The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	768561	843257	5244439	tRNA,integrase,protease,transposase	Stx2-converting_phage(36.36%)	57	764646:764662	814735:814751
764646:764662	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_016232250.1|768561_769695_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_087894478.1|771402_771753_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	2.6e-38
WP_000435656.1|771749_772175_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.8e-33
WP_001149832.1|772836_773754_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|773787_774663_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|774711_776184_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|776187_777018_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|777063_777774_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|777786_778896_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_174147630.1|778945_779881_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|779916_780651_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|780750_781737_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_000074477.1|781894_783088_-	MFS transporter	NA	NA	NA	NA	NA
WP_001403387.1|783223_784948_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287503.1|784948_785896_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015713.1|785895_787638_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750131.1|787634_788972_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|788977_791173_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000477619.1|792844_793171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|794623_796714_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_174147632.1|797318_798932_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.6	1.4e-166
WP_000624723.1|798962_799313_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_000422749.1|799309_799735_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_168725979.1|802345_802927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016232304.1|802973_806831_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	4.1e-225
WP_174147634.1|809301_812817_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001218834.1|813268_814531_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_000234514.1|814909_815617_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
814735:814751	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_001326492.1|816014_818150_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|818199_819456_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|819657_820737_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|820801_821077_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_168725849.1|821104_822157_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|822317_823037_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|823036_823363_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|823546_824266_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394131.1|824441_825488_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745210.1|825604_826612_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239943.1|826766_827903_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174777.1|827895_828489_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000994920.1|828496_828787_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|828783_829350_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|829367_830072_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001326494.1|830089_831070_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|831253_831670_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|831669_832233_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|832341_833292_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|833304_834036_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016232301.1|834115_834823_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|834917_835415_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|835491_836886_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|837309_838464_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_087894487.1|838767_838983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|839118_839250_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001300904.1|839258_841235_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105566.1|841372_842293_+	agmatinase	NA	NA	NA	NA	NA
WP_001326497.1|842498_843257_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	1241486	1321437	5244439	tRNA,portal,transposase,head,lysis,terminase,integrase,tail,capsid,protease	Enterobacteria_phage(53.57%)	88	1251647:1251693	1298443:1298489
WP_000912347.1|1241486_1242872_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143535.1|1242907_1243429_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1243536_1243749_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1243750_1244617_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1245096_1245639_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1245858_1246551_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_168725938.1|1246581_1249191_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|1249203_1250211_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1250221_1250737_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1250739_1251372_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1251647:1251693	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|1251706_1252870_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|1253068_1253347_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001386642.1|1253710_1253992_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|1254002_1254560_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1254552_1254714_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|1254710_1255391_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_049068839.1|1255387_1256173_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.2e-147
WP_000995433.1|1256178_1256475_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1256552_1256759_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000340376.1|1257236_1258100_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000259990.1|1258166_1258922_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1258960_1259191_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1259260_1259800_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_087893615.1|1259796_1260816_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.3e-110
WP_000788891.1|1260812_1261514_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.3	7.1e-128
WP_029488730.1|1261510_1261804_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
WP_000062289.1|1261800_1262001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087893617.1|1262022_1262217_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	76.6	1.0e-23
WP_128491518.1|1262623_1263430_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	29.5	1.1e-15
WP_000017329.1|1263725_1264235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072279669.1|1264324_1264426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052953588.1|1264422_1264878_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.0	6.3e-61
