The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	0	44497	4957282	portal,head,terminase,lysis,holin,tail,protease,capsid,plate	Escherichia_phage(62.5%)	52	NA	NA
WP_174166896.1|0_2286_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_024187708.1|2285_2738_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	7.9e-80
WP_021519103.1|3168_3762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174166894.1|3944_4130_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	84.9	1.4e-14
WP_062878017.1|4168_5203_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	9.3e-201
WP_023140584.1|5202_6975_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_174166897.1|7148_8003_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	97.9	4.3e-135
WP_023567679.1|8061_9135_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	3.9e-202
WP_174166898.1|9138_9882_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.4	7.1e-126
WP_000988633.1|9981_10491_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|10490_10694_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|10697_10979_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_174166899.1|10978_11476_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000736556.1|11490_11916_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	97.9	2.7e-61
WP_174166900.1|11903_12329_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	2.1e-66
WP_072146842.1|12300_12474_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000917151.1|12436_12904_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_174166901.1|12896_13349_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_174166902.1|13415_14051_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.3e-112
WP_000127164.1|14047_14395_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_021525816.1|14399_15308_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	5.7e-162
WP_001285340.1|15300_15912_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_010835463.1|18901_19495_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	1.0e-103
WP_174166903.1|19554_20745_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001251408.1|20757_21276_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|21332_21608_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|21640_21760_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_174166904.1|21752_24200_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	92.9	0.0e+00
WP_174166905.1|24214_24694_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	3.3e-84
WP_174166906.1|24693_25857_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.2	1.2e-204
WP_000468308.1|25938_26157_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000416606.1|26297_26939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|27146_28049_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|28229_29192_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045705.1|29510_30500_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_023155169.1|30606_31362_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|31416_32184_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|32291_32891_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|32991_33432_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|33643_33943_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|33969_34398_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796322.1|34402_35149_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250651.1|35245_36256_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136781.1|36485_37994_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|38016_38862_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|39287_39533_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000232688.1|39571_40198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301616.1|40320_40995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872908.1|41054_41540_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001308187.1|41632_42559_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|42625_43957_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|43966_44497_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	61255	68502	4957282		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424850.1|61255_61918_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	7.1e-29
WP_001174070.1|61929_64431_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|64739_65819_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|65833_66154_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184816.1|66204_68502_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 3
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	84473	90295	4957282	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125462.1|84473_85790_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.4	2.0e-59
WP_001309117.1|85893_86544_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|86543_86903_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187368.1|86942_88043_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_174166908.1|88411_90295_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	26.8	2.0e-07
>prophage 4
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	98634	101687	4957282		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|98634_99585_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|100502_101687_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 5
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	105682	114011	4957282		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|105682_109711_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|109787_114011_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 6
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	123227	124991	4957282		Klosneuvirus(50.0%)	3	NA	NA
WP_000362385.1|123227_123899_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|123941_124532_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|124718_124991_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 7
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	130359	131949	4957282		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187561.1|130359_131949_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	4.5e-69
>prophage 8
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	147846	151530	4957282		Dickeya_phage(100.0%)	1	NA	NA
WP_000096038.1|147846_151530_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 9
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	176916	178032	4957282		Mycoplasma_phage(100.0%)	1	NA	NA
WP_021557420.1|176916_178032_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	5.6e-18
>prophage 10
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	187246	187855	4957282		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|187246_187855_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 11
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	194482	197030	4957282		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|194482_195898_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147337.1|195950_197030_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
>prophage 12
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	201234	204848	4957282		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001033156.1|201234_204057_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|204311_204848_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 13
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	209514	210864	4957282		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|209514_210864_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 14
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	216448	218407	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078191.1|216448_218407_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 15
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	226919	231386	4957282	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_100245061.1|226919_228268_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000719886.1|228455_229145_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001300547.1|229238_231386_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 16
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	236632	238618	4957282		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066020.1|236632_238618_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.9e-149
>prophage 17
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	244154	245675	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001089390.1|244154_245675_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	7.7e-18
>prophage 18
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	251395	252945	4957282		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611403.1|251395_252076_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	9.3e-08
WP_001075541.1|252186_252945_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	6.1e-16
>prophage 19
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	258700	261646	4957282	transposase	Cedratvirus(50.0%)	3	NA	NA
WP_001193417.1|258700_259489_-	phosphonate ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	30.7	5.0e-13
WP_174166911.1|259621_260065_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_100245061.1|260298_261646_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 20
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	265862	267365	4957282		Burkholderia_virus(100.0%)	1	NA	NA
WP_001313516.1|265862_267365_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 21
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	288564	291776	4957282	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295065.1|288564_290082_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	3.5e-87
WP_174166912.1|290318_291776_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	2.0e-47
>prophage 22
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	306053	308037	4957282		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|306053_306347_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|306390_308037_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 23
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	312504	313038	4957282		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|312504_313038_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 24
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	317958	318936	4957282		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|317958_318936_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 25
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	326364	326910	4957282		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|326364_326910_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 26
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	330825	398236	4957282	transposase,tRNA,protease	Vibrio_phage(23.08%)	66	NA	NA
WP_000990296.1|330825_332163_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_174166913.1|332172_334020_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	5.8e-60
WP_001280339.1|334012_334963_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|335048_335357_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|335433_336714_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|336799_338059_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|338061_339066_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|339147_339345_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|339448_340747_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|340951_341377_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|341415_343857_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|344037_344769_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220132.1|344895_345297_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|345315_346014_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012551.1|346064_346724_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|346741_347140_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101690.1|347149_347788_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943970.1|347790_348954_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	6.4e-81
WP_024262252.1|349037_350663_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|350779_351055_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|351203_351533_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569706.1|351714_352464_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|352460_353216_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|353323_354388_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_023154553.1|354742_356140_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|356155_356461_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776510.1|356470_356935_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|356948_357599_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949514.1|357608_358463_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170808.1|358462_359149_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|359277_359553_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|359879_360275_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|360281_360596_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|360600_360828_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|360869_361319_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_050541734.1|361389_362145_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_174167018.1|364671_364830_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	95.9	3.9e-18
WP_174166914.1|364826_365249_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	98.6	2.1e-66
WP_001119478.1|365383_366022_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|366239_366860_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|367168_368581_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001550499.1|368625_369288_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_020233409.1|369395_370361_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|370469_371330_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001317588.1|371418_371799_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001522389.1|371915_373859_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886900.1|374048_374789_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175286.1|374778_375336_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|375660_375867_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|375928_377272_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|377594_378233_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|378438_380172_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001522396.1|380168_383948_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|383950_384292_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055072.1|384671_385202_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|385511_386468_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|386607_388110_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001297255.1|388123_389146_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|389132_390128_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|390160_391159_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|391334_392708_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|392863_393415_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|393509_394862_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|395044_395431_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|395475_395940_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|396097_398236_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 27
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	401874	407971	4957282		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181312.1|401874_402822_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|403006_403060_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|403200_405897_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|406102_406489_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|406561_407023_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|407035_407971_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 28
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	416242	425476	4957282	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416382.1|416242_419098_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|419097_419541_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|419894_421406_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|421672_422773_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|422772_423855_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016245206.1|423973_425476_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	6.7e-83
>prophage 29
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	430602	431622	4957282		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001318460.1|430602_431622_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 30
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	441273	449631	4957282	transposase,holin	Shigella_phage(20.0%)	7	NA	NA
WP_085948656.1|441273_442440_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|442375_442789_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|442851_444849_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|445002_446159_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|447092_447350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|447906_448674_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|448674_449631_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 31
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	459806	461966	4957282	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998019.1|459806_461192_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|461241_461589_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|461585_461966_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 32
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	486003	486984	4957282		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|486003_486984_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 33
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	490346	492023	4957282		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|490346_490949_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|491426_492023_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 34
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	502290	503751	4957282		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_112033547.1|502290_503751_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 35
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	510216	510903	4957282		Clostridioides_phage(100.0%)	1	NA	NA
WP_164550099.1|510216_510903_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	43.5	4.3e-37
>prophage 36
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	526819	536634	4957282	transposase	Sodalis_phage(25.0%)	7	NA	NA
WP_089625882.1|526819_527764_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	4.8e-63
WP_089625881.1|528004_529417_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000394276.1|529593_529758_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_089625880.1|529800_530139_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_089625879.1|530353_533617_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.3	2.8e-49
WP_097177238.1|533711_535025_-	restriction endonuclease subunit S	NA	A0A1V0S9X4	Catovirus	31.9	2.2e-05
WP_089625877.1|535014_536634_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.9	1.4e-06
>prophage 37
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	543103	548468	4957282		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_089625874.1|543103_544768_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410140.1|544816_546178_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|546392_547307_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|547445_548468_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 38
