The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	332384	378086	4922872	transposase,tail,integrase,capsid	Shigella_phage(44.44%)	48	354611:354650	381892:381931
WP_001000409.1|332384_333920_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|333969_334317_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|334313_334697_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_001548946.1|334846_336868_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_174190331.1|336868_338329_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003029591.1|341871_342876_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003029589.1|342905_344306_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_000345204.1|344305_345676_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029587.1|345813_347331_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_003029584.1|347496_348420_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_077258089.1|348648_348819_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029582.1|349328_349637_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_003029581.1|349665_350322_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_008321072.1|350377_350998_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_008321066.1|351459_352224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321061.1|353104_354424_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
354611:354650	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCG	NA	NA	NA	NA
WP_060614984.1|355236_355395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614983.1|355406_356180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131727973.1|356343_356571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685487.1|356567_357026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685488.1|357084_357282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032937054.1|357292_357853_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060614981.1|359449_359698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309089.1|359716_359893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614980.1|359907_360648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614979.1|360641_361103_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077870821.1|361321_361591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685494.1|361583_361922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801630.1|362588_362804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685495.1|362800_363160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172426607.1|363185_364208_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_033801633.1|364327_364525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614977.1|364517_366362_+	cell envelope integrity protein TolA	NA	A0A1Q1N989	Escherichia_phage	32.4	1.5e-63
WP_060614976.1|366700_366979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685605.1|367009_368233_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000051887.1|368405_369569_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|369795_370101_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001020634.1|370497_371190_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|371287_371548_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_162521836.1|372866_373133_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.8	2.9e-42
WP_000497751.1|373141_373312_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_069067270.1|373295_374435_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	75.3	1.3e-190
WP_000090998.1|374434_374791_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_071549914.1|374975_375323_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	51.2	4.6e-11
WP_023568707.1|375394_375946_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.9e-86
WP_023568708.1|376380_377001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023568709.1|377006_377309_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_048228913.1|377411_378086_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.3	1.0e-78
381892:381931	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCG	NA	NA	NA	NA
>prophage 2
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	945983	1048408	4922872	transposase,terminase,protease,capsid,portal,integrase,head,lysis,tail,plate	Salmonella_phage(64.81%)	107	948711:948726	1020575:1020590
WP_000399648.1|945983_946964_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|947224_948490_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114278.1|948641_949457_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
948711:948726	attL	ATCATCGGTAGCGTAA	NA	NA	NA	NA
WP_000209304.1|949602_952035_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|952040_952940_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|953070_953733_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829244.1|953820_954570_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397384.1|954569_955805_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|956008_956974_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001296993.1|956960_958832_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090136.1|958851_960390_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|960407_961328_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|961330_962242_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|962419_964768_+	CHASE9 sensor domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|964775_966104_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|966150_967476_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|967688_968072_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|968182_969298_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|969294_969921_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|970167_971370_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|971416_972175_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|972232_972829_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|973113_974346_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|974386_974671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|974756_975572_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|975571_976780_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|976863_977400_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_016529337.1|977504_978557_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.0e-106
WP_060615102.1|978643_979633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077870828.1|979643_980582_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.6	6.1e-34
WP_000188448.1|980670_980892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460897.1|980924_981434_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001350183.1|981441_981675_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_060615101.1|981622_982081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961902.1|982274_982541_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	83.3	1.1e-15
WP_000996717.1|982658_983000_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244165.1|983067_983301_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752613.1|983300_983528_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_060615100.1|983524_984382_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	1.8e-157
WP_060615099.1|984378_986793_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_023138932.1|986945_987134_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	4.6e-26
WP_001217575.1|987144_987378_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|987570_987906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060615098.1|988412_989663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520382.1|989695_990730_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	1.7e-170
WP_001098440.1|990729_992496_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216223.1|992638_993472_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.1e-122