WP_000224914.1|1264877_1265048_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774504.1|1265040_1265331_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1265327_1265690_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|1265686_1265827_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|1265912_1266296_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|1266484_1267567_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|1268155_1268371_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|1268370_1268868_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|1269084_1269267_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_053884742.1|1269357_1269651_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000453587.1|1270317_1270863_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_168725969.1|1270837_1272763_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1272759_1272966_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_134880914.1|1272962_1274564_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.6e-308
WP_134880915.1|1274544_1275864_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	6.9e-233
WP_001299443.1|1275873_1276206_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024232991.1|1276261_1277287_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	7.6e-187
WP_032318908.1|1277328_1277724_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.9e-53
WP_000753001.1|1277735_1278089_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_001541219.1|1278100_1278679_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000683105.1|1278675_1279071_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_168725971.1|1279078_1279819_+	Ig-like domain-containing protein	NA	A0A0K2FJ05	Enterobacteria_phage	98.4	1.4e-129
WP_000479146.1|1279834_1280257_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	3.3e-72
WP_000459457.1|1280238_1280673_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_168725972.1|1280665_1283227_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.6	0.0e+00
WP_069903524.1|1283552_1284251_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_089585290.1|1284256_1285000_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_000090917.1|1284936_1285569_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_174147651.1|1285629_1289043_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.5	0.0e+00
WP_174147653.1|1289112_1289712_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	98.0	1.8e-108
WP_174147655.1|1289776_1292749_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_152066050.1|1292748_1293330_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	5.2e-100
WP_128491441.1|1293449_1294340_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1294358_1294865_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1294901_1295402_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1295480_1295663_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1296167_1296836_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087894369.1|1297066_1298020_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177471.1|1298532_1299294_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1298443:1298489	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224604.1|1299476_1300367_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662357.1|1300367_1303340_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383932.1|1303326_1305564_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253842.1|1305713_1307156_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|1307145_1307829_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074244.1|1307985_1309365_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709880.1|1309391_1309724_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717088.1|1309739_1310963_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573948.1|1310974_1314118_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	9.8e-60
WP_000786319.1|1314219_1315596_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|1315676_1316924_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351487.1|1317031_1317685_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|1317778_1318147_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682509.1|1318211_1318460_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130654.1|1318525_1319644_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|1320095_1320248_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|1320324_1321437_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	1633355	1669066	5244439	transposase,protease,integrase	Stx2-converting_phage(50.0%)	23	1623092:1623107	1652496:1652511
1623092:1623107	attL	TCAATCAGCGTATCAG	NA	NA	NA	NA
WP_000520781.1|1633355_1633676_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1633706_1635983_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|1636500_1637703_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_023356228.1|1637889_1639707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1640818_1641115_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1641341_1641539_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001300563.1|1643030_1644143_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000282076.1|1645362_1645926_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001333439.1|1646600_1651559_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|1651555_1652992_+	hypothetical protein	NA	NA	NA	NA	NA
1652496:1652511	attR	TCAATCAGCGTATCAG	NA	NA	NA	NA
WP_024167628.1|1653096_1653303_+	methyltransferase	NA	NA	NA	NA	NA
WP_001300563.1|1653463_1654576_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000757210.1|1654820_1656710_-	enterotoxin	NA	NA	NA	NA	NA
WP_000459228.1|1656723_1657899_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000192271.1|1657910_1659482_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000195940.1|1659595_1660000_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000072197.1|1660182_1661007_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_000612591.1|1662921_1663269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|1663265_1663646_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001505166.1|1665439_1665652_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001309734.1|1666640_1667075_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_016232761.1|1667071_1667422_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	4.7e-40
WP_000080172.1|1667452_1669066_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
>prophage 4
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	2140031	2209192	5244439	head,holin,terminase,integrase,tail,capsid,protease	Stx2-converting_phage(28.0%)	71	2135493:2135507	2185345:2185359
2135493:2135507	attL	AAAAATAAGCAATCC	NA	NA	NA	NA
WP_000113694.1|2140031_2141162_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	2.0e-103
WP_000113186.1|2141139_2141388_-	excisionase	NA	NA	NA	NA	NA
WP_174147683.1|2141452_2143924_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	6.3e-54
WP_103757222.1|2144018_2144207_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|2144203_2144392_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000373333.1|2145095_2145542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379613.1|2145640_2145793_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_097511883.1|2146062_2146779_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	7.7e-53
WP_000471549.1|2146828_2147044_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693938.1|2147040_2147466_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139447.1|2148574_2149036_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_168725973.1|2149407_2150178_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.3	1.2e-88
WP_147691886.1|2150193_2150589_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	64.2	7.7e-39
WP_000150294.1|2150763_2151429_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000935258.1|2151609_2151822_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_024193993.1|2151989_2152268_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_016232645.1|2152269_2153328_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	1.7e-88