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	551692	552972	4957282		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|551692_552430_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|552432_552972_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 39
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	560901	563777	4957282		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|560901_562491_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295410.1|562883_563489_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|563615_563777_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 40
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	569716	571039	4957282		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|569716_571039_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 41
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	577759	583105	4957282		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093814.1|577759_578992_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
WP_000046746.1|579289_580957_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	7.5e-43
WP_112033542.1|581167_583105_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 42
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	586441	588555	4957282		Bacillus_phage(50.0%)	2	NA	NA
WP_001188666.1|586441_587131_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_001219594.1|587130_588555_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	9.4e-10
>prophage 43
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	600323	609392	4957282		Cyanophage(20.0%)	9	NA	NA
WP_000130187.1|600323_601277_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|601391_601979_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|602013_602580_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|602728_603442_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_001520432.1|603467_603872_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|604248_606165_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|606253_607384_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|607487_607697_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|608225_609392_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 44
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	618896	621713	4957282	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286887.1|618896_621713_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 45
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	626119	627268	4957282		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|626119_627268_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 46
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	632771	638432	4957282		Staphylococcus_phage(50.0%)	4	NA	NA
WP_089610140.1|632771_634325_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349922.1|634398_635616_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|635744_636887_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787110.1|636917_638432_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 47
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	646327	648288	4957282		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|646327_646807_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|646892_647126_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001160974.1|647128_647443_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257188.1|647439_648288_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 48
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	657376	662798	4957282		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_089610123.1|657376_660283_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_089559767.1|660446_662798_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.4	3.0e-37
>prophage 49
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	669129	669828	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916289.1|669129_669828_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 50
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	682316	684041	4957282		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032280248.1|682316_684041_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 51
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	710245	711289	4957282		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|710245_711289_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 52
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	715534	716086	4957282		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923728.1|715534_716086_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	2.5e-11
>prophage 53
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	727098	728523	4957282		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|727098_728523_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 54
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	736262	742885	4957282		Mamastrovirus(33.33%)	5	NA	NA
WP_001189615.1|736262_737813_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
WP_001297052.1|738014_740405_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|740610_741147_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|741187_741850_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|741958_742885_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 55
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	746147	747020	4957282		Sodalis_phage(100.0%)	1	NA	NA
WP_000339964.1|746147_747020_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.6	3.2e-61
>prophage 56
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	756983	763789	4957282	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|756983_758402_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937431.1|758440_759367_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|759403_759859_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|760036_760741_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294682.1|760755_761286_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_024257891.1|761359_763789_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.0e-40
>prophage 57
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	768984	769782	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|768984_769782_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 58
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	775693	776038	4957282		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|775693_776038_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 59
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	779967	781392	4957282	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|779967_781392_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 60
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	793011	793770	4957282		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|793011_793770_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 61
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	802598	806714	4957282		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569420.1|802598_803195_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.7e-26
WP_001294774.1|803231_806714_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 62
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	819717	820749	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593998.1|819717_820749_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 63
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	827268	835121	4957282		Indivirus(25.0%)	9	NA	NA
WP_000997019.1|827268_828072_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	1.6e-38
WP_000648585.1|828068_828983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|829223_830024_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211698.1|830101_830872_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|830919_832278_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052714.1|832349_833105_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|833138_833861_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|833857_834325_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|834389_835121_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 64
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	845873	848633	4957282		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614389.1|845873_848633_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.1	5.5e-83
>prophage 65
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	861783	866172	4957282		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_112033770.1|861783_866172_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.7	4.2e-24
>prophage 66
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	872022	875941	4957282		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|872022_872601_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|872806_873574_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|873544_874285_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001695460.1|874440_874719_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|874721_874982_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_112033627.1|875191_875941_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 67
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	886082	898899	4957282	integrase	Enterobacteria_phage(42.86%)	15	881751:881763	897135:897147
881751:881763	attL	CGGGGCCGGGCGG	NA	NA	NA	NA
WP_000749881.1|886082_887138_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|887425_888529_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893266.1|888540_889794_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_041329569.1|890150_891365_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
WP_000565286.1|891493_892291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072422.1|892518_892716_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001515791.1|892793_893594_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	40.7	2.4e-23
WP_061352515.1|893586_894894_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335966.1|894886_895111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001723121.1|895103_895469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204082.1|895461_895695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551487.1|895687_895888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061352516.1|895892_896183_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_061352517.1|896179_897985_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	2.5e-124
897135:897147	attR	CGGGGCCGGGCGG	NA	NA	NA	NA
WP_032194282.1|898368_898899_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	6.2e-07
>prophage 68
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	913878	916077	4957282		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001695466.1|913878_916077_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	26.0	5.1e-39
>prophage 69
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	935568	936420	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174462.1|935568_936420_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.4e-47
>prophage 70
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	942480	945785	4957282		Staphylococcus_phage(50.0%)	4	NA	NA
WP_021556518.1|942480_943350_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001306921.1|943509_944103_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|944114_944351_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_024257800.1|944459_945785_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	4.2e-113
>prophage 71
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	955707	963265	4957282	holin,integrase	Escherichia_phage(33.33%)	6	954668:954681	969739:969752
954668:954681	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001362381.1|955707_956271_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_024257799.1|956515_956650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159084.1|957327_959016_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.1e-61
WP_000089080.1|959029_960502_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301903.1|960515_961103_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|961231_963265_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
969739:969752	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 72
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	976272	980810	4957282		Bacillus_virus(50.0%)	4	NA	NA
WP_000447322.1|976272_977757_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|977749_978721_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750339.1|978717_979674_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692735.1|979760_980810_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.2	1.7e-72
>prophage 73
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	989302	991189	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010304.1|989302_991189_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
>prophage 74
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	994747	995647	4957282		Lactobacillus_phage(100.0%)	1	NA	NA
WP_112033640.1|994747_995647_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	9.4e-16
>prophage 75
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1000188	1004468	4957282		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177952.1|1000188_1003263_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.1	0.0e+00
WP_000805884.1|1003385_1004468_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.4	2.4e-191
>prophage 76
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1011702	1021103	4957282	transposase	Ostreococcus_lucimarinus_virus(20.0%)	9	NA	NA
WP_000044325.1|1011702_1012653_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
WP_001013510.1|1012649_1013663_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
WP_000107624.1|1013937_1015149_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001096705.1|1015250_1015790_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_100245061.1|1015964_1017313_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000419046.1|1017551_1018385_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842102.1|1018477_1019587_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|1019621_1019897_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000078831.1|1020056_1021103_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	3.6e-35
>prophage 77
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1029126	1029894	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939393.1|1029126_1029894_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	6.6e-26
>prophage 78
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1036828	1037986	4957282		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1036828_1037986_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 79
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1045408	1046524	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1045408_1046524_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 80
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1053119	1063082	4957282		Bacillus_phage(60.0%)	7	NA	NA
WP_024257915.1|1053119_1054031_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	1.2e-103
WP_001219298.1|1054155_1055064_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|1055197_1056382_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698913.1|1056507_1059651_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221341.1|1059647_1060850_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	24.1	4.8e-07
WP_000113933.1|1061039_1061729_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|1061786_1063082_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 81
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1071707	1080688	4957282	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1071707_1072835_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1072857_1073190_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1073217_1075065_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1075075_1076047_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1076175_1076523_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1076699_1077584_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001362411.1|1077882_1078422_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1078572_1079022_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001154827.1|1079025_1080129_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_001021161.1|1080217_1080688_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 82
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1104052	1109104	4957282	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1104052_1104676_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1104806_1106081_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_023155153.1|1106268_1108623_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1108831_1109104_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 83
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1112244	1112940	4957282		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817232.1|1112244_1112940_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 84
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1116263	1119810	4957282		Bacillus_phage(100.0%)	2	NA	NA
WP_001235613.1|1116263_1118036_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256211.1|1118028_1119810_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	5.2e-42
>prophage 85
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1128646	1131796	4957282		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1128646_1131796_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 86
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1138804	1147268	4957282		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1138804_1139356_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000121998.1|1139484_1141422_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1141474_1141804_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1141803_1142409_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1142518_1144393_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1144573_1145218_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250105.1|1145349_1146312_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801810.1|1146308_1147268_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
>prophage 87
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1155513	1160111	4957282	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_024257919.1|1155513_1155855_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_100245061.1|1156076_1157425_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000083954.1|1157606_1160111_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
>prophage 88
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1185177	1187316	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_174166929.1|1185177_1187316_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.9	1.0e-23
>prophage 89
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1192968	1193646	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|1192968_1193646_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 90
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1196782	1204511	4957282		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|1196782_1197469_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561832.1|1197465_1199880_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_174166930.1|1200308_1204511_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	2.2e-22
>prophage 91
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1209768	1211550	4957282		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_174166931.1|1209768_1211550_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.9	2.7e-38
>prophage 92
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1217740	1218886	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706356.1|1217740_1218886_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 93