WP_016237792.1|993488_994547_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059204.1|994550_995201_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_016237793.1|995296_995761_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000868175.1|995760_995964_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|995967_996183_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_016237794.1|996163_996676_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	2.0e-87
WP_000727853.1|996677_997055_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_016237795.1|997051_997480_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	9.3e-46
WP_001039935.1|997575_998007_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_023352536.1|997999_998446_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_000993775.1|998514_999093_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177597.1|999089_999449_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_060615096.1|999435_1000344_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	3.0e-142
WP_001086833.1|1000336_1000942_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_060615094.1|1002329_1002761_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.3	7.4e-19
WP_060615093.1|1002732_1003164_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	57.9	1.4e-38
WP_165843458.1|1003167_1003566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046146.1|1003680_1004853_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|1004862_1005378_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281007.1|1005432_1005735_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
WP_000763311.1|1005749_1005869_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_060615092.1|1005861_1008939_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000980397.1|1008935_1009421_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_060615091.1|1009417_1010518_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	6.5e-176
WP_000972391.1|1010608_1010827_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1011062_1012748_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1013017_1013395_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|1013424_1013682_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|1013841_1014129_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|1014895_1015798_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1015885_1016362_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|1016712_1017825_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996022.1|1017919_1019053_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_000105438.1|1019062_1020016_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061670.1|1020012_1020858_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
1020575:1020590	attR	TTACGCTACCGATGAT	NA	NA	NA	NA
WP_000389260.1|1020917_1021406_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|1021446_1022574_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|1022748_1023480_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1023771_1024440_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1024439_1025156_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1025162_1025894_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027195.1|1025911_1026640_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
WP_001270735.1|1026857_1027373_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160739.1|1027498_1027822_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|1027818_1028649_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001307082.1|1028645_1029659_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1029757_1031188_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1031198_1032200_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|1032236_1033955_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|1034087_1035056_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1035067_1036720_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1036863_1037763_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|1038219_1038915_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1039340_1040999_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1040995_1041952_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746460.1|1042102_1043218_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188193.1|1043214_1045161_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|1045233_1045458_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1045780_1046101_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1046131_1048408_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 3
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	1512498	1530797	4922872	tRNA,holin	Escherichia_phage(66.67%)	21	NA	NA
WP_000628065.1|1512498_1513731_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1513985_1514969_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1515446_1516820_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001153728.1|1516948_1517884_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000040852.1|1517935_1519171_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1519172_1519388_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1519466_1519676_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1519668_1519863_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_060615110.1|1519946_1520729_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	73.0	5.5e-105
WP_000105127.1|1520721_1523322_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_000632297.1|1523423_1523699_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1523773_1523944_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1523943_1524165_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1524606_1525095_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1525091_1525247_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233320.1|1525678_1526098_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1526177_1526432_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693853.1|1526428_1526854_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262393.1|1526925_1527996_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151151.1|1528036_1528459_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|1528799_1530797_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
>prophage 4
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	1541884	1548787	4922872	tail,holin	Enterobacteria_phage(57.14%)	7	NA	NA
WP_000839557.1|1541884_1542100_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	6.5e-32
WP_000885599.1|1544306_1544882_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_000086519.1|1544979_1545570_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000836772.1|1545886_1546120_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_120795384.1|1546188_1546302_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001082294.1|1547078_1547513_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|1547653_1548787_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 5
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	1734540	1766472	4922872	transposase,terminase,integrase,lysis,tail	Enterobacteria_phage(42.31%)	42	1750294:1750308	1768959:1768973
WP_000885571.1|1734540_1735122_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
WP_100069996.1|1735924_1737235_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	1.0e-252
WP_000421825.1|1737243_1737783_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001205129.1|1738138_1738294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|1738463_1738757_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1738847_1739030_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001348167.1|1739246_1739744_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_000839586.1|1739743_1739959_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
WP_001000409.1|1741453_1742989_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|1743038_1743386_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|1743382_1743766_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000780579.1|1744483_1745008_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.7e-46
WP_001204811.1|1745164_1745542_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	4.5e-52
