The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	0	2283	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_174143649.1|0_2283_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.6	0.0e+00
>prophage 2
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	6379	34420	4902569	tail,holin,tRNA,capsid,plate,terminase,portal,head,lysis	Escherichia_phage(48.39%)	35	NA	NA
WP_001504902.1|6379_7414_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	3.2e-201
WP_000156872.1|7413_9186_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|9359_10214_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_016237184.1|10272_11346_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_000203462.1|11349_12093_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_000988633.1|12192_12702_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_054498020.1|12701_12905_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	1.5e-30
WP_000123123.1|12908_13190_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_169758922.1|13189_13687_+	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.1e-93
WP_096975756.1|13701_14127_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.0	8.0e-58
WP_000040694.1|14114_14540_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.9	5.5e-67
WP_096975755.1|14511_14685_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	1.2e-23
WP_000917155.1|14647_15115_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_174143650.1|15107_15560_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	3.4e-75
WP_000255496.1|15631_16417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093722.1|16500_17136_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	3.4e-113
WP_080073501.1|17132_17480_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
WP_174143651.1|17484_18393_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	4.1e-160
WP_001285325.1|18385_18916_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_174143652.1|18926_21176_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	55.8	1.9e-137
WP_063121876.1|21179_21707_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.7	1.3e-89
WP_042093525.1|21942_22527_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000884345.1|22547_22991_-	acetyltransferase	NA	NA	NA	NA	NA
WP_174143653.1|23402_24593_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|24605_25124_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|25180_25456_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|25488_25608_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_174143654.1|25600_28048_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
WP_001565024.1|28062_28542_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_174143655.1|28541_29705_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000468308.1|29786_30005_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|30277_31639_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_021539982.1|31785_32118_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|32297_33020_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675178.1|33016_34420_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 3
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	47527	48880	4902569		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469703.1|47527_48880_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 4
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	53601	63785	4902569		Catovirus(40.0%)	8	NA	NA
WP_001295424.1|53601_54243_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|54334_54916_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252295.1|54937_56791_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454700.1|56858_58442_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|59099_60239_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|60244_60688_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_174143658.1|60690_62853_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_174143659.1|62945_63785_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	7.0e-05
>prophage 5
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	68102	74896	4902569		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|68102_69224_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000089918.1|69226_70192_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	4.9e-87
WP_000479831.1|70194_70674_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699725.1|70670_71894_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079263.1|71896_73333_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_021536495.1|73525_74896_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	3.8e-32
>prophage 6
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	80898	87197	4902569		Enterobacteria_phage(33.33%)	6	NA	NA
WP_001116025.1|80898_82293_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
WP_000183060.1|82467_83361_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699459.1|83732_84818_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	5.2e-101
WP_001023632.1|84817_85717_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.3e-28
WP_000857513.1|85774_86653_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_001100780.1|86657_87197_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.7	3.9e-49
>prophage 7
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	95375	101172	4902569		Hokovirus(25.0%)	4	NA	NA
WP_001151874.1|95375_96806_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	3.5e-57
WP_001125684.1|96809_98189_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.0	5.0e-32
WP_174143661.1|98352_99759_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.8	4.0e-37
WP_174143662.1|100005_101172_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.1e-109
>prophage 8
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	108614	109514	4902569		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|108614_109514_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 9
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	115711	116878	4902569		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|115711_116878_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 10
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	121225	123559	4902569		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692323.1|121225_121447_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|121509_121986_-	RadC family protein	NA	NA	NA	NA	NA
WP_001385393.1|122001_122475_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	8.7e-13
WP_001234710.1|122737_123559_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.7	2.2e-43
>prophage 11
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	134691	135459	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|134691_135459_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 12
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	138970	139993	4902569	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001373875.1|138970_139993_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	1.1e-198
>prophage 13
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	158811	160664	4902569		Mycobacterium_phage(50.0%)	2	NA	NA
WP_174143667.1|158811_160035_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.0	1.3e-60
WP_000502870.1|160019_160664_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
>prophage 14
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	187592	197084	4902569		Paenibacillus_phage(100.0%)	1	NA	NA
WP_042091642.1|187592_197084_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 15
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	204686	288318	4902569	integrase,tail,holin,capsid,transposase,terminase,portal,head,protease	Escherichia_phage(31.48%)	99	213506:213565	254776:254837
WP_001330751.1|204686_206399_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_000654456.1|206385_208188_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286281.1|208180_209461_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703043.1|209488_210793_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_024175719.1|210986_212249_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	4.1e-73
WP_001325918.1|212586_213384_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
213506:213565	attL	CGGTCTCGAAAACCGGAGTGGGGGCAACTCCACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_059240107.1|213619_214645_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	3.4e-102
WP_000096344.1|214644_214848_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_174143669.1|214906_217348_-	3'-5' exoribonuclease	NA	V5UQJ3	Shigella_phage	45.9	1.0e-109
WP_001090252.1|217424_217628_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_042974855.1|217624_217813_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_174143670.1|218299_218875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|218876_219032_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_174143671.1|219198_219606_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	2.6e-13
WP_113919124.1|219689_219920_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_021568048.1|219903_220425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054495.1|220405_221371_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_174143672.1|221411_221843_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	3.8e-63