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1230407	1233538	4957282	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|1230407_1231793_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143538.1|1231828_1232350_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1232457_1232670_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1232671_1233538_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 94
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1252675	1262621	4957282		uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_174166933.1|1252675_1257496_-	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	7.5e-19
WP_001160801.1|1257515_1257977_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103440.1|1258004_1259906_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	2.3e-27
WP_000253811.1|1260499_1261948_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.9	2.3e-11
WP_000770953.1|1261937_1262621_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 95
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1265766	1268910	4957282		Leptospira_phage(100.0%)	1	NA	NA
WP_000573997.1|1265766_1268910_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	9.8e-60
>prophage 96
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1279835	1285880	4957282		Tupanvirus(50.0%)	3	NA	NA
WP_000077744.1|1279835_1283717_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	6.4e-61
WP_000096698.1|1283934_1285068_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|1285064_1285880_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 97
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1300240	1302063	4957282		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|1300240_1300870_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_023155206.1|1300842_1302063_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	6.1e-58
>prophage 98
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1305130	1307245	4957282		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1305130_1306696_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|1306816_1307245_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 99
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1322670	1323317	4957282		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1322670_1322880_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|1322933_1323317_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 100
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1328133	1330573	4957282		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1328133_1329345_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231437.1|1329484_1330573_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 101
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1337583	1340166	4957282	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|1337583_1340166_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 102
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1347106	1350639	4957282		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367882.1|1347106_1348777_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	3.0e-76
WP_001207503.1|1348860_1349796_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1349913_1350639_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 103
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1356522	1357563	4957282		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1356522_1357563_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 104
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1361698	1363363	4957282		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337049.1|1361698_1363363_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	1.6e-85
>prophage 105
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1367989	1371859	4957282	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|1367989_1369936_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287134.1|1370194_1371859_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 106
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1376142	1376907	4957282		Mycobacterium_phage(100.0%)	1	NA	NA
WP_174166934.1|1376142_1376907_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	33.3	2.2e-05
>prophage 107
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1383686	1395627	4957282		Hokovirus(40.0%)	10	NA	NA
WP_000186104.1|1383686_1384364_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.5	1.8e-27
WP_001309343.1|1384360_1387045_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_023155195.1|1387037_1387610_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087991.1|1387618_1389667_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.4e-27
WP_000741113.1|1389689_1391363_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|1391362_1391452_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|1391764_1391971_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001076010.1|1392071_1392581_+	YbgA family protein	NA	NA	NA	NA	NA
WP_112033492.1|1392577_1393996_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.8	4.9e-59
WP_023155194.1|1394145_1395627_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	9.3e-45
>prophage 108
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1399005	1399797	4957282		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114030.1|1399005_1399797_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	4.9e-08
>prophage 109
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1443675	1447195	4957282		Vibrio_phage(33.33%)	4	NA	NA
WP_000345395.1|1443675_1444395_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	1.9e-22
WP_000951303.1|1444391_1445333_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000784348.1|1445446_1445827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109196.1|1446142_1447195_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 110
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1451557	1458132	4957282		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|1451557_1452574_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096880.1|1452835_1454308_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|1454375_1455164_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1455292_1455442_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101994.1|1455608_1456382_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1456381_1457071_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891683.1|1457073_1458132_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 111
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1468392	1469682	4957282		Klosneuvirus(100.0%)	1	NA	NA
WP_021556611.1|1468392_1469682_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 112
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1476162	1477071	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_001312684.1|1476162_1477071_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 113
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1487670	1492662	4957282		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_023155186.1|1487670_1489407_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|1489399_1490395_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1490397_1491069_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007108.1|1491297_1492662_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 114
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1497051	1499202	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_001218655.1|1497051_1499202_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
>prophage 115
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1502261	1506128	4957282		Salmonella_phage(33.33%)	4	NA	NA
WP_000146357.1|1502261_1502528_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990162.1|1502601_1503279_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	1.5e-18
WP_000430062.1|1503320_1505603_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1505867_1506128_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 116
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1509812	1515036	4957282		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|1509812_1510535_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|1510531_1511191_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1511328_1512075_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1512478_1512982_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1513280_1514168_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1514402_1514468_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1514520_1515036_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 117
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1520032	1528374	4957282		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|1520032_1521625_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|1521865_1523131_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114248.1|1523282_1524098_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209324.1|1524243_1526676_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_024257802.1|1526681_1527581_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424891.1|1527711_1528374_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	5.7e-26
>prophage 118
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1531589	1533461	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_024257801.1|1531589_1533461_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	1.4e-16
>prophage 119
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1544796	1545999	4957282		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1544796_1545999_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 120
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1555333	1564483	4957282		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|1555333_1555591_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|1555750_1556038_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001612710.1|1556021_1556744_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_112033497.1|1556804_1557707_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	1.5e-37
WP_000203025.1|1557794_1558271_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|1558621_1559734_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|1559828_1560962_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105436.1|1560971_1561925_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061659.1|1561921_1562767_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1562826_1563315_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149720.1|1563355_1564483_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 121
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1571150	1571879	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|1571150_1571879_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 122
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1575556	1576387	4957282		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255155.1|1575556_1576387_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.6	1.5e-07
>prophage 123
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1579974	1581693	4957282		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815358.1|1579974_1581693_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 124
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1590953	1614816	4957282	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188180.1|1590953_1592900_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1592972_1593197_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1593519_1593840_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1593870_1596147_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1596892_1597111_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1597395_1598100_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202193.1|1598141_1599863_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001043591.1|1599863_1601630_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_000537418.1|1601752_1602718_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1603262_1603757_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_089610782.1|1603891_1607998_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1608156_1608768_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1608778_1610122_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1610212_1611505_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850297.1|1611743_1614188_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	2.5e-220
WP_000213089.1|1614198_1614816_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 125
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1619655	1622870	4957282		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111036.1|1619655_1620396_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.1e-21
WP_001292812.1|1620587_1622870_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 126
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1626971	1628060	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_174166937.1|1626971_1628060_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	1.3e-80
>prophage 127
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1633146	1637687	4957282		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1633146_1633431_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705681.1|1633637_1635902_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1635938_1637687_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 128
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1652392	1663324	4957282	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1652392_1652941_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|1652967_1653615_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462689.1|1653664_1654855_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977933.1|1655039_1656110_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.5	1.5e-100
WP_000117885.1|1656712_1658113_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.3	2.4e-82
WP_001307697.1|1658282_1659485_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193850.1|1659750_1662363_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001090510.1|1662556_1663324_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 129
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1679244	1681152	4957282		Tupanvirus(100.0%)	1	NA	NA
WP_000053083.1|1679244_1681152_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 130
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1693766	1695821	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_021577221.1|1693766_1695821_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 131
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1700054	1700714	4957282	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1700054_1700714_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 132
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1719983	1732239	4957282		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1719983_1720196_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1720206_1720395_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001312727.1|1720369_1720600_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1720589_1720763_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818445.1|1720811_1721885_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071789987.1|1721956_1724701_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	29.7	4.1e-38
WP_001264931.1|1724783_1725812_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120116.1|1725784_1726477_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	5.9e-18
WP_023154912.1|1726606_1727779_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_021577291.1|1727778_1730325_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.0e-70
WP_000209878.1|1730321_1730921_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1731013_1731319_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|1731318_1732239_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 133
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1736532	1738632	4957282		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1736532_1736706_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_174166940.1|1736788_1738117_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.3e-235
WP_001028095.1|1738137_1738632_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 134
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1755586	1756375	4957282		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533533.1|1755586_1756375_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.0e-90
>prophage 135
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1763196	1764555	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_000409867.1|1763196_1764555_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	7.3e-20
>prophage 136
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1779485	1780193	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_001192029.1|1779485_1780193_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.4e-35
>prophage 137
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1789740	1790574	4957282		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1789740_1790574_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 138
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1794714	1795248	4957282		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1794714_1795248_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 139
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1804556	1805477	4957282		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1804556_1805477_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 140
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1810139	1810385	4957282		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1810139_1810385_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 141
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1826268	1827210	4957282		Brevibacillus_phage(100.0%)	1	NA	NA
WP_024262209.1|1826268_1827210_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 142
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1839567	1840749	4957282		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1839567_1840302_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1840512_1840749_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 143
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1844021	1845664	4957282		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1844021_1844663_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267908.1|1844659_1845664_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 144
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1857987	1858245	4957282		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1857987_1858245_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 145
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1865532	1873222	4957282		Mycoplasma_phage(50.0%)	8	NA	NA
WP_001033692.1|1865532_1866234_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251344.1|1866233_1867478_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1867506_1868418_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952741.1|1868433_1869255_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	7.3e-23
WP_000759309.1|1869410_1870457_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1870453_1871248_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000799401.1|1871244_1872102_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1872085_1873222_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 146
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1878342	1879713	4957282		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423731.1|1878342_1879713_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
>prophage 147
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1882850	1884101	4957282		Phage_21(100.0%)	1	NA	NA
WP_000444487.1|1882850_1884101_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 148
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1892103	1894767	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_052908566.1|1892103_1894767_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	9.7e-85
>prophage 149
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1903301	1904989	4957282		Morganella_phage(50.0%)	2	NA	NA