WP_001265276.1|1745559_1746609_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_023147795.1|1746610_1746889_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980987.1|1746955_1747207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967407.1|1747423_1747636_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	4.0e-26
WP_000892866.1|1748321_1749017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373963.1|1749029_1749683_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000566848.1|1749997_1750897_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
1750294:1750308	attL	AACCAGTGAGCATAT	NA	NA	NA	NA
WP_001151251.1|1751149_1751572_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000054501.1|1751612_1752578_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_000705353.1|1752558_1753080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1753063_1753294_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|1753377_1753785_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1753951_1754107_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171933.1|1754266_1754485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|1754488_1754653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1755052_1755241_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1755237_1755429_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048320.1|1755522_1757994_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1758066_1758318_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876993.1|1758352_1759633_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1759652_1759763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174190342.1|1759820_1760840_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.6	6.3e-16
WP_001295394.1|1760851_1762066_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1762271_1762598_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1762732_1763074_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1763108_1763669_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1763671_1764382_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1764489_1764795_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041533.1|1764993_1766472_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	5.2e-120
1768959:1768973	attR	AACCAGTGAGCATAT	NA	NA	NA	NA
>prophage 6
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	1909396	1933727	4922872	tail,integrase,capsid	Enterobacteria_phage(88.89%)	24	1908448:1908472	1933386:1933410
1908448:1908472	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_021529551.1|1909396_1910335_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	6.7e-81
WP_000094527.1|1910423_1910735_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_021549223.1|1911065_1911455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033544758.1|1911451_1914277_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.8	0.0e+00
WP_033544759.1|1914353_1915313_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_000211261.1|1915317_1915629_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	1.0e-49
WP_033544760.1|1915810_1916956_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001603073.1|1916945_1917464_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_033544761.1|1918763_1919600_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
WP_033544768.1|1920124_1920598_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.7	2.4e-87
WP_069067388.1|1920600_1922712_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.7	9.1e-110
WP_060615039.1|1922711_1923311_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-101
WP_001100987.1|1923405_1924584_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979945.1|1924680_1925169_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_033544764.1|1925181_1927989_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_000333495.1|1927975_1928131_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|1928139_1928505_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1928559_1929072_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005367.1|1929071_1930256_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000132830.1|1930413_1931523_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_024188892.1|1931879_1932383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488101.1|1932532_1932793_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1932983_1933124_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1933427_1933727_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1933386:1933410	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
>prophage 7
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	2172038	2239583	4922872	transposase,terminase,protease,portal,capsid,integrase,holin,head,tail	Escherichia_phage(37.5%)	64	2177450:2177465	2255612:2255627
WP_001079062.1|2172038_2172569_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
WP_041498150.1|2174059_2174641_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.7e-101
WP_105313501.1|2174640_2178054_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
2177450:2177465	attL	CTGGCACTGGTAGCTG	NA	NA	NA	NA
WP_041498143.1|2178118_2178718_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.2e-105
WP_105313502.1|2178787_2182267_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_012311734.1|2182327_2182975_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_105313503.1|2182872_2183616_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	1.4e-142
WP_001152456.1|2183620_2184319_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_040079256.1|2184318_2184675_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_071549949.1|2184652_2187880_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.0	0.0e+00
WP_000978930.1|2187926_2188205_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_001441851.1|2188228_2188600_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	97.6	1.0e-61
WP_001441850.1|2188614_2189319_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.4	1.8e-115
WP_001441849.1|2189379_2189724_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	6.7e-55
WP_000968644.1|2189720_2190170_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2190166_2190505_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719065.1|2190513_2190831_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_000766109.1|2190907_2192125_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2192139_2192739_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|2192731_2193958_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000811487.1|2193947_2194109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|2194105_2195863_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2195862_2196345_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140099.1|2196492_2196843_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_016240599.1|2196850_2197051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114684.1|2197295_2197781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001228685.1|2198021_2198207_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001274714.1|2198423_2198957_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_000193292.1|2199012_2199327_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_000839572.1|2199331_2199547_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_016240600.1|2200343_2201033_-	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	2.6e-58
WP_001217424.1|2201029_2201389_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_024195967.1|2201401_2202451_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_024175747.1|2202452_2202731_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|2203027_2203420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813260.1|2203563_2203719_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000150294.1|2203956_2204622_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_021546098.1|2204796_2205222_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_001475341.1|2205262_2206333_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000693850.1|2206404_2206830_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_060615121.1|2206826_2207042_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_069067232.1|2207091_2207808_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	1.7e-52