WP_016232627.1|2153328_2153709_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.0e-35
WP_000762902.1|2153705_2154527_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917743.1|2154753_2154951_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_016232051.1|2155101_2156160_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.2	6.8e-191
WP_000271631.1|2156640_2157069_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_174147685.1|2157594_2159574_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	59.7	5.5e-218
WP_024192858.1|2159712_2159895_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	83.3	6.7e-22
WP_001289720.1|2159932_2160223_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	67.7	8.3e-06
WP_000284506.1|2160298_2160514_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_033808946.1|2160518_2160869_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	92.1	3.4e-54
WP_001625285.1|2160932_2161466_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	2.4e-99
WP_000675931.1|2161687_2161801_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_071529499.1|2162022_2162208_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_000735655.1|2162293_2162518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828068.1|2162862_2163189_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095743.1|2163320_2163521_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	6.2e-29
WP_000057924.1|2163562_2163928_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	3.5e-62
WP_000958372.1|2164219_2164783_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_044706948.1|2164779_2166441_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_174147687.1|2166504_2168442_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_174147689.1|2168486_2168708_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	1.7e-35
WP_000126002.1|2171234_2171561_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
WP_001007900.1|2171570_2171921_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	98.3	1.7e-58
WP_000573400.1|2171917_2172364_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_000133383.1|2172360_2172705_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275434.1|2172771_2173488_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2173502_2173877_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001513217.1|2173972_2174182_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_174147691.1|2174229_2177472_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.4	0.0e+00
WP_000807940.1|2177464_2177806_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_115187404.1|2177805_2178504_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	98.7	8.1e-132
WP_174147693.1|2178514_2179258_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.2e-146
WP_128972936.1|2179203_2179836_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	4.2e-103
WP_174147695.1|2180085_2183616_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	81.9	0.0e+00
WP_174147697.1|2185333_2185915_+	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	90.5	3.9e-95
2185345:2185359	attR	AAAAATAAGCAATCC	NA	NA	NA	NA
WP_174147698.1|2186598_2187759_+	YadA-like family protein	NA	Q9LA60	Enterobacterial_phage	85.8	9.0e-144
WP_021577509.1|2187847_2188318_+	hypothetical protein	NA	A0A2L1IV29	Escherichia_phage	99.4	5.0e-85
WP_174147700.1|2188591_2192617_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	98.4	0.0e+00
WP_001079505.1|2193528_2194035_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056490.1|2194080_2194581_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2194666_2194846_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2195226_2196033_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2196032_2197226_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983871.1|2197237_2198599_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763511.1|2198599_2200195_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|2200194_2201757_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2201848_2201893_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2202030_2202912_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2202908_2203529_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|2203556_2205452_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|2205662_2206538_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2206577_2207168_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|2207164_2207923_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|2208142_2209192_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	2284175	2334511	5244439	tRNA,lysis,holin,terminase,tail	Escherichia_phage(52.38%)	52	NA	NA
WP_000628058.1|2284175_2285408_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2285662_2286646_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2287123_2288497_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2288625_2289561_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000079604.1|2290848_2291064_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2291142_2291352_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2291344_2291539_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2291594_2292404_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000632297.1|2295098_2295374_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_016232653.1|2295448_2295619_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	73.2	1.6e-17
WP_000560223.1|2295618_2295840_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2296281_2296770_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_016232654.1|2296766_2296922_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_000948459.1|2297375_2297852_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2297975_2298272_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2298294_2298717_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_016232655.1|2298729_2299587_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.9	4.1e-69
WP_000450660.1|2300362_2301124_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_001403739.1|2301139_2301571_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_000385105.1|2301764_2302919_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_016232657.1|2302893_2305158_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_087893974.1|2305574_2306174_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	6.1e-104
WP_000247763.1|2306173_2306464_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|2306460_2307003_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|2308047_2308476_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2308647_2309022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072971597.1|2309273_2309489_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	1.4e-31
WP_001135310.1|2309488_2309986_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228696.1|2310202_2310388_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2310584_2312042_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_016232661.1|2312179_2312971_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	3.7e-48