WP_000897370.1|1903301_1903721_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	3.1e-38
WP_000457623.1|1903720_1904989_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	1.0e-209
>prophage 150
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1923075	1923834	4957282		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173326.1|1923075_1923834_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.1	7.4e-14
>prophage 151
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1939700	1942452	4957282		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1939700_1941380_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1941504_1942452_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 152
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1945588	1952392	4957282		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|1945588_1946671_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|1946670_1947504_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_174166945.1|1947500_1947893_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1947896_1948706_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1948741_1949596_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|1949743_1949851_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_021577368.1|1950279_1950387_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_024257875.1|1950791_1951892_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146454.1|1952161_1952392_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	38.7	1.9e-05
>prophage 153
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1963525	1973535	4957282		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|1963525_1965064_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571685.1|1965060_1965771_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1965770_1966448_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555853.1|1967173_1968016_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001362540.1|1968065_1968524_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1968636_1969542_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193451.1|1969633_1970647_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1970848_1971757_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1971900_1972314_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|1972917_1973535_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 154
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1981944	1983959	4957282		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|1981944_1982958_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1982954_1983959_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 155
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	1995617	1998575	4957282		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983868.1|1995617_1996979_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.9e-37
WP_000763524.1|1996979_1998575_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
>prophage 156
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2005546	2010838	4957282	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559268.1|2005546_2006305_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2006524_2007574_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|2007609_2007861_-	YciN family protein	NA	NA	NA	NA	NA
WP_001309471.1|2008240_2010838_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	9.2e-88
>prophage 157
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2015762	2016353	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2015762_2016353_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 158
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2024169	2026104	4957282		Lactococcus_phage(100.0%)	1	NA	NA
WP_112033588.1|2024169_2026104_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
>prophage 159
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2035037	2037058	4957282		Salmonella_phage(50.0%)	2	NA	NA
WP_000135022.1|2035037_2036201_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	6.2e-28
WP_000573412.1|2036251_2037058_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 160
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2049847	2051113	4957282		Klosneuvirus(100.0%)	1	NA	NA
WP_023154544.1|2049847_2051113_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	9.2e-25
>prophage 161
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2065127	2066210	4957282		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057989.1|2065127_2066210_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 162
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2084313	2084829	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|2084313_2084829_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 163
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2091155	2150154	4957282	terminase,lysis,transposase,tail,tRNA	Escherichia_phage(46.0%)	62	NA	NA
WP_024257744.1|2091155_2092388_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2092642_2093626_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123746.1|2094103_2095477_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157403.1|2095605_2096541_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.3e-145
WP_112033623.1|2096592_2097828_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.2e-239
WP_000079604.1|2097829_2098045_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2098123_2098333_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_053889809.1|2098325_2098520_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	5.8e-32
WP_000166319.1|2098576_2099386_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105139.1|2099378_2101979_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000632297.1|2102080_2102356_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2102430_2102601_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2102600_2102822_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2103263_2103752_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2103748_2103904_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948460.1|2104357_2104834_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2104957_2105254_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2105276_2105699_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_174166948.1|2105711_2106569_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.6e-65
WP_174166949.1|2106575_2107322_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450660.1|2107344_2108106_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_174166950.1|2108121_2108553_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	3.8e-63
WP_000385105.1|2108746_2109901_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_016232657.1|2109875_2112140_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_087451024.1|2112874_2113994_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000247763.1|2114380_2114671_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|2114667_2115210_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|2116254_2116683_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2116854_2117229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2117480_2117696_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|2117695_2118193_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|2118409_2118595_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|2118791_2120249_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|2120386_2121178_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|2121170_2122103_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|2122038_2122290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059338826.1|2122293_2123388_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	1.7e-112
WP_000625348.1|2123368_2124670_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|2124672_2126079_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000770042.1|2127279_2128044_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|2128142_2129282_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|2129324_2129501_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|2129504_2129900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2129899_2130283_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2130283_2130664_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|2130660_2131053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019440.1|2131121_2132102_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_089589136.1|2132391_2133597_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	36.5	2.4e-54
WP_000024051.1|2133589_2133928_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|2133927_2134626_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_112033792.1|2134631_2135375_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
WP_174166951.1|2135311_2135944_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.6	4.6e-94
WP_174166952.1|2136003_2139483_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_174166953.1|2139549_2140149_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	1.4e-108
WP_174166954.1|2140213_2143615_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_112033700.1|2143614_2144199_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.3	1.4e-100
WP_000968131.1|2144411_2145269_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|2145265_2146123_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983721.1|2146119_2146947_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_000286867.1|2146946_2147861_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|2148445_2148880_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_112033699.1|2149020_2150154_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	6.3e-118
>prophage 164
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2155113	2156103	4957282		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2155113_2156103_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 165
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2174909	2178812	4957282		Klosneuvirus(100.0%)	1	NA	NA
WP_000139591.1|2174909_2178812_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 166
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2184430	2185379	4957282		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|2184430_2184961_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|2185205_2185379_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 167
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2198553	2205603	4957282		Phage_TP(25.0%)	7	NA	NA
WP_024257894.1|2198553_2200515_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	5.4e-24
WP_000494244.1|2200606_2200837_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813793.1|2201058_2201235_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	8.0e-12
WP_001270286.1|2201280_2201697_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760655.1|2201775_2203182_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047419.1|2203426_2204572_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|2204589_2205603_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 168
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2212735	2214838	4957282		Salmonella_phage(100.0%)	1	NA	NA
WP_000689328.1|2212735_2214838_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.6e-135
>prophage 169
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2219745	2226126	4957282		Ralstonia_phage(50.0%)	2	NA	NA
WP_071337731.1|2219745_2221854_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	1.6e-26
WP_174166955.1|2221920_2226126_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.6	1.4e-21
>prophage 170
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2234374	2235919	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_023307977.1|2234374_2235919_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 171
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2251481	2252922	4957282		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|2251481_2251766_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|2251911_2252922_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 172
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2256196	2258102	4957282		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285521.1|2256196_2257123_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.6e-13
WP_023154881.1|2257115_2258102_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
>prophage 173
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2262447	2266254	4957282		Klosneuvirus(50.0%)	2	NA	NA
WP_143357915.1|2262447_2264847_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_001515301.1|2264871_2266254_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 174
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2271533	2278469	4957282		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_024257824.1|2271533_2274317_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
WP_000832464.1|2274373_2276746_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001312953.1|2276783_2278469_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 175
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2295084	2296485	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_122989960.1|2295084_2296485_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	1.2e-105
>prophage 176
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2303891	2305427	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194914.1|2303891_2305427_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	4.4e-21
>prophage 177
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2313298	2314717	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_174166957.1|2313298_2314717_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 178
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2322464	2322848	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|2322464_2322848_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 179
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2325850	2326741	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_000592844.1|2325850_2326741_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 180
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2332110	2406418	4957282	head,portal,terminase,lysis,transposase,tail,integrase,capsid	Enterobacteria_phage(42.37%)	91	2374056:2374071	2406489:2406504
WP_000214712.1|2332110_2332314_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527836.1|2332349_2333810_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	5.6e-42
WP_120795384.1|2335786_2335900_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2335968_2336202_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2336518_2337109_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2337206_2337782_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_075209605.1|2337781_2340853_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_001230375.1|2340917_2341517_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_044723265.1|2341584_2345064_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.2	0.0e+00
WP_174166951.1|2345124_2345757_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.6	4.6e-94
WP_000140768.1|2345693_2346437_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
WP_001152612.1|2346441_2347140_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|2347139_2347469_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_174166958.1|2347465_2350027_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.3	0.0e+00
WP_000459457.1|2350019_2350454_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479146.1|2350435_2350858_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	3.3e-72
WP_001528302.1|2350873_2351614_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	9.5e-131
WP_000683105.1|2351621_2352017_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001541219.1|2352013_2352592_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000753001.1|2352603_2352957_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_032318908.1|2352968_2353364_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.9e-53
WP_053884661.1|2354377_2355250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178671.1|2356295_2356679_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190772.1|2356690_2357032_-|head	head decoration protein	head	NA	NA	NA	NA
WP_112047712.1|2357041_2358082_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
WP_000125506.1|2358746_2358992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817024.1|2359279_2361100_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000790824.1|2361096_2361384_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000999172.1|2361387_2361612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089587471.1|2361604_2361868_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_024239330.1|2361947_2362142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024239328.1|2363568_2363790_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000896724.1|2363791_2365027_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
WP_012304872.1|2365490_2365823_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_080029809.1|2365832_2367152_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001356819.1|2367132_2368734_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|2368730_2368937_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027293.1|2368933_2370859_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|2370833_2371379_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|2371767_2372001_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2372058_2372469_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2372620_2372794_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2372965_2373121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2373200_2373266_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2373268_2373457_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2373467_2373680_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2374042_2374540_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2374056:2374071	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|2374536_2375070_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2375066_2375378_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2375382_2375598_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2376351_2376567_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2376867_2377080_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2377134_2377224_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_112033706.1|2377502_2378255_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	4.2e-134
WP_001265198.1|2378268_2379318_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2379319_2379598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2379664_2379916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2380132_2380288_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2380359_2380647_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2380646_2380886_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2380910_2381216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2381418_2381751_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2382187_2383501_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2383678_2383861_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_174166959.1|2385171_2385528_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	68.8	3.5e-38
WP_001151262.1|2385524_2385947_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|2385987_2386953_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|2386933_2387455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2387438_2387669_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2387752_2388160_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2388326_2388482_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2388641_2388860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|2388863_2389028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2389427_2389616_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|2389612_2389804_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048342.1|2389896_2392368_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2392440_2392692_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876958.1|2392726_2394007_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_174166960.1|2394026_2394137_-	transporter	NA	NA	NA	NA	NA