WP_000379589.1|2208080_2208236_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171942.1|2208395_2208614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2208617_2208782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2209181_2209370_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_021579309.1|2209366_2209558_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097409586.1|2209651_2212093_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	7.8e-113
WP_000096344.1|2212151_2212355_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_021546102.1|2212354_2213380_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001302302.1|2213615_2214413_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001347679.1|2214902_2221979_+	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_000378575.1|2223607_2224924_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2225025_2226480_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|2226822_2227539_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_123001122.1|2228167_2229811_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011020.1|2229928_2230879_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|2230980_2231898_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986347.1|2232356_2233292_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001166155.1|2233353_2234433_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|2234444_2235188_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973198.1|2235184_2235730_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_106120865.1|2236769_2237997_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.7e-175
WP_001373172.1|2238431_2239583_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
2255612:2255627	attR	CTGGCACTGGTAGCTG	NA	NA	NA	NA
>prophage 8
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	2256049	2261789	4922872	transposase	Stx2-converting_phage(33.33%)	9	NA	NA
WP_000080200.1|2256049_2257663_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|2257693_2258044_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2258040_2258466_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000581504.1|2258787_2259243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|2259321_2259555_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|2259654_2260473_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849582.1|2260527_2261013_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001347688.1|2261028_2261505_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|2261567_2261789_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 9
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	2391918	2401360	4922872		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2391918_2393055_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|2393051_2395052_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2395176_2395638_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2395678_2396149_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2396195_2396915_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2396911_2398597_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2398818_2399550_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2399609_2399717_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2399697_2400429_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2400433_2401360_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	2608125	2685571	4922872	tRNA,transposase,terminase,protease,portal,integrase,holin,lysis,coat	Enterobacteria_phage(55.56%)	92	2605330:2605346	2657377:2657393
2605330:2605346	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283581.1|2608125_2608938_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2608937_2609951_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2610016_2611153_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2611251_2612247_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127778.1|2612243_2613422_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2613714_2614935_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683808.1|2615093_2617100_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000399648.1|2617270_2618251_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000559764.1|2618499_2618778_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2618811_2619360_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2619359_2620169_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043799.1|2620168_2620993_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|2620996_2622082_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001309606.1|2622116_2623049_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2623214_2623766_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2623887_2624760_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730293.1|2624746_2625271_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2625267_2625738_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2625734_2626283_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281620.1|2626257_2627010_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112827.1|2627029_2629672_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2629753_2630317_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2630991_2631477_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425059.1|2631679_2633824_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2633823_2635134_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2635313_2635598_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2635969_2637310_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937840.1|2637675_2638734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2638915_2639671_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2639964_2640897_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_136430556.1|2641208_2642366_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
WP_174190351.1|2647083_2648379_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	91.2	4.0e-185
WP_114569587.1|2648388_2649084_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	92.7	1.5e-85
WP_114569586.1|2649086_2649542_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.3e-85
WP_114569585.1|2649541_2650390_-	hypothetical protein	NA	Q716G6	Shigella_phage	94.3	1.9e-98
WP_114569584.1|2650389_2651808_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.2	7.8e-275
WP_073461871.1|2651808_2652309_-	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
WP_167784818.1|2652286_2652892_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.7	4.6e-59
WP_114569583.1|2652935_2654231_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	8.0e-242
WP_080028446.1|2654230_2655142_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	8.3e-161
WP_112014988.1|2655155_2657321_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_000417851.1|2657321_2658821_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
2657377:2657393	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_000729920.1|2658798_2659287_-	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_124038846.1|2659559_2659949_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	58.1	4.6e-36
WP_039720091.1|2659950_2660193_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.7	6.4e-36
WP_000342560.1|2660340_2660556_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
WP_024193020.1|2660902_2661421_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
WP_097414186.1|2661622_2662060_-|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	98.6	5.0e-71
WP_000229390.1|2662056_2662533_-	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_021499321.1|2662516_2662840_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	99.1	6.5e-52
WP_174190352.1|2663301_2663820_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.8	1.7e-94
WP_089648300.1|2663816_2664005_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.6e-26
WP_016248923.1|2664001_2664364_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	97.5	6.6e-61