WP_000613571.1|2313831_2314083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|2314086_2315181_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|2315161_2316463_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763702.1|2316465_2317872_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_001363932.1|2317855_2318968_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|2319072_2319837_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|2319935_2321075_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|2321117_2321294_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000524260.1|2321692_2322076_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029819.1|2322076_2322457_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_016232664.1|2322453_2322846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016232665.1|2322872_2323835_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_122452218.1|2323985_2324345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|2324452_2324653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033866456.1|2324818_2328052_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.1e-112
WP_000024051.1|2328044_2328383_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_114424623.1|2328382_2329081_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	7.1e-128
WP_136764998.1|2329086_2329830_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.3e-148
WP_052920620.1|2329766_2330369_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	1.4e-87
WP_174147706.1|2330428_2333842_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_001230279.1|2333911_2334511_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	1.3e-109
>prophage 6
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	2531702	2586914	5244439	portal,head,lysis,terminase,integrase,transposase,tail,capsid	Enterobacteria_phage(36.0%)	67	2537045:2537059	2590304:2590318
WP_000527809.1|2531702_2533163_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_120795384.1|2535136_2535250_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2535318_2535552_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|2535868_2536459_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885595.1|2536556_2537132_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
2537045:2537059	attL	CGTCACCTTCACCAA	NA	NA	NA	NA
WP_174147712.1|2537131_2540239_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.9	3.1e-82
WP_016232698.1|2540303_2540903_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.7e-106
WP_000090917.1|2545938_2546571_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_089585290.1|2546507_2547251_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_069903524.1|2547256_2547955_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_168725972.1|2548280_2550842_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.6	0.0e+00
WP_000459457.1|2550834_2551269_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479146.1|2551250_2551673_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	3.3e-72
WP_168725971.1|2551688_2552429_-	Ig-like domain-containing protein	NA	A0A0K2FJ05	Enterobacteria_phage	98.4	1.4e-129
WP_000683105.1|2552436_2552832_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001541219.1|2552828_2553407_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000753001.1|2553418_2553772_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_032318908.1|2553783_2554179_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.9e-53
WP_024232991.1|2554220_2555246_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	7.6e-187
WP_001299443.1|2555301_2555634_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_134880915.1|2555643_2556963_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	6.9e-233
WP_134880914.1|2556943_2558545_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.6e-308
WP_000198149.1|2558541_2558748_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_168725969.1|2558744_2560670_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|2560644_2561190_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_032156745.1|2561578_2561812_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	82.5	4.3e-21
WP_000373090.1|2561869_2562280_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2562431_2562605_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2562776_2562932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2563011_2563077_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2563079_2563268_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2563278_2563491_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2563853_2564351_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2564347_2564881_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2564877_2565189_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2565193_2565409_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2566162_2566378_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2566678_2566891_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2566945_2567035_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2567312_2568065_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001424248.1|2568078_2569128_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	7.4e-113
WP_012304870.1|2569129_2569408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2569474_2569726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2569942_2570098_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2570169_2570457_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2570456_2570696_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2570720_2571026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2571228_2571561_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2571997_2573311_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2573488_2573671_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|2574977_2575334_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|2575330_2575753_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|2575793_2576759_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|2576739_2577261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2577244_2577472_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2577549_2577957_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_016232058.1|2578149_2578305_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	7.5e-06
WP_000344953.1|2578306_2578882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2579368_2579557_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2579553_2579745_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_174147714.1|2579838_2582310_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2582382_2582634_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_016232059.1|2582668_2583949_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.5e-155
WP_001360138.1|2583968_2584079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725977.1|2584136_2585156_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|2585167_2586382_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_168725976.1|2586587_2586914_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.3e-23
2590304:2590318	attR	TTGGTGAAGGTGACG	NA	NA	NA	NA
>prophage 7
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	2591260	2658897	5244439	lysis,holin,integrase,bacteriocin,transposase,capsid	Escherichia_phage(47.14%)	75	2627637:2627653	2663240:2663256
WP_001171554.1|2591260_2591641_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2591637_2591985_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2592034_2593573_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001340362.1|2594246_2596670_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213043.1|2596680_2596794_+	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_021571279.1|2597209_2597845_+	antA/AntB antirepressor family protein	NA	A0A0N6WET9	Escherichia_phage	84.0	6.7e-93
WP_001145450.1|2598041_2599268_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.7	2.4e-62
WP_000528463.1|2599252_2599897_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.2	1.5e-55
WP_001625096.1|2599985_2600474_-	SocA family protein	NA	NA	NA	NA	NA
WP_174147716.1|2600660_2609039_-	hypothetical protein	NA	G3CFQ0	Escherichia_phage	93.1	0.0e+00