WP_000836059.1|2394194_2395214_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_024257740.1|2395225_2396440_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	5.3e-46
WP_000598291.1|2396620_2396971_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	6.2e-24
WP_000705197.1|2397105_2397447_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2397481_2398042_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2398044_2398755_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2398862_2399168_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_174166961.1|2399366_2401793_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.5e-214
WP_001340362.1|2401853_2404277_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|2404287_2404905_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526477.1|2404906_2405761_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148698.1|2405803_2406418_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
2406489:2406504	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 181
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2424180	2425482	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_000732488.1|2424180_2425482_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 182
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2433641	2437585	4957282	transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_000019440.1|2433641_2434622_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_174166962.1|2434667_2435777_-	glucuronide transporter	NA	NA	NA	NA	NA
WP_071337754.1|2435773_2437585_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 183
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2457565	2458840	4957282	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2457565_2458840_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 184
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2465751	2467250	4957282		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|2465751_2466273_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|2466353_2467250_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 185
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2476053	2484857	4957282		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101183.1|2476053_2476881_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2477008_2477590_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|2477735_2478905_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2479070_2479160_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2479458_2480484_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|2480480_2481413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|2481525_2482737_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|2483027_2484176_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493966.1|2484215_2484857_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	4.3e-23
>prophage 186
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2490361	2492628	4957282		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587573.1|2490361_2491174_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
WP_001069978.1|2491177_2491963_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|2491959_2492628_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 187
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2500917	2506001	4957282		environmental_halophage(33.33%)	5	NA	NA
WP_000144577.1|2500917_2502138_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	4.9e-92
WP_174166963.1|2502134_2503406_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948875.1|2503380_2504127_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_023154328.1|2504136_2505624_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|2505632_2506001_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 188
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2524648	2544187	4957282	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_024257784.1|2524648_2526295_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.7e-32
WP_000069375.1|2526351_2528730_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2529062_2529896_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|2530052_2531099_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2531230_2531422_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175593.1|2531425_2532862_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001302301.1|2532924_2533638_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|2533884_2534349_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029469.1|2534426_2535176_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	6.0e-08
WP_001154167.1|2535175_2535727_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956517.1|2535789_2536770_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2536870_2537170_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_174166964.1|2537174_2539562_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2539576_2540560_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2540842_2540887_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2541009_2541366_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2541418_2541616_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2541712_2542255_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2542258_2544187_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 189
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2555483	2557745	4957282		Tupanvirus(100.0%)	1	NA	NA
WP_000082740.1|2555483_2557745_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 190
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2563871	2564699	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_000175050.1|2563871_2564699_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 191
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2572175	2573396	4957282		Klosneuvirus(100.0%)	1	NA	NA
WP_023154319.1|2572175_2573396_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.5e-27
>prophage 192
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2580160	2580814	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_001383240.1|2580160_2580814_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	4.3e-10
>prophage 193
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2586411	2588373	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_023154312.1|2586411_2588373_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 194
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2593299	2597385	4957282		Tupanvirus(50.0%)	4	NA	NA
WP_001135064.1|2593299_2593941_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	1.7e-19
WP_001299574.1|2594033_2595392_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2595509_2596268_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723731.1|2596404_2597385_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 195
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2606198	2607053	4957282		Indivirus(100.0%)	1	NA	NA
WP_001186335.1|2606198_2607053_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	3.3e-10
>prophage 196
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2610371	2614951	4957282		Bacillus_phage(100.0%)	2	NA	NA
WP_023154309.1|2610371_2611655_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	3.4e-11
WP_023154279.1|2613460_2614951_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 197
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2629705	2637811	4957282	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2629705_2631391_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2631595_2632177_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220953.1|2632215_2632911_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_174166965.1|2632968_2634879_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	2.0e-92
WP_001295493.1|2635010_2635355_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2635717_2636077_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2636196_2636376_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854985.1|2636449_2637811_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 198
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2641673	2643230	4957282		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2641673_2643230_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 199
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2648871	2649081	4957282		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2648871_2649081_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 200
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2654413	2656462	4957282		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|2654413_2656462_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 201
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2663958	2668428	4957282		Escherichia_phage(33.33%)	7	NA	NA
WP_000812739.1|2663958_2664615_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.2e-55
WP_000976472.1|2665010_2665352_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879287.1|2665364_2666237_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2666240_2666615_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916760.1|2666753_2666984_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.7e-14
WP_000011656.1|2667085_2667742_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2667765_2668428_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 202
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2676481	2677957	4957282		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2676481_2677957_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 203
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2681954	2689016	4957282		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2681954_2683277_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001695833.1|2683292_2684225_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202983.1|2684303_2685059_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.9	1.0e-18
WP_000571478.1|2685055_2685841_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_112033552.1|2685984_2686995_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2687003_2687615_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|2687753_2687819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|2687890_2688493_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2688494_2689016_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 204
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2693034	2695085	4957282		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|2693034_2693853_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2693905_2694301_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2694341_2695085_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 205
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2701701	2703435	4957282	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_174166969.1|2701701_2703435_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	2.6e-86
>prophage 206
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2708688	2714332	4957282		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2708688_2709078_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2709092_2710142_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204337.1|2710144_2711005_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483256.1|2711023_2712625_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	1.9e-14
WP_001313042.1|2712670_2714332_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 207
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2724419	2725934	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187818.1|2724419_2725934_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 208
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2737925	2738678	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|2737925_2738678_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 209
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2750851	2751520	4957282		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_112033549.1|2750851_2751520_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.3e-82
>prophage 210
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2767359	2779856	4957282		Bacillus_phage(28.57%)	12	NA	NA
WP_001313055.1|2767359_2769054_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2769224_2769407_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922681.1|2769485_2770403_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212210.1|2770575_2771496_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2771484_2771955_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157240.1|2771935_2773354_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365581.1|2773420_2774116_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.2e-07
WP_174166970.1|2774155_2774521_-	permease	NA	NA	NA	NA	NA
WP_029396139.1|2775087_2776275_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	52.7	8.4e-97
WP_000218214.1|2776867_2777719_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826790.1|2777826_2779185_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
WP_024248376.1|2779184_2779856_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	4.1e-32
>prophage 211
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2783400	2783931	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_001079083.1|2783400_2783931_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 212
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2824255	2826057	4957282	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001323403.1|2824255_2825035_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|2825034_2826057_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 213
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2835834	2837978	4957282		Yersinia_phage(33.33%)	4	NA	NA
WP_001234528.1|2835834_2836656_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.8	2.1e-46
WP_001469549.1|2836710_2837196_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	2.9e-11
WP_001186774.1|2837211_2837688_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2837756_2837978_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 214
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2842319	2843486	4957282		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001320295.1|2842319_2843486_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 215
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2851130	2852030	4957282		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2851130_2852030_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 216
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2859384	2860551	4957282		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_053270446.1|2859384_2860551_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	4.4e-114
>prophage 217
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2870743	2874421	4957282		Bacillus_phage(33.33%)	3	NA	NA
WP_061350269.1|2870743_2871631_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.8	7.8e-47
WP_040234799.1|2871873_2872869_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.5e-09
WP_088765802.1|2873026_2874421_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
>prophage 218
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2880214	2887008	4957282		Bacillus_phage(25.0%)	6	NA	NA
WP_001296216.1|2880214_2881585_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_032214197.1|2881777_2883214_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_032214198.1|2883216_2884440_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479833.1|2884436_2884916_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_032214199.1|2884918_2885884_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	6.4e-87
WP_000048190.1|2885886_2887008_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 219
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2891252	2901903	4957282		uncultured_marine_virus(20.0%)	9	NA	NA
WP_074574017.1|2891252_2892092_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_057109785.1|2892269_2894432_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000482901.1|2894434_2894878_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2894883_2896023_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|2896331_2896481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339006.1|2896681_2898265_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|2898713_2900567_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2900588_2901170_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2901261_2901903_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 220
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2906628	2907981	4957282		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001695942.1|2906628_2907981_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 221
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2921423	2928286	4957282	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675144.1|2921423_2922827_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|2922823_2923546_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2923736_2924069_+	YegP family protein	NA	NA	NA	NA	NA
WP_003915633.1|2924312_2924564_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_032214208.1|2924565_2924862_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476027.1|2924964_2926326_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_000716757.1|2926655_2926973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174166980.1|2927386_2928286_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 222
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2943130	2943748	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_023154626.1|2943130_2943748_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.5e-12
>prophage 223
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2955445	2963094	4957282		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|2955445_2956453_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|2956591_2956876_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578040.1|2957000_2958761_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	1.9e-100
WP_001234850.1|2958910_2959606_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|2959633_2960824_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|2961156_2961501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194868.1|2961504_2963094_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	4.2e-19
>prophage 224
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2968848	2973149	4957282		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2968848_2969415_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|2969826_2970540_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_174166983.1|2970578_2971565_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_174166984.1|2971682_2973149_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	6.6e-43
>prophage 225
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2987643	2988501	4957282		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|2987643_2988501_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 226
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	2992569	2996343	4957282		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489254.1|2992569_2994549_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
WP_000425454.1|2994580_2995417_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2995674_2996343_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 227
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3000037	3001558	4957282		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|3000037_3001558_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 228