WP_001367360.1|222166_222406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032286199.1|222408_223005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062871932.1|223228_224953_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_122987018.1|225189_225297_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.9e-08
WP_174143673.1|225341_225554_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_042343688.1|225774_226035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042343690.1|226101_226380_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	5.7e-12
WP_174143674.1|226381_227437_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	3.5e-86
WP_000140004.1|227437_227803_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_021537289.1|227799_228489_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000839572.1|229300_229516_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193273.1|229520_229835_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_021526741.1|229890_230424_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.7	1.6e-100
WP_032145233.1|230640_230823_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_174143675.1|230927_231278_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	2.1e-64
WP_021526739.1|231425_231908_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_029392424.1|231907_233665_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_029305475.1|233676_233859_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	1.9e-24
WP_000466247.1|233858_235100_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|235077_235728_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257489.1|235742_236948_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601355.1|236999_237188_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|237199_237505_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|237513_237852_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|237851_238298_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|238294_238639_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_174143676.1|238698_239403_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.7	4.3e-117
WP_000164661.1|239417_239789_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978931.1|239812_240091_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_029392501.1|240136_243364_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|243341_243698_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_171870834.1|243697_244396_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	1.5e-130
WP_174143677.1|244401_245145_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	3.5e-149
WP_012311734.1|245042_245690_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_174143678.1|245750_249164_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_174143679.1|249224_251246_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	73.0	2.9e-182
WP_029305513.1|251242_251521_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	54.3	3.8e-24
WP_029305512.1|251533_251824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094284293.1|252336_253050_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	99.6	8.5e-137
WP_174143680.1|253046_253868_+	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	99.6	1.3e-152
WP_000859545.1|253864_254437_+	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_174143681.1|255506_256157_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
254776:254837	attR	CGGTCTCGAAAACCGGAGTGGGGGCAACTCCACCGGGGGTTCAAATCCCCCTCTCTCCGCCA	NA	NA	NA	NA
WP_001240078.1|256414_257050_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_174143682.1|257050_258055_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|258163_258577_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|258709_259381_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_021540291.1|259380_260739_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218217.1|260846_261698_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824389.1|262293_263352_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
WP_001330593.1|263917_264283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001374850.1|264322_265018_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001157268.1|265084_266503_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|266483_266954_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212231.1|266942_267863_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|268035_268953_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|269031_269214_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001545998.1|269384_271079_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	34.5	1.9e-17
WP_000491486.1|271075_271891_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|272188_272416_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|272578_272767_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103994.1|272810_273434_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983988.1|273723_274509_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|274517_274787_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253318.1|274796_275534_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001313947.1|275533_275899_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282103.1|275901_276315_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|276311_277316_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|277320_277785_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620070.1|277889_279017_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|279013_279457_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|279475_280849_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282677.1|280848_281535_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|281527_282523_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994399.1|282515_284174_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274299.1|284388_284703_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|285046_285379_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001310919.1|285547_286099_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879825.1|286108_286906_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174143683.1|287062_287587_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_174143684.1|287609_287939_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	6.2e-42
WP_000334589.1|287820_288318_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	66.7	1.4e-53
>prophage 16
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	299702	300455	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_001524857.1|299702_300455_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	6.4e-26
>prophage 17
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	312436	313951	4902569		Cedratvirus(100.0%)	1	NA	NA
WP_174143686.1|312436_313951_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	2.8e-12
>prophage 18
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	324038	328307	4902569		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001313042.1|324038_325700_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_021576217.1|325990_326851_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036385.1|326853_327903_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|327917_328307_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 19
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	332814	334548	4902569	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|332814_334548_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 20
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	341164	343215	4902569		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|341164_341908_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|341948_342344_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_001524835.1|342396_343215_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 21
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	347108	354172	4902569		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|347108_347630_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024919.1|347631_348234_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|348304_348370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|348508_349120_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|349128_350139_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_097750681.1|350285_351071_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|351067_351823_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_134881692.1|351901_352834_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|352849_354172_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 22
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	358170	359646	4902569		Cyanophage(100.0%)	1	NA	NA
WP_000301716.1|358170_359646_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 23