WP_016232703.1|2609123_2610386_-	hypothetical protein	NA	A0A2R2Z372	Escherichia_phage	86.0	5.1e-177
WP_000540391.1|2610396_2610648_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_016232704.1|2610657_2611104_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	98.0	2.6e-75
WP_016232066.1|2611106_2611763_-	hypothetical protein	NA	A0A088CD74	Shigella_phage	97.7	4.8e-102
WP_016232705.1|2611856_2612258_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	100.0	5.4e-72
WP_000078907.1|2612314_2612455_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_001539074.1|2612686_2613424_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	4.1e-110
WP_024185469.1|2613503_2614121_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	97.6	2.4e-119
WP_032159055.1|2614126_2614408_-	hypothetical protein	NA	A0A2L1IV69	Escherichia_phage	98.9	5.3e-50
WP_000162957.1|2614422_2615691_-	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	98.3	4.2e-235
WP_097747140.1|2615687_2617313_-	hypothetical protein	NA	A0A2L1IV27	Escherichia_phage	99.8	0.0e+00
WP_168725994.1|2617493_2617676_-	hypothetical protein	NA	A0A2L1IV33	Escherichia_phage	98.3	1.9e-24
WP_021565060.1|2617675_2618146_-	hypothetical protein	NA	A0A2L1IV29	Escherichia_phage	100.0	7.7e-86
WP_174147718.1|2618234_2619494_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	43.3	4.1e-57
WP_032182038.1|2620301_2620895_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	69.0	3.0e-71
WP_000207910.1|2622807_2623458_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|2623457_2624021_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290750.1|2624004_2624466_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	100.0	3.1e-71
WP_001140438.1|2624516_2624909_-	hypothetical protein	NA	A0A088CD63	Shigella_phage	88.5	1.2e-55
WP_016232077.1|2624963_2626178_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	98.8	1.6e-231
WP_021565201.1|2626200_2627208_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	95.8	1.9e-174
WP_032298132.1|2627365_2629510_-	hypothetical protein	NA	A0A088CE71	Shigella_phage	97.8	0.0e+00
2627637:2627653	attL	TGTTGCTCCAGCGCCTG	NA	NA	NA	NA
WP_000143995.1|2629509_2631216_-	hypothetical protein	NA	A0A2L1IV76	Escherichia_phage	99.8	0.0e+00
WP_001624796.1|2631196_2632048_-	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	82.7	5.1e-96
WP_001824833.1|2632349_2632817_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	94.2	3.3e-73
WP_001280930.1|2632824_2632956_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	93.0	1.0e-11
WP_021566721.1|2632970_2633153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021565205.1|2633309_2633843_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	89.3	1.1e-91
WP_024194161.1|2633847_2634063_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	91.5	1.4e-31
WP_096980659.1|2634139_2634430_-	DUF826 domain-containing protein	NA	A0A0N7KZI7	Stx2-converting_phage	64.6	5.4e-05
WP_024192660.1|2634455_2634650_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	89.8	1.9e-22
WP_000874521.1|2634791_2636765_-	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	58.5	2.8e-214
WP_001241329.1|2638215_2638830_-	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	86.4	1.5e-97
WP_000994506.1|2639064_2639265_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	74.2	1.6e-21
WP_001624518.1|2639261_2639624_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	97.5	5.0e-61
WP_024194163.1|2639620_2639911_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	3.5e-49
WP_001254269.1|2639934_2640126_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	91.2	8.0e-26
WP_001076830.1|2640122_2640533_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	97.8	5.2e-70
WP_021571289.1|2640587_2641262_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	76.8	9.0e-88
WP_016232083.1|2641579_2641909_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	73.6	1.4e-33
WP_000147082.1|2641898_2642207_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	90.2	2.2e-41
WP_001624507.1|2642261_2642507_-	hypothetical protein	NA	A0A088CC19	Shigella_phage	95.1	1.3e-36
WP_032144013.1|2642505_2643180_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	98.2	5.6e-122
WP_000196185.1|2643212_2643644_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	78.3	8.7e-60
WP_021571292.1|2644456_2645197_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	98.0	4.0e-137
WP_168725754.1|2645203_2646292_-	DNA-binding protein	NA	V5URT9	Shigella_phage	96.7	1.4e-199
WP_000438870.1|2646312_2646531_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000084293.1|2646545_2646842_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	99.0	1.2e-47
WP_001054988.1|2646958_2647183_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	100.0	1.2e-36
WP_001369130.1|2647293_2648001_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	100.0	2.7e-127
WP_000502040.1|2648153_2648375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256291.1|2648708_2649014_+	hypothetical protein	NA	C6ZCW1	Enterobacteria_phage	83.5	1.4e-35
WP_001140061.1|2649224_2649410_+	hypothetical protein	NA	V5URU3	Shigella_phage	97.8	1.9e-16
WP_001005964.1|2649441_2649801_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	73.5	2.7e-38
WP_000189938.1|2649769_2649979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560214.1|2650435_2650657_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_016238038.1|2650740_2651127_+	hypothetical protein	NA	V5USC5	Shigella_phage	79.7	3.3e-50
WP_021571294.1|2651234_2653307_+	hypothetical protein	NA	V5UQJ3	Shigella_phage	85.7	0.0e+00
WP_000995032.1|2653303_2653600_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_000100829.1|2653605_2654391_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_021571295.1|2654387_2655068_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	97.8	7.4e-130
WP_000497817.1|2655115_2655367_+	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	91.6	3.9e-36
WP_001387389.1|2655628_2656792_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000526503.1|2657385_2658240_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2658282_2658897_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
2663240:2663256	attR	TGTTGCTCCAGCGCCTG	NA	NA	NA	NA
>prophage 8
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	3225474	3337278	5244439	tRNA,head,lysis,holin,terminase,transposase,tail,capsid,protease	Enterobacteria_phage(35.56%)	122	NA	NA
WP_000476014.1|3225474_3226836_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001394463.1|3227165_3227483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807345.1|3227896_3228796_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000481293.1|3228869_3229523_-	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
WP_000060034.1|3229567_3230845_-	MFS transporter	NA	NA	NA	NA	NA
WP_000280578.1|3230913_3232377_-	xylulokinase	NA	NA	NA	NA	NA
WP_001005232.1|3232390_3233758_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001030845.1|3233970_3234912_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000198985.1|3234914_3235946_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_168725901.1|3236107_3236857_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000156561.1|3236867_3238472_+	FGGY family pentulose kinase	NA	NA	NA	NA	NA
WP_000089321.1|3238573_3239848_+	MFS transporter	NA	NA	NA	NA	NA
WP_000129550.1|3239904_3240957_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|3241213_3242491_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846230.1|3242487_3243492_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	6.4e-13