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3021808	3031253	4957282		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|3021808_3022735_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|3022739_3023471_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3023451_3023559_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3023618_3024350_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3024571_3026257_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3026253_3026973_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3027019_3027490_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3027530_3027992_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_023154469.1|3028116_3030120_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_023154468.1|3030116_3031253_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 229
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3046825	3048859	4957282	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|3046825_3048859_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 230
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3059358	3060804	4957282		Burkholderia_phage(100.0%)	1	NA	NA
WP_174167021.1|3059358_3060804_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	27.1	1.1e-05
>prophage 231
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3066833	3067208	4957282		Cronobacter_phage(100.0%)	1	NA	NA
WP_174166993.1|3066833_3067208_+	hypothetical protein	NA	M1EZ72	Cronobacter_phage	57.6	3.3e-07
>prophage 232
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3073073	3088779	4957282	transposase	Bacillus_phage(28.57%)	13	NA	NA
WP_024257810.1|3073073_3073892_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_023154828.1|3073943_3074690_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001405405.1|3074663_3075629_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_023154829.1|3075625_3076630_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.2e-14
WP_000858500.1|3076626_3077904_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|3078160_3079213_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_100245061.1|3079331_3080680_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000758063.1|3081128_3082775_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422204.1|3082992_3084636_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
WP_000884972.1|3084711_3085362_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786362.1|3085361_3086426_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000406053.1|3086499_3087555_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865563.1|3087666_3088779_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	7.6e-116
>prophage 233
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3093056	3097899	4957282		Hokovirus(50.0%)	2	NA	NA
WP_000876018.1|3093056_3095906_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.9	1.7e-42
WP_112033513.1|3096072_3097899_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	5.8e-20
>prophage 234
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3112822	3115450	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_001281251.1|3112822_3115450_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 235
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3120909	3124813	4957282		Pseudomonas_phage(66.67%)	3	NA	NA
WP_001075183.1|3120909_3123195_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332036.1|3123428_3124559_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|3124558_3124813_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
>prophage 236
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3129575	3130652	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779095.1|3129575_3130652_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 237
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3136544	3141163	4957282	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_023154577.1|3136544_3137516_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	6.1e-69
WP_000150343.1|3137528_3137750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992980.1|3137790_3138594_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|3138611_3139901_-	MFS transporter	NA	NA	NA	NA	NA
WP_000174592.1|3139957_3141163_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 238
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3144766	3149770	4957282		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|3144766_3145369_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_024257759.1|3145676_3146816_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	31.4	7.7e-31
WP_000461637.1|3146819_3147788_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860303.1|3147787_3149770_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 239
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3184197	3187425	4957282		Salmonella_phage(50.0%)	3	NA	NA
WP_000813853.1|3184197_3184797_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|3184855_3186688_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203396.1|3186774_3187425_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 240
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3197984	3199857	4957282		Sodalis_phage(50.0%)	2	NA	NA
WP_000156142.1|3197984_3198887_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	3.1e-67
WP_001293612.1|3199083_3199857_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 241
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3204068	3205586	4957282		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3204068_3205586_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 242
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3212335	3213472	4957282		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_112033517.1|3212335_3213472_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	2.6e-23
>prophage 243
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3222018	3223104	4957282		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|3222018_3223104_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 244
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3241240	3242173	4957282		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|3241240_3242173_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 245
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3245195	3246629	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_000194535.1|3245195_3246629_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.8	1.2e-28
>prophage 246
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3253271	3260848	4957282		Bacillus_phage(50.0%)	4	NA	NA
WP_023154697.1|3253271_3256865_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001433504.1|3256920_3258066_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3258139_3259084_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283491.1|3259153_3260848_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 247
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3264539	3265460	4957282		Morganella_phage(100.0%)	1	NA	NA
WP_000484413.1|3264539_3265460_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	1.3e-76
>prophage 248
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3269278	3270013	4957282		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3269278_3270013_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 249
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3288007	3288550	4957282	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_077627982.1|3288007_3288550_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	3.9e-41
>prophage 250
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3293304	3308673	4957282		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443701.1|3293304_3295320_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	2.0e-151
WP_001299866.1|3295390_3296389_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3296618_3297380_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3297564_3298536_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3298919_3299177_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|3299221_3300949_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|3300989_3301499_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096670.1|3301540_3302392_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719947.1|3302496_3302865_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001358955.1|3302867_3303779_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	4.5e-58
WP_000021037.1|3303912_3305010_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852696.1|3304999_3305875_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|3305874_3306708_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290243.1|3306707_3307724_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517428.1|3307881_3308673_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
>prophage 251
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3312151	3317089	4957282		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001313136.1|3312151_3313456_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_001362548.1|3313513_3314413_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.2	1.7e-25
WP_000838947.1|3314508_3315084_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001313137.1|3315144_3315594_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3315580_3316006_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|3316219_3317089_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 252
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3335641	3336592	4957282		Cyanophage(100.0%)	1	NA	NA
WP_001003735.1|3335641_3336592_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 253
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3354610	3355324	4957282		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3354610_3355324_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 254
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3376624	3380626	4957282		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3376624_3377914_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3377999_3378626_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|3378950_3379988_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028618.1|3379987_3380626_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
>prophage 255
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3386873	3393356	4957282		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|3386873_3387026_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3387043_3387235_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|3387545_3388064_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755178.1|3388079_3388619_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138270.1|3388711_3390289_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3390357_3391824_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_112033534.1|3391985_3393356_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.1e-42
>prophage 256
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3402185	3407433	4957282		Escherichia_phage(66.67%)	5	NA	NA
WP_000963837.1|3402185_3402617_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
WP_000948588.1|3402757_3403612_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000544905.1|3403611_3404433_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_000077290.1|3404425_3405055_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	3.3e-60
WP_024257742.1|3405051_3407433_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.7	1.7e-144
>prophage 257
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3417358	3423696	4957282		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133579.1|3417358_3418642_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|3418700_3418901_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124474.1|3418912_3419248_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3419249_3421100_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384423.1|3421116_3421632_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3421727_3422051_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3422067_3422454_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3422481_3423696_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 258
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3438829	3440341	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493515.1|3438829_3440341_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.5e-13
>prophage 259
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3446099	3457409	4957282		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3446099_3447353_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883120.1|3447682_3448873_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_112033536.1|3448917_3449256_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|3449316_3450651_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215856.1|3450640_3451354_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|3451518_3452946_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970067.1|3453521_3457409_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 260
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3461528	3461789	4957282		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|3461528_3461789_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 261
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3465249	3468991	4957282		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3465249_3465930_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3466201_3467176_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3467191_3468991_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 262
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3474762	3480845	4957282	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3474762_3476097_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001313163.1|3476129_3477011_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189218.1|3477113_3477701_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3477756_3478140_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001284571.1|3478444_3479134_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997418.1|3479181_3480219_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3480425_3480845_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 263
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3486138	3487437	4957282		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3486138_3487437_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 264
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3493199	3495773	4957282		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3493199_3495773_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 265
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3501679	3502750	4957282		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168032.1|3501679_3502750_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 266
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3516384	3516867	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3516384_3516867_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 267
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3522497	3522716	4957282		Salmonella_phage(100.0%)	1	NA	NA
WP_071780853.1|3522497_3522716_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	72.0	3.2e-10
>prophage 268
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3532182	3536235	4957282		Klosneuvirus(50.0%)	4	NA	NA
WP_000097648.1|3532182_3533463_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001301367.1|3533701_3535102_+	GABA permease	NA	NA	NA	NA	NA
WP_000156821.1|3535122_3535785_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|3535785_3536235_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 269
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3540169	3545466	4957282		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223223.1|3540169_3540415_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3540411_3540822_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246560.1|3540794_3542939_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	1.1e-195
WP_000777943.1|3542948_3543908_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.0e-133
WP_000985494.1|3544263_3545466_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 270
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3558280	3563840	4957282	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3558280_3558466_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047187.1|3558700_3561331_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|3561458_3561959_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3562201_3563263_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3563342_3563840_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 271
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3569307	3570273	4957282		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287416.1|3569307_3570273_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	8.0e-37
>prophage 272
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3577748	3578759	4957282		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032194274.1|3577748_3578759_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 273
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3597053	3607074	4957282		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_001272898.1|3597053_3599615_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141336.1|3599720_3600377_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_000562980.1|3600417_3600654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863206.1|3600664_3602092_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000767724.1|3602091_3602685_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001208062.1|3602831_3603239_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081550.1|3603358_3604351_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3604413_3605553_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254702.1|3605692_3606319_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	4.4e-36
WP_023154954.1|3606312_3607074_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	6.9e-60
>prophage 274
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3610186	3612219	4957282		Tupanvirus(50.0%)	2	NA	NA
WP_001173672.1|3610186_3610792_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	5.5e-28
WP_001090361.1|3610791_3612219_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 275
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3636496	3637282	4957282		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021347.1|3636496_3637282_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 276
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3642001	3642673	4957282		Vibrio_phage(100.0%)	1	NA	NA
WP_001199973.1|3642001_3642673_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 277
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3646488	3649512	4957282		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|3646488_3647787_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3647874_3649512_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 278
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3653545	3657660	4957282		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046797.1|3653545_3654847_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.7e-38
WP_000186457.1|3654903_3657660_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 279
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3665194	3666043	4957282		Vibrio_phage(100.0%)	1	NA	NA
WP_000100417.1|3665194_3666043_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 280
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3670901	3671657	4957282		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3670901_3671657_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 281
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3683169	3698715	4957282	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|3683169_3684375_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184266.1|3684374_3684818_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117724.1|3684868_3685675_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
