	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	52.8	2.5e-53
WP_002457323.1|1623778_1624174_-	single-stranded DNA-binding protein	NA	Q4ZAD5	Staphylococcus_virus	51.4	4.1e-32
WP_002457324.1|1624187_1624454_-	hypothetical protein	NA	A0A2H4JAK6	uncultured_Caudovirales_phage	57.1	6.2e-16
WP_002457325.1|1624516_1624708_-	DUF1270 family protein	NA	NA	NA	NA	NA
WP_002457326.1|1624722_1624932_-	hypothetical protein	NA	A0A2H4JFX1	uncultured_Caudovirales_phage	68.1	1.3e-21
WP_002457327.1|1624997_1625201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002457328.1|1625189_1625354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002457329.1|1625353_1625509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002457330.1|1625530_1625809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002457331.1|1625836_1626073_-	DUF739 family protein	NA	A0A2I6PDH8	Staphylococcus_phage	83.3	8.7e-30
WP_002457332.1|1626237_1626588_+	helix-turn-helix domain-containing protein	NA	R9QTP6	Staphylococcus_phage	50.0	3.4e-22
WP_002457333.1|1626757_1627129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002457334.1|1627171_1628296_+|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	29.0	1.9e-34
WP_001829492.1|1628440_1629781_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
1628371:1628493	attR	AAAAAAGAAGCTAAGGCAAAATGCCTTAACTCCTTACCCCTATTAGGTTTCCCCTGAAATTGTTTAGCGCTTAGTATTGCTTAATATACTGTTCTCTTTCCCATTCGGATACTTGAGTTCTAT	NA	NA	NA	NA
WP_001829488.1|1629799_1630165_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002456554.1|1630645_1631884_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_002456555.1|1631899_1633150_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002456556.1|1633250_1633727_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	43.7	1.1e-26
WP_001829517.1|1633948_1634188_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_002504492.1|1634141_1635140_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002456557.1|1635151_1636078_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001832566.1|1636301_1637975_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_001829522.1|1638151_1639651_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001829504.1|1639804_1640629_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002504493.1|1641003_1641537_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_002456559.1|1641550_1643488_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.6	1.1e-61
WP_001832553.1|1643502_1646124_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.3	3.8e-41
WP_001829480.1|1646321_1646816_-	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_001829463.1|1646839_1647205_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_002439565.1|1647206_1648751_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP040883	Staphylococcus epidermidis strain O47 chromosome, complete genome	2518181	1866223	1874693	2518181		Synechococcus_phage(33.33%)	9	NA	NA
WP_001831672.1|1866223_1866790_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.0	6.1e-29
WP_002504799.1|1866789_1867821_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.4	2.8e-64
WP_001831721.1|1867813_1869298_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.9	9.4e-45
WP_001831715.1|1869276_1871466_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	8.7e-140
WP_001831727.1|1871458_1872130_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_001831728.1|1872131_1872392_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001831723.1|1872391_1873096_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	H8ZMN3	Synechococcus_phage	42.5	1.6e-47
WP_001831674.1|1873096_1874224_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001831735.1|1874210_1874693_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.3	5.2e-21
>prophage 5
NZ_CP040883	Staphylococcus epidermidis strain O47 chromosome, complete genome	2518181	2109791	2120225	2518181		uncultured_Caudovirales_phage(66.67%)	10	NA	NA
WP_001829596.1|2109791_2110571_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	5.1e-18
WP_002438903.1|2110567_2111527_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	100.0	4.1e-17
WP_002438902.1|2111510_2112485_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	99.7	5.9e-165
WP_002456931.1|2112500_2112764_-	hypothetical protein	NA	A0A2H4IYB4	uncultured_Caudovirales_phage	100.0	5.5e-17
WP_001829597.1|2112738_2113707_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	100.0	3.9e-185
WP_001829582.1|2113825_2115931_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	100.0	0.0e+00
WP_001829589.1|2115893_2116292_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	100.0	2.0e-71
WP_001829684.1|2117046_2117922_+	DMT family transporter	NA	NA	NA	NA	NA
WP_001832596.1|2117935_2118436_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	70.1	1.1e-50
WP_002438897.1|2118719_2120225_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.0	5.5e-61
>prophage 6
NZ_CP040883	Staphylococcus epidermidis strain O47 chromosome, complete genome	2518181	2141653	2152189	2518181		Staphylococcus_phage(22.22%)	13	NA	NA
WP_001830323.1|2141653_2142805_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	39.6	7.5e-26
WP_001830349.1|2142794_2143382_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_001830328.1|2143678_2144350_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.7	4.1e-64
WP_001830341.1|2144354_2144774_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_001830330.1|2144774_2145488_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.8	1.6e-55
WP_001830331.1|2145590_2146190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049361804.1|2146557_2146695_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	76.7	2.3e-11
WP_001830329.1|2147290_2147728_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001830332.1|2147778_2148252_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001830352.1|2148226_2148916_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.4e-34
WP_025987135.1|2148918_2149971_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	2.0e-17
WP_001830351.1|2150040_2151147_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.2	6.3e-62
WP_001830355.1|2151349_2152189_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	1.2e-60