WP_001352368.1|3243649_3244858_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_168725898.1|3245765_3246512_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_001352238.1|3246563_3247382_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822266.1|3247446_3248247_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195568.1|3248243_3249032_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|3249254_3249527_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134632.1|3249647_3250472_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|3250690_3251029_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405695.1|3251110_3252145_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945452.1|3252160_3254641_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|3254656_3255331_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830456.1|3255410_3255953_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|3256245_3256527_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|3256789_3257899_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001350533.1|3258030_3260064_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_000356822.1|3264008_3267641_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636925.1|3267701_3268019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128491496.1|3268325_3269414_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294387.1|3269424_3271704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333512.1|3271696_3272833_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|3272829_3274830_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_168725899.1|3274954_3275416_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	9.2e-76
WP_000950409.1|3275455_3275926_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|3275972_3276692_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3276688_3278374_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_087893591.1|3278888_3279137_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	80.2	2.7e-29
WP_021565261.1|3279173_3279347_-	hypothetical protein	NA	A0A2L1IV33	Escherichia_phage	67.2	6.4e-14
WP_032217753.1|3279351_3279825_-	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	94.2	1.8e-79
WP_174147746.1|3279913_3281191_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	48.9	9.4e-78
WP_174147697.1|3281874_3282456_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	90.5	3.9e-95
WP_032217644.1|3284140_3284740_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	89.9	1.1e-97
WP_174147748.1|3284807_3288281_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.4	0.0e+00
WP_128972936.1|3288623_3289256_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	4.2e-103
WP_032270996.1|3289201_3289945_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	2.0e-144
WP_032270922.1|3289955_3290654_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	95.7	7.8e-127
WP_103757175.1|3290850_3292005_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.3e-128
WP_001672459.1|3292220_3292562_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	92.9	5.8e-59
WP_174147749.1|3292554_3295821_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	79.4	0.0e+00
WP_001513217.1|3295868_3296078_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|3296173_3296548_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3296562_3297279_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133383.1|3297345_3297690_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573400.1|3297686_3298133_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_001007900.1|3298129_3298480_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	98.3	1.7e-58
WP_000126002.1|3298489_3298816_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
WP_001063093.1|3301504_3301726_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	97.3	6.4e-35
WP_174147751.1|3301770_3303708_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_128491545.1|3303771_3305433_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.0	0.0e+00
WP_000958405.1|3305429_3305993_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	81.2	1.1e-67
WP_000829187.1|3306284_3306650_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.7e-62
WP_000095740.1|3306691_3306892_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	2.1e-29
WP_174147753.1|3307090_3307315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174147755.1|3307311_3307806_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	92.2	1.1e-71
WP_001280930.1|3307813_3307945_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	93.0	1.0e-11
WP_021566721.1|3307959_3308142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032217553.1|3308298_3308832_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	94.4	3.4e-98
WP_168726030.1|3309065_3309596_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.8	5.3e-51
WP_021565269.1|3309588_3309816_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	3.6e-33
WP_001289720.1|3309891_3310182_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	67.7	8.3e-06
WP_024235164.1|3310207_3310402_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	83.3	7.9e-21
WP_174147757.1|3310549_3312529_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	59.5	2.5e-218
WP_000216690.1|3313508_3313673_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_016237410.1|3313669_3314101_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	2.7e-69
WP_016237411.1|3314407_3314926_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_001107959.1|3314969_3315575_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	99.0	1.9e-97
WP_001004036.1|3315574_3316297_-	phage antirepressor protein	NA	A0A0N7KZI6	Stx2-converting_phage	92.1	1.5e-117
WP_044706958.1|3316371_3317076_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	91.5	6.5e-121
WP_001254242.1|3317350_3317533_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	96.7	2.2e-28
WP_033808057.1|3317529_3318057_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	3.6e-100
WP_134880860.1|3318053_3318500_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	97.3	1.1e-78
WP_032326218.1|3318456_3318693_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	98.7	1.0e-38
WP_000103679.1|3318703_3318919_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_044695145.1|3319004_3319295_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.9	9.0e-45
WP_174147758.1|3319291_3319993_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	99.1	4.9e-129
WP_134880859.1|3319989_3320895_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	73.1	3.9e-118
WP_016238079.1|3320887_3321034_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	97.9	3.3e-19
WP_174147760.1|3321066_3321363_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	3.7e-46
WP_032182603.1|3321504_3321720_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	95.8	6.9e-34
WP_168725991.1|3321796_3322492_+	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	95.2	2.1e-127
WP_000885926.1|3322501_3322843_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001207140.1|3322913_3323348_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_168725990.1|3323344_3323965_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_000198439.1|3324460_3324844_+	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	3.3e-63
WP_000095078.1|3324905_3325529_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	93.2	3.2e-103
WP_001198858.1|3325753_3325894_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361825.1|3325886_3326030_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	3.5e-18
WP_000995422.1|3326103_3326400_+	host-nuclease inhibitor protein Gam	NA	A0A1U9AJD6	Stx1_converting_phage	100.0	2.1e-49
WP_049068839.1|3326405_3327191_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.2e-147