WP_000678646.1|3685912_3687010_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_112033708.1|3687587_3688841_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3689072_3690404_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775919.1|3690465_3692292_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.1	4.1e-26
WP_023154677.1|3692291_3695834_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138208.1|3695826_3698715_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	2.0e-67
>prophage 282
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3704192	3710965	4957282		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816242.1|3704192_3704987_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	5.8e-118
WP_000204658.1|3704993_3705869_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|3706019_3708266_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3708278_3708809_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|3709493_3710183_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3710251_3710965_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 283
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3720596	3723091	4957282		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3720596_3722015_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|3722329_3723091_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 284
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3754938	3755694	4957282		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3754938_3755694_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 285
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3780154	3805258	4957282	transposase,tRNA	Bacillus_phage(20.0%)	23	NA	NA
WP_001280192.1|3780154_3781555_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001313239.1|3781572_3782889_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3782924_3784292_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838411.1|3784327_3784816_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_174167002.1|3784815_3786735_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3787170_3788619_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|3788620_3788746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3788742_3788814_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192812.1|3788868_3789417_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|3789459_3790977_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3790986_3792085_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813236.1|3792175_3793909_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	6.4e-61
WP_000715218.1|3793914_3794625_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806630.1|3794649_3795546_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_001055874.1|3795657_3796179_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_000244777.1|3796218_3796626_-	toxin CptA	NA	NA	NA	NA	NA
WP_000354046.1|3796606_3796873_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_000886100.1|3797115_3798096_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_100245061.1|3798173_3799522_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000250270.1|3799608_3800268_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_001182957.1|3800431_3800743_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_024257890.1|3800787_3802221_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.7	5.1e-32
WP_000194983.1|3802384_3805258_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	8.2e-263
>prophage 286
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3813394	3814627	4957282		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3813394_3814627_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 287
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3834823	3835501	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_000956883.1|3834823_3835501_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	4.9e-09
>prophage 288
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3841206	3915759	4957282	tRNA,transposase,protease,integrase	Yersinia_phage(25.0%)	58	3876302:3876324	3898808:3898830
WP_000646940.1|3841206_3842115_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
WP_023155094.1|3842334_3844326_-	transketolase	NA	NA	NA	NA	NA
WP_000701842.1|3844603_3845362_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_100245061.1|3845496_3846845_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000105566.1|3847003_3847924_-	agmatinase	NA	NA	NA	NA	NA
WP_000758918.1|3848059_3848791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3849712_3851689_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3851697_3851829_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3851964_3852180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3852483_3853638_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3854074_3855469_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001300769.1|3855545_3856043_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000281728.1|3856137_3856845_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3856924_3857656_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3857668_3858619_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3858727_3859291_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017113.1|3859290_3859707_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_174167003.1|3859890_3860871_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_001313259.1|3860888_3861593_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3861610_3862177_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3862173_3862464_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174750.1|3862471_3863065_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239958.1|3863057_3864194_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745237.1|3864436_3865444_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_174167004.1|3865560_3866607_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3866782_3867502_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3867685_3868012_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3868011_3868731_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_024262241.1|3868891_3869944_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3869971_3870247_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3870311_3871391_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3871592_3872849_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839809.1|3872898_3875034_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234483.1|3875432_3876140_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
3876302:3876324	attL	GATTCCGAGTCCGGGCACCACTA	NA	NA	NA	NA
WP_000525605.1|3877932_3878814_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_000025792.1|3880332_3882528_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000109323.1|3882726_3883344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350754.1|3883343_3884411_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000508166.1|3884594_3886922_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000014360.1|3886925_3888242_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000980865.1|3888238_3890437_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001232428.1|3890448_3895164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021577946.1|3895160_3897392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087888794.1|3897520_3898619_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	1.7e-46
WP_000942975.1|3898975_3899512_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
3898808:3898830	attR	GATTCCGAGTCCGGGCACCACTA	NA	NA	NA	NA
WP_071337510.1|3899513_3900692_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000625913.1|3900688_3901666_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_001250464.1|3901662_3902268_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820103.1|3902264_3902636_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115148.1|3902632_3903196_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087296.1|3903199_3903655_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_174167005.1|3903671_3904895_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000249344.1|3904894_3906388_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_000498829.1|3906387_3908448_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000135081.1|3908477_3909437_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_023154867.1|3909454_3909865_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000895861.1|3909930_3910740_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_023154454.1|3911199_3915759_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
>prophage 289
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3930117	3931290	4957282		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|3930117_3931290_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 290
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3943530	3944878	4957282	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100245061.1|3943530_3944878_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 291
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3954937	3955822	4957282		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3954937_3955822_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 292
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3961665	3973795	4957282		Staphylococcus_phage(25.0%)	10	NA	NA
WP_000013149.1|3961665_3962493_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691606.1|3962692_3963619_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848536.1|3963667_3963925_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095178.1|3963967_3966187_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3966297_3967710_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965716.1|3967784_3968522_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3968755_3971014_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_001308070.1|3971151_3972759_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183494.1|3972867_3973350_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3973402_3973795_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 293
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3977661	3988624	4957282		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3977661_3979554_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3979582_3980164_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3980163_3980991_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3981015_3981438_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3981438_3982068_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3982272_3983754_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831556.1|3983901_3984573_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3984578_3985739_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_024257842.1|3985776_3986565_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3986707_3987481_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3987538_3987709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3987970_3988624_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 294
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3992912	3994346	4957282		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3992912_3994346_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 295
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	3999483	4000722	4957282	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708465.1|3999483_4000722_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.4	5.9e-93
>prophage 296
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4007123	4024754	4957282	transposase,tRNA	Moraxella_phage(14.29%)	13	NA	NA
WP_001264362.1|4007123_4008137_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	3.7e-109
WP_001144069.1|4008374_4008590_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918812.1|4008700_4010446_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	4.1e-76
WP_000437371.1|4010640_4012482_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228930.1|4012560_4013067_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065881.1|4013319_4014084_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|4014371_4014995_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_100245061.1|4015133_4016482_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000094727.1|4016584_4018105_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001297164.1|4018522_4019902_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450588.1|4019943_4020276_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212463.1|4020494_4021478_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_089610295.1|4021661_4024754_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	2.2e-157
>prophage 297
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4038996	4039962	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|4038996_4039962_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 298
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4060744	4063039	4957282		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861750.1|4060744_4063039_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 299
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4071033	4072179	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_174167008.1|4071033_4072179_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	1.3e-49
>prophage 300
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4095189	4102983	4957282		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|4095189_4096050_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249165.1|4096114_4098151_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246841.1|4098108_4098504_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|4098523_4099114_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|4099123_4099699_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147622.1|4099812_4100853_-	permease	NA	NA	NA	NA	NA
WP_024257851.1|4100925_4101561_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037593.1|4101688_4102207_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_000449041.1|4102186_4102630_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|4102680_4102983_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 301
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4108685	4110575	4957282		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|4108685_4110575_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 302
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4116057	4122696	4957282		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|4116057_4118730_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|4118754_4120242_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4120269_4120722_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207679.1|4121352_4122696_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 303
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4126778	4129651	4957282	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4126778_4127627_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4127716_4129651_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 304
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4136279	4137758	4957282		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|4136279_4137251_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4137479_4137758_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 305
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4141826	4156619	4957282		Staphylococcus_phage(25.0%)	16	NA	NA
WP_000438245.1|4141826_4142636_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922870.1|4142845_4143823_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4143836_4144823_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030000.1|4144843_4145410_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|4145406_4145982_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4145950_4146508_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4146514_4147240_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4147287_4148721_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4148743_4149031_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|4149148_4149640_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4149685_4150540_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4150536_4150809_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620409.1|4151021_4151654_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_001308080.1|4152374_4153028_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|4153257_4155594_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4155689_4156619_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 306
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4163367	4168115	4957282		Salmonella_phage(50.0%)	5	NA	NA
WP_000445108.1|4163367_4164495_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.1e-72
WP_000979870.1|4164554_4165019_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209065.1|4165015_4165891_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001313328.1|4165887_4166577_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108458.1|4166624_4168115_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 307
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4171820	4172318	4957282	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|4171820_4172318_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 308
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4176284	4178809	4957282	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|4176284_4177652_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|4177741_4178809_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 309
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4195318	4196362	4957282		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4195318_4196362_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 310
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4206927	4207812	4957282		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258928.1|4206927_4207812_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	6.4e-25
>prophage 311
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4214316	4218470	4957282		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|4214316_4215342_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019651.1|4215409_4216591_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001308087.1|4216600_4217704_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078321.1|4217711_4218470_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 312
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4228804	4230276	4957282	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4228804_4229314_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004459.1|4229328_4230276_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 313
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4250153	4255727	4957282		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|4250153_4251338_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4251408_4253523_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4253619_4254090_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4254186_4254561_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903384.1|4254686_4254974_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820739.1|4254981_4255341_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	6.2e-11
WP_001209707.1|4255340_4255727_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	7.4e-18
>prophage 314
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4261297	4270838	4957282		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4261297_4263211_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057382.1|4263210_4264233_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4264226_4264445_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|4264498_4265368_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4265422_4265827_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4266128_4266761_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|4266811_4268902_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963776.1|4268968_4270189_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601856.1|4270274_4270838_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	5.4e-62