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	367702	372171	4902569		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944249.1|367702_368365_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011664.1|368388_369045_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|369146_369377_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000255065.1|369515_369890_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879320.1|369893_370766_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|370778_371120_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812745.1|371514_372171_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
>prophage 24
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	379666	381715	4902569		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|379666_381715_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 25
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	387047	387257	4902569		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|387047_387257_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 26
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	392898	394455	4902569		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|392898_394455_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 27
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	398317	406423	4902569	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_174143694.1|398317_399679_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	3.1e-42
WP_000457334.1|399752_399932_+	YoaH family protein	NA	NA	NA	NA	NA
WP_071525875.1|400051_400411_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_174144212.1|400772_401117_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128877.1|401248_403159_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	2.9e-91
WP_001220974.1|403216_403912_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|403951_404533_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|404737_406423_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 28
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	415390	419967	4902569		Bacillus_phage(100.0%)	3	NA	NA
WP_001296127.1|415390_416881_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621388.1|417061_418537_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219684.1|418683_419967_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 29
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	423285	424140	4902569		Indivirus(100.0%)	1	NA	NA
WP_001385373.1|423285_424140_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 30
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	432953	437039	4902569		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723734.1|432953_433934_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	8.7e-07
WP_000719098.1|434070_434829_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001385371.1|434946_436305_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135068.1|436397_437039_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 31
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	442756	444712	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235804.1|442756_444712_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 32
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	449102	449756	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|449102_449756_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 33
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	455497	457653	4902569		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692303.1|455497_455719_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_174143701.1|455781_456258_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860074.1|456273_456753_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234688.1|456834_457653_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	2.3e-45
>prophage 34
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	465862	523237	4902569	transposase	Enterobacteria_phage(25.0%)	27	NA	NA
WP_001323514.1|465862_466111_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|466179_466371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346664.1|467964_468078_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_174143702.1|468901_470449_+	YadA-like family protein	NA	Q9MCI8	Enterobacteria_phage	76.1	6.4e-20
WP_000884153.1|470510_470966_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_174143703.1|474774_475968_-	MFS transporter	NA	NA	NA	NA	NA
WP_174143704.1|476103_477828_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|477828_478776_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015724.1|478775_480518_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001354579.1|480514_481792_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001354580.1|481873_484075_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000968123.1|486663_487542_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101719.1|487538_488396_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983725.1|488392_489220_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.9	5.6e-07
WP_000555617.1|489219_490134_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000823671.1|493495_494020_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	62.4	3.0e-62
WP_001470144.1|494148_494373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024211228.1|495621_495942_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_174143705.1|501227_502454_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.7	9.7e-64
WP_000502867.1|502438_503083_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.5	1.6e-54
WP_001373875.1|504672_505695_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	1.1e-198
WP_000248798.1|507101_507422_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.9	8.8e-33
WP_000952435.1|507487_508660_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.4	6.8e-224
WP_000961389.1|511265_512525_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	27.8	1.7e-15
WP_000881114.1|516168_516561_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001354603.1|518364_519396_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_139502184.1|521149_523237_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	33.8	2.3e-09
>prophage 35
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	541020	542208	4902569	integrase	Enterobacteria_phage(100.0%)	1	536018:536031	548260:548273
536018:536031	attL	AGAAAATCAGCGCG	NA	NA	NA	NA
WP_001218736.1|541020_542208_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.6	5.8e-122
WP_001218736.1|541020_542208_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.6	5.8e-122
548260:548273	attR	CGCGCTGATTTTCT	NA	NA	NA	NA
>prophage 36
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	546475	547696	4902569		Klosneuvirus(100.0%)	1	NA	NA
WP_115763105.1|546475_547696_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.7e-26
>prophage 37
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	555172	556000	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|555172_556000_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 38
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	562124	564386	4902569		Tupanvirus(100.0%)	1	NA	NA
WP_174143711.1|562124_564386_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	2.5e-142
>prophage 39
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	573763	593303	4902569	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144199.1|573763_575692_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
WP_001700733.1|575695_576238_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|576334_576532_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|576584_576941_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|577063_577108_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|577391_578375_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672325.1|578389_580777_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|580781_581081_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956535.1|581181_582162_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154195.1|582223_582775_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029452.1|582774_583524_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|583601_584066_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001296111.1|584313_585027_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_174143712.1|585089_586526_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|586529_586721_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082215.1|586852_587899_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|588055_588889_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|589221_591600_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_001296108.1|591656_593303_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
>prophage 40
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	611776	616860	4902569		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367158.1|611776_612145_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
WP_042091596.1|612153_613641_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948882.1|613650_614397_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_174143716.1|614371_615643_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144570.1|615639_616860_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	5.8e-93
>prophage 41
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	625149	627416	4902569		Escherichia_phage(50.0%)	3	NA	NA