WP_023146907.1|2664364_2664889_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_000002243.1|2664885_2665176_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001279421.1|2665175_2665445_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950962.1|2665437_2665614_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_138217220.1|2665613_2665973_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	99.2	2.4e-63
WP_078180628.1|2665975_2666152_-	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	3.6e-28
WP_174190353.1|2666148_2666676_-	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	98.9	1.4e-99
WP_000736913.1|2666672_2667113_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_174190354.1|2667186_2668563_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
WP_174190381.1|2668559_2669447_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.6	2.0e-143
WP_045903210.1|2669509_2669782_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	3.0e-42
WP_174190355.1|2669804_2670101_-	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	89.3	1.2e-33
WP_000620665.1|2670209_2670404_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|2670510_2671227_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_032283438.1|2671245_2671614_+	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	98.4	8.5e-56
WP_000219336.1|2671983_2672289_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.8	1.3e-25
WP_000213975.1|2672689_2672890_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_097471936.1|2672949_2673315_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	8.1e-59
WP_174190356.1|2673503_2673815_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	95.1	3.9e-54
WP_000005785.1|2673850_2674819_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_000638547.1|2674843_2674975_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2674959_2675112_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_016248933.1|2675187_2675358_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	98.2	1.5e-23
WP_021499331.1|2675368_2675974_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	9.2e-108
WP_000951325.1|2675973_2676357_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_174190357.1|2676380_2676677_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	8.6e-51
WP_174190358.1|2676687_2676834_+	DUF2737 family protein	NA	K7P716	Enterobacteria_phage	87.0	1.6e-18
WP_174190359.1|2676830_2677280_+	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	83.2	3.7e-61
WP_174190360.1|2677276_2677774_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	89.0	8.8e-48
WP_096985882.1|2677773_2678265_+	hypothetical protein	NA	G9L661	Escherichia_phage	98.2	3.9e-88
WP_000212569.1|2678266_2678503_+	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	100.0	3.0e-38
WP_174190361.1|2679337_2679640_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	96.0	4.7e-52
WP_000002117.1|2679632_2679914_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	96.7	1.1e-47
WP_174190362.1|2680297_2680465_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.8e-26
WP_024239659.1|2680491_2680836_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	1.7e-58
WP_001163428.1|2680958_2681159_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001593563.1|2681688_2682936_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2683007_2683922_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2684137_2685571_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 11
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	3032497	3039637	4922872		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3032497_3035059_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|3035164_3035821_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|3035871_3036639_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3036834_3037743_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3037739_3039002_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3038998_3039637_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 12
NZ_CP047405	Escherichia coli strain MS6193 chromosome, complete genome	4922872	4845412	4888736	4922872	transposase,terminase,portal,integrase,lysis,tail	Enterobacteria_phage(46.81%)	48	4837954:4837969	4862898:4862913
4837954:4837969	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_060615063.1|4845412_4846636_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	3.7e-233
WP_001419254.1|4846898_4848599_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001377405.1|4849031_4849652_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001242749.1|4849651_4850014_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001401560.1|4850004_4850541_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_001311077.1|4851340_4852033_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|4852130_4852391_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|4852383_4852935_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087308.1|4852931_4854083_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.0	2.8e-214
WP_000620697.1|4854079_4854304_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.3e-38
WP_000061519.1|4854300_4855119_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_015674830.1|4855115_4855610_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.6e-84
WP_001442792.1|4855609_4856263_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|4856259_4856586_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|4856582_4856972_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061378.1|4856991_4857801_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_023352842.1|4857808_4858798_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_080086273.1|4858812_4859193_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_000357056.1|4859207_4860227_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_000917724.1|4860546_4860750_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|4860900_4861953_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|4862020_4862236_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|4862235_4862733_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|4862729_4863197_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
4862898:4862913	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
WP_001139675.1|4863184_4863337_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001205130.1|4863478_4863655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373426.1|4864012_4864507_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_174190375.1|4864506_4866609_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|4866605_4866818_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072652320.1|4866745_4868293_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.2e-283
WP_001201739.1|4869887_4870271_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|4870267_4870615_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|4870664_4872200_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_001459761.1|4872829_4873153_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	4.2e-51
WP_001283153.1|4873145_4873421_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|4873432_4874011_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079415.1|4874007_4874409_+|tail	phage tail protein U	tail	A5LH34	Enterobacteria_phage	98.5	1.2e-71
WP_001401822.1|4874419_4875163_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.8	1.9e-131
WP_001370402.1|4875223_4875610_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|4875618_4875948_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_060614965.1|4875919_4878976_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.4	0.0e+00
WP_000447253.1|4878975_4879305_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|4879314_4880013_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_174190376.1|4880017_4880761_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	2.8e-151
WP_000741576.1|4880658_4881306_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_174190377.1|4881366_4884846_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_032192258.1|4884913_4885513_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.0e-106
WP_174190378.1|4885577_4888736_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	60.2	5.9e-81
>prophage 1