WP_174147762.1|3327187_3327868_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000682303.1|3327864_3328023_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	100.0	3.1e-23
WP_000581108.1|3328019_3328772_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	8.4e-151
WP_000151207.1|3328779_3328995_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
WP_000774248.1|3329093_3329315_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_168725981.1|3329311_3330127_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	78.4	1.4e-106
WP_001261532.1|3330126_3330303_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	86.2	1.2e-20
WP_016232199.1|3330671_3330881_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	97.1	6.1e-35
WP_016232200.1|3330877_3331327_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.0	2.3e-39
WP_016232201.1|3331551_3331740_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	91.9	1.4e-25
WP_174147764.1|3331743_3332688_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	55.7	1.6e-74
WP_087893736.1|3332772_3333015_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	86.2	1.6e-31
WP_032270192.1|3333018_3333153_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	90.9	2.1e-20
WP_168725982.1|3333171_3333426_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	1.9e-43
WP_016232204.1|3333459_3334746_+	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	99.3	8.4e-252
WP_029208472.1|3334766_3335468_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_001216963.1|3335527_3335635_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3335615_3336347_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|3336351_3337278_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 9
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	3585218	3647942	5244439	lysis,holin,integrase,tail,capsid	Escherichia_phage(76.56%)	70	3586226:3586250	3648137:3648161
WP_000368140.1|3585218_3586151_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
3586226:3586250	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_174147770.1|3586372_3594757_-	hypothetical protein	NA	G3CFQ0	Escherichia_phage	91.7	0.0e+00
WP_016232065.1|3594842_3596105_-	hypothetical protein	NA	A0A2R2Z372	Escherichia_phage	77.9	2.7e-170
WP_000540393.1|3596115_3596367_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455643.1|3596376_3596823_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_016232066.1|3596825_3597482_-	hypothetical protein	NA	A0A088CD74	Shigella_phage	97.7	4.8e-102
WP_016232705.1|3597575_3597977_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	100.0	5.4e-72
WP_000078907.1|3598033_3598174_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_174147771.1|3598405_3599140_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.5e-107
WP_024185469.1|3599226_3599844_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	97.6	2.4e-119
WP_032159055.1|3599849_3600131_-	hypothetical protein	NA	A0A2L1IV69	Escherichia_phage	98.9	5.3e-50
WP_001539076.1|3600145_3601414_-	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	96.9	1.5e-232
WP_016232069.1|3601410_3603036_-	hypothetical protein	NA	A0A2L1IV27	Escherichia_phage	99.8	0.0e+00
WP_168725994.1|3603216_3603399_-	hypothetical protein	NA	A0A2L1IV33	Escherichia_phage	98.3	1.9e-24
WP_021565060.1|3603398_3603869_-	hypothetical protein	NA	A0A2L1IV29	Escherichia_phage	100.0	7.7e-86
WP_174147746.1|3603957_3605235_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	48.9	9.4e-78
WP_174147772.1|3606042_3606621_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	89.9	4.7e-93
WP_174147773.1|3606640_3608674_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	97.0	2.3e-62
WP_000207910.1|3608670_3609321_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|3609320_3609884_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290750.1|3609867_3610329_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	100.0	3.1e-71
WP_001140438.1|3610379_3610772_-	hypothetical protein	NA	A0A088CD63	Shigella_phage	88.5	1.2e-55
WP_016232077.1|3610826_3612041_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	98.8	1.6e-231
WP_021565201.1|3612063_3613071_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	95.8	1.9e-174
WP_032298132.1|3613228_3615373_-	hypothetical protein	NA	A0A088CE71	Shigella_phage	97.8	0.0e+00
WP_000143995.1|3615372_3617079_-	hypothetical protein	NA	A0A2L1IV76	Escherichia_phage	99.8	0.0e+00
WP_001624796.1|3617059_3617911_-	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	82.7	5.1e-96
WP_001824833.1|3618212_3618680_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	94.2	3.3e-73
WP_001280930.1|3618687_3618819_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	93.0	1.0e-11
WP_021566721.1|3618833_3619016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021565205.1|3619172_3619706_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	89.3	1.1e-91
WP_024194161.1|3619710_3619926_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	91.5	1.4e-31
WP_096980659.1|3620002_3620293_-	DUF826 domain-containing protein	NA	A0A0N7KZI7	Stx2-converting_phage	64.6	5.4e-05
WP_024192660.1|3620318_3620513_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	89.8	1.9e-22
WP_000874521.1|3620654_3622628_-	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	58.5	2.8e-214
WP_072005598.1|3623238_3624366_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044809592.1|3624416_3626429_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.7	6.4e-81
WP_174147774.1|3626458_3626950_+	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_016232225.1|3627106_3627262_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	2.7e-16
WP_001204831.1|3627461_3627887_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	73.2	1.2e-53
WP_016232226.1|3627879_3628080_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	92.4	6.9e-28
WP_174147814.1|3628076_3628640_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	97.3	7.0e-102
WP_016232228.1|3628647_3629097_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	99.3	2.2e-82
WP_016232229.1|3629096_3630068_-	toprim domain-containing protein	NA	A0A0H4IPK0	Shigella_phage	99.4	9.4e-195
WP_016232230.1|3630057_3631578_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.6	1.9e-306
WP_016232231.1|3631571_3631949_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	96.0	8.4e-59
WP_077769202.1|3632116_3632311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240875.1|3632481_3632685_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_016232232.1|3632780_3633494_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	99.6	2.4e-131
WP_106888904.1|3634747_3635533_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	86.6	3.7e-125
WP_000934197.1|3635827_3636109_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|3636129_3636411_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_016232236.1|3636427_3637378_+	recombinase RecT	NA	A0A0H4IQ64	Shigella_phage	99.4	3.5e-178
WP_069371324.1|3637374_3638073_+	YqaJ viral recombinase family protein	NA	A0A2L1IV73	Escherichia_phage	99.1	1.9e-133
WP_033807808.1|3638065_3638653_+	hypothetical protein	NA	A0A2L1IV75	Escherichia_phage	100.0	5.2e-108
WP_001071603.1|3638727_3639075_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_033808859.1|3639138_3639960_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	99.6	4.3e-148
WP_033807623.1|3640036_3640513_+	hypothetical protein	NA	A0A2L1IV82	Escherichia_phage	100.0	1.3e-85
WP_047660376.1|3640669_3641284_+	DUF551 domain-containing protein	NA	A0A2L1IV16	Escherichia_phage	99.5	1.3e-120
WP_033807712.1|3641963_3642746_+	Bro-N domain-containing protein	NA	A0A2L1IV39	Escherichia_phage	100.0	1.0e-146
WP_113449161.1|3642788_3643094_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	99.0	9.8e-50