>prophage 315
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4287375	4288212	4957282		Vibrio_phage(100.0%)	1	NA	NA
WP_000742147.1|4287375_4288212_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	8.4e-67
>prophage 316
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4305115	4308883	4957282		Bacillus_phage(66.67%)	3	NA	NA
WP_001298201.1|4305115_4306738_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|4306814_4308167_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|4308163_4308883_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 317
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4315446	4316325	4957282		Sodalis_phage(100.0%)	1	NA	NA
WP_000039082.1|4315446_4316325_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	8.5e-70
>prophage 318
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4322292	4324686	4957282		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|4322292_4324686_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 319
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4329905	4331132	4957282		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105465.1|4329905_4331132_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 320
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4340037	4342485	4957282		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4340037_4342485_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 321
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4352814	4354911	4957282		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000410812.1|4352814_4354911_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.1	2.1e-42
>prophage 322
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4363295	4365106	4957282		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073575.1|4363295_4364039_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	6.4e-10
WP_000907809.1|4364035_4365106_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 323
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4369475	4370958	4957282		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4369475_4370189_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4370190_4370958_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 324
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4377439	4380258	4957282		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4377439_4378294_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4378538_4379597_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4379589_4380258_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 325
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4383264	4387396	4957282		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4383264_4383891_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_112033570.1|4383964_4386163_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	4.2e-118
WP_000130621.1|4386264_4386510_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100475.1|4386730_4387396_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.1e-57
>prophage 326
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4410644	4411451	4957282		Bacillus_virus(100.0%)	1	NA	NA
WP_000173708.1|4410644_4411451_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.6	1.5e-17
>prophage 327
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4418071	4422279	4957282		Burkholderia_phage(50.0%)	3	NA	NA
WP_001259385.1|4418071_4418347_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_001314210.1|4418419_4419544_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149185.1|4419543_4422279_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 328
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4435691	4437734	4957282		Indivirus(100.0%)	1	NA	NA
WP_001313364.1|4435691_4437734_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	2.3e-46
>prophage 329
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4440848	4442984	4957282		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008968.1|4440848_4441202_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|4441256_4442546_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065772.1|4442558_4442984_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.2e-50
>prophage 330
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4456081	4457551	4957282		Pithovirus(50.0%)	2	NA	NA
WP_023154777.1|4456081_4456852_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
WP_001296814.1|4456903_4457551_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 331
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4504460	4506445	4957282		Bacillus_virus(50.0%)	2	NA	NA
WP_000107036.1|4504460_4505465_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196486.1|4505461_4506445_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 332
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4522249	4524583	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_000013958.1|4522249_4524583_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 333
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4528237	4528450	4957282		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4528237_4528450_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 334
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4532577	4533573	4957282		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182638.1|4532577_4533573_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	2.0e-11
>prophage 335
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4538891	4540433	4957282		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|4538891_4540433_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 336
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4559869	4561714	4957282		Tupanvirus(100.0%)	1	NA	NA
WP_000582431.1|4559869_4561714_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 337
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4568246	4569227	4957282	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019440.1|4568246_4569227_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 338
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4583470	4593025	4957282		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|4583470_4583722_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4583863_4584295_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|4584539_4586084_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4586093_4587377_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|4587380_4588340_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982093.1|4588326_4589361_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000645982.1|4589599_4590625_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213802.1|4590634_4591831_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	1.1e-35
WP_000587766.1|4592044_4593025_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.2e-35
>prophage 339
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4608204	4612767	4957282		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171870.1|4608204_4608684_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	4.8e-27
WP_001114529.1|4608722_4609532_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|4609629_4609797_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4609817_4610054_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|4610270_4610939_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|4611110_4612331_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|4612308_4612767_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 340
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4616107	4631286	4957282	integrase	Morganella_phage(27.27%)	19	4611468:4611481	4631918:4631931
4611468:4611481	attL	GTGCTCCCCGCCAT	NA	NA	NA	NA
WP_001384863.1|4616107_4617367_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	5.1e-193
WP_000735991.1|4617462_4618308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090781.1|4618420_4618624_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412546.1|4618623_4619055_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
WP_001019369.1|4619067_4619901_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|4619893_4620076_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000958748.1|4620069_4621137_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	44.1	5.7e-12
WP_001065661.1|4621129_4621324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024677.1|4621320_4621584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4621580_4621802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058740.1|4621794_4622397_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000628970.1|4622407_4622749_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208876.1|4622741_4623113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174167015.1|4623099_4625856_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	2.3e-299
WP_001018524.1|4626449_4626611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420670.1|4626627_4627089_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	9.9e-62
WP_000909175.1|4627082_4627760_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000246959.1|4627759_4629181_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.2	5.7e-124
WP_096962453.1|4629180_4631286_+	injection protein	NA	A0A2I7QQN9	Vibrio_phage	36.8	3.6e-90
4631918:4631931	attR	ATGGCGGGGAGCAC	NA	NA	NA	NA
>prophage 341
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4634718	4643011	4957282		Clostridium_botulinum_C_phage(20.0%)	7	NA	NA
WP_001590894.1|4634718_4635732_-	hypothetical protein	NA	Q331X4	Clostridium_botulinum_C_phage	27.7	2.1e-11
WP_001336364.1|4636260_4637085_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.0	2.5e-95
WP_000924289.1|4637376_4637994_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_112033712.1|4637990_4639673_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	4.3e-22
WP_001295237.1|4639930_4640554_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4640608_4640884_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4640902_4643011_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 342
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4647444	4648836	4957282		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4647444_4648836_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 343
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4655115	4656300	4957282	integrase	Enterobacteria_phage(100.0%)	1	4652683:4652697	4667940:4667954
4652683:4652697	attL	ACCAGAACTCACCTT	NA	NA	NA	NA
WP_001218910.1|4655115_4656300_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|4655115_4656300_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
4667940:4667954	attR	ACCAGAACTCACCTT	NA	NA	NA	NA
>prophage 344
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4671522	4672643	4957282	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087451024.1|4671522_4672643_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 345
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4679315	4680650	4957282		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|4679315_4680650_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 346
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4687954	4695263	4957282		Micromonas_sp._RCC1109_virus(33.33%)	9	NA	NA
WP_000168464.1|4687954_4689643_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	3.5e-56
WP_001312198.1|4689748_4689847_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4690411_4690501_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4690780_4691965_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4691972_4692470_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4692466_4692829_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4692818_4693166_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|4693273_4693723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|4693769_4695263_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
>prophage 347
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4703756	4704710	4957282		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4703756_4704185_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4704296_4704710_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 348
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4709137	4710286	4957282		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4709137_4710286_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 349
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4714991	4722360	4957282		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4714991_4717406_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4717434_4718508_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4718507_4719608_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4719612_4721016_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4721312_4721393_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4721622_4721763_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4721779_4722139_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4722102_4722360_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 350
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4732561	4733899	4957282		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4732561_4733899_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 351
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4744263	4751871	4957282		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4744263_4745037_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4745219_4746110_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4746109_4747069_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_112033664.1|4747155_4748196_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.1	8.0e-51
WP_000334086.1|4748509_4750339_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933719.1|4750500_4751871_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.3	3.1e-34
>prophage 352
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4763823	4764816	4957282		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|4763823_4764816_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 353
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4767984	4773837	4957282		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4767984_4769853_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|4770019_4770439_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387778.1|4770446_4771952_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4771956_4772922_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4772946_4773837_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 354
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4787209	4788856	4957282		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012619.1|4787209_4788856_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.1e-67
>prophage 355
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4797288	4802702	4957282		Bacillus_phage(33.33%)	4	NA	NA
WP_001238865.1|4797288_4799310_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_112033692.1|4799356_4800841_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047496.1|4800976_4802242_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001280776.1|4802372_4802702_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 356
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4806744	4812888	4957282		Enterobacteria_phage(40.0%)	6	NA	NA
WP_023308511.1|4806744_4807875_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006621.1|4807871_4809134_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226600.1|4809133_4810201_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	5.1e-101
WP_000676056.1|4810219_4811101_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|4811078_4811753_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|4811757_4812888_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 357
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4820972	4822628	4957282		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000394791.1|4820972_4822628_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 358
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4831193	4833964	4957282		Salmonella_phage(100.0%)	2	NA	NA
WP_001014281.1|4831193_4832489_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.7e-08
WP_023154485.1|4832485_4833964_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	55.4	3.0e-43
>prophage 359
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4836999	4840858	4957282		Bacillus_phage(100.0%)	3	NA	NA
WP_000130686.1|4836999_4837896_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
WP_001213584.1|4837895_4838612_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383417.1|4838695_4840858_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	3.5e-117
>prophage 360
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4847459	4849289	4957282		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4847459_4849289_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 361
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4861820	4865107	4957282		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|4861820_4863461_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|4863539_4863809_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4863812_4864328_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4864330_4865107_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 362
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4873895	4874510	4957282		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|4873895_4874510_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 363
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4888195	4890982	4957282		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|4888195_4890982_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 364
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4895057	4897528	4957282		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_023155177.1|4895057_4896467_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4896478_4897528_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 365
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4914522	4917302	4957282		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|4914522_4915419_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621638.1|4915586_4916483_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4916516_4917302_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 366
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4928483	4931534	4957282		Escherichia_phage(100.0%)	1	NA	NA
WP_077627994.1|4928483_4931534_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 367
NZ_CP054371	Escherichia coli strain SCU-316 chromosome, complete genome	4957282	4948087	4957021	4957282	integrase	Salmonella_phage(30.0%)	13	4950079:4950091	4957080:4957092
WP_001297064.1|4948087_4948708_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_071337557.1|4948967_4949951_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
4950079:4950091	attL	TTTCTCGTGGAGA	NA	NA	NA	NA
WP_001270249.1|4950099_4950774_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580427.1|4950879_4952253_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	2.9e-16
WP_001033722.1|4952249_4952948_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4953097_4953598_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|4953784_4954765_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4954834_4955128_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4955264_4955537_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217681.1|4955706_4956207_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_001620973.1|4956270_4956495_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	5.2e-32
WP_001277891.1|4956494_4956794_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001113273.1|4956796_4957021_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	6.5e-35
4957080:4957092	attR	TCTCCACGAGAAA	NA	NA	NA	NA