NZ_CP047406	Escherichia coli strain MS6193 plasmid pMS6193A-NDM, complete sequence	142890	17020	71407	142890	protease,transposase	Escherichia_phage(27.27%)	57	NA	NA
WP_152924612.1|17020_18249_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_000053332.1|19255_20266_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
WP_000253905.1|20361_22488_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083369.1|22550_23828_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813680.1|23827_25258_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
WP_001037799.1|25452_26847_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000912556.1|27962_28586_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_001302184.1|30019_30178_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000275854.1|30845_31052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107242.1|31076_31364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234465.1|31482_32304_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	1.7e-43
WP_000949660.1|32599_33172_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001063020.1|33541_33925_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000332520.1|34115_34763_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001352842.1|34898_35114_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000340282.1|35156_35522_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|35536_35848_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399790.1|35869_36436_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_001553834.1|36993_37131_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000741714.1|37152_37314_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038342.1|37306_37558_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_000809832.1|37554_38070_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278692.1|38204_38426_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
WP_001064264.1|38585_41213_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000099690.1|41209_41596_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203720.1|41592_42225_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000205701.1|43539_44286_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.0	9.3e-09
WP_000139363.1|44340_44901_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|45033_45246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968309.1|46349_46532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387399.1|46718_46925_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|47208_47466_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|47701_47776_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|49535_50756_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|50766_51678_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154544.1|51762_52767_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|52814_54218_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|54298_54778_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080217.1|55134_55356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|55386_55737_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|55733_56096_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032147503.1|56930_57509_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|57921_58275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|58746_59769_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|60173_60431_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|60666_60741_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130948.1|60733_61591_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|62529_63183_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|63275_63533_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|63465_63867_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|65147_65852_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|65995_66550_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|66680_67511_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|68142_68847_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|68953_69814_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|69826_70369_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067834.1|70702_71407_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP047406	Escherichia coli strain MS6193 plasmid pMS6193A-NDM, complete sequence	142890	75144	130957	142890	transposase,integrase	Escherichia_phage(33.33%)	51	93209:93223	124758:124772
WP_000050481.1|75144_76686_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|77090_77930_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|77923_78271_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|78434_79226_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|79231_79522_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|79633_80131_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|80275_81289_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|81491_81842_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|81967_82528_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|82530_85497_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|85563_85941_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000449408.1|87226_87385_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000949452.1|87374_87881_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|88063_88879_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|89225_91112_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|91152_91680_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|91783_93163_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|93165_94449_+	ABC transporter permease	NA	NA	NA	NA	NA
93209:93223	attL	GCCGCAAAGTGCTGG	NA	NA	NA	NA
WP_000729220.1|94438_95569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|95573_96269_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267177.1|96255_96741_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|96765_97251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|97960_98665_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000476108.1|100584_101895_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000950177.1|101887_102961_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000922702.1|102966_103791_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_001271561.1|103801_104689_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000338039.1|104678_105557_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000796505.1|106101_106296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077068.1|106528_107419_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000710783.1|107443_107824_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001022265.1|107856_108822_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000562172.1|108867_109620_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387467.1|110224_110509_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421272.1|110508_110784_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105060.1|110889_111183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|111378_112548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042065278.1|113690_113873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|113993_114734_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361612.1|115018_115996_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_000081352.1|119149_120082_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|120068_121472_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|121679_122696_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|122923_123241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|123527_123887_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|123914_124094_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|124098_124479_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|124478_124700_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|124882_126439_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
124758:124772	attR	CCAGCACTTTGCGGC	NA	NA	NA	NA
WP_001553855.1|126435_127719_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.9e-10
WP_001553854.1|127840_130957_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