WP_033805719.1|3643104_3643425_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_148711987.1|3643417_3643789_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_128491445.1|3644133_3644811_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	87.6	8.7e-107
WP_033807709.1|3644861_3645293_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	95.8	5.4e-70
WP_016232246.1|3645289_3645916_+	hypothetical protein	NA	A0A2R2Z304	Escherichia_phage	99.5	3.1e-122
WP_016232247.1|3645875_3646088_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.6	2.7e-30
WP_033807707.1|3646123_3646528_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	93.3	4.5e-50
WP_000453637.1|3646606_3646789_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3646772_3647942_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
3648137:3648161	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 10
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	4002230	4015413	5244439		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|4002230_4004792_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|4004897_4005554_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|4005604_4006372_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847979.1|4006567_4007476_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_174147776.1|4007472_4008735_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	2.2e-135
WP_001278994.1|4008731_4009370_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_168725907.1|4009374_4010151_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104459.1|4010239_4011604_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|4011697_4012690_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|4012752_4013892_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|4014031_4014658_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4014651_4015413_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 11
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	4104890	4144490	5244439	transposase,plate,integrase	Enterobacteria_phage(28.57%)	36	4098794:4098807	4116492:4116505
4098794:4098807	attL	TAATCCCAGCACCA	NA	NA	NA	NA
WP_000772650.1|4104890_4106105_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
WP_000893278.1|4106461_4107715_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|4107726_4108830_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|4109117_4110173_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|4110211_4110613_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|4110670_4111915_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4112006_4112465_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|4112725_4114183_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001352051.1|4114239_4114797_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|4114708_4114975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|4115280_4115733_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|4115742_4116141_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|4116143_4116437_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4116488_4117544_-	DNA polymerase IV	NA	NA	NA	NA	NA
4116492:4116505	attR	TAATCCCAGCACCA	NA	NA	NA	NA
WP_000207552.1|4117614_4118400_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|4118344_4120084_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|4120307_4120805_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|4120980_4121730_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|4121939_4122200_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|4122202_4122481_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4122636_4123377_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4123347_4124115_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4124320_4124899_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|4125138_4127583_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4127625_4128099_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|4128252_4129023_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|4129063_4130200_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|4130630_4131023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097748248.1|4131000_4135245_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001142958.1|4137671_4138190_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4138884_4139385_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4139419_4139644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174147779.1|4139694_4141170_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|4141176_4141590_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|4141593_4143444_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4143407_4144490_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NZ_CP053284	Escherichia coli strain SCU-104 chromosome, complete genome	5244439	4499772	4546183	5244439	integrase,holin,transposase	Stx2-converting_phage(30.0%)	34	4529509:4529523	4552550:4552564
WP_085947772.1|4499772_4500986_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001069724.1|4502347_4503220_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001330680.1|4503329_4504349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001170560.1|4505841_4506414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639386.1|4506499_4506778_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000453332.1|4507404_4507614_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_114493573.1|4508360_4508930_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|4509189_4509591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221620.1|4509578_4510013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4510367_4510748_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4510744_4511092_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_174147789.1|4511141_4512479_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.2	1.3e-247
WP_000823238.1|4512717_4514076_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4514826_4515084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4516834_4517356_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4517352_4518306_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188285.1|4518392_4520717_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879152.1|4520761_4521664_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125177.1|4521660_4522659_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_174147791.1|4522655_4523612_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4523612_4524380_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4524937_4525195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|4527284_4528397_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000587091.1|4528563_4528719_-	hypothetical protein	NA	NA	NA	NA	NA
4529509:4529523	attL	CCCCAGCTCTTTCAT	NA	NA	NA	NA
WP_162130073.1|4530279_4531122_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001825888.1|4531124_4532213_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001300030.1|4532217_4533168_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_012601883.1|4533232_4534177_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001293435.1|4535664_4537662_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_032262819.1|4537724_4539095_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_059259442.1|4539246_4539408_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297096.1|4539451_4540231_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_012601875.1|4541033_4542050_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_001218934.1|4544917_4546183_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.8	6.2e-82
4552550:4552564	attR	ATGAAAGAGCTGGGG	NA	NA	NA	NA