WP_001524760.1|625149_625818_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	7.7e-23
WP_001070012.1|625814_626600_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_174143718.1|626603_627416_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 42
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	632921	641725	4902569		Orpheovirus(20.0%)	9	NA	NA
WP_000493948.1|632921_633563_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|633602_634751_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182336.1|635041_636253_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269498.1|636365_637298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174143721.1|637294_638320_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	6.3e-32
WP_000102278.1|638618_638708_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_174143722.1|638873_640043_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|640188_640770_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101207.1|640897_641725_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 43
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	646140	647639	4902569		Indivirus(50.0%)	2	NA	NA
WP_021576193.1|646140_647037_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	1.2e-07
WP_001296099.1|647117_647639_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 44
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	654550	655825	4902569	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|654550_655825_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 45
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	675616	677428	4902569		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945910.1|675616_677428_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 46
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	687323	688625	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_174143725.1|687323_688625_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	3.2e-17
>prophage 47
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	698724	750371	4902569	tail,integrase,terminase,lysis,protease	Enterobacteria_phage(33.33%)	64	706301:706316	736892:736907
WP_097490302.1|698724_699546_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|699645_699729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|699821_700157_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091815.1|700554_701808_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019561.1|701914_702808_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|702942_704163_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|704287_704983_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071849600.1|704935_706228_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
706301:706316	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148693.1|706387_707002_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_174143728.1|707044_707899_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|707900_708518_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_077627272.1|708528_710952_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.1e-207
WP_000041660.1|711012_713439_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001296085.1|713637_713943_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001385358.1|714050_714761_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|714763_715324_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705192.1|715358_715700_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|715834_716161_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|716366_717581_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836080.1|717592_718612_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|718669_718780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|718799_720080_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|720114_720366_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021520755.1|720438_722910_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|723003_723195_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|723191_723380_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_174143729.1|723865_724441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|724442_724598_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_024239371.1|724790_725198_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000476994.1|725275_725503_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_021568048.1|725486_726008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174143730.1|725988_726954_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.9e-55
WP_001151183.1|726994_727417_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_001366387.1|727413_727647_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_021568046.1|727700_728366_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000887491.1|728924_729137_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|729353_729605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|729671_729950_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001531701.1|729951_731001_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_001047121.1|731014_731767_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_000203370.1|732927_733113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795389.1|733738_733828_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|733882_734095_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066485.1|734395_734611_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000839590.1|735364_735580_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_040082246.1|735584_735896_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	79.7	4.5e-26
WP_001092973.1|735892_736426_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	8.4e-97
WP_001071769.1|736422_736920_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
736892:736907	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|737282_737495_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|737505_737694_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|737696_737762_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|737841_737997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|738169_738343_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001531698.1|738494_738905_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	91.2	5.0e-65
WP_001031431.1|739205_739412_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|739957_740497_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507036.1|740505_742605_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_097725716.1|742601_742814_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	5.4e-31
WP_001429608.1|744711_745287_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	2.7e-101
WP_000086522.1|745384_745975_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|746291_746525_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|746593_746707_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_096950224.1|748671_750132_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.0e-43
WP_000214712.1|750167_750371_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 48
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	754757	755648	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_000592832.1|754757_755648_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-20
>prophage 49
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	758650	759034	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091198.1|758650_759034_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 50
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	765777	767196	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_000558459.1|765777_767196_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 51
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	793500	795900	4902569		Klosneuvirus(100.0%)	1	NA	NA
WP_001385338.1|793500_795900_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
>prophage 52
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	799305	801064	4902569		Escherichia_phage(66.67%)	3	NA	NA
WP_000642417.1|799305_800316_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
WP_000605675.1|800501_800780_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000781370.1|800779_801064_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 53
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	812488	814033	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|812488_814033_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 54
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	823027	825100	4902569		Salmonella_phage(100.0%)	1	NA	NA
WP_171871124.1|823027_825100_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 55
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	830595	831609	4902569		Mycoplasma_phage(100.0%)	1	NA	NA
WP_174143742.1|830595_831609_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	3.9e-26
>prophage 56
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	835238	837200	4902569		Phage_TP(100.0%)	1	NA	NA
WP_024186902.1|835238_837200_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 57
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	849049	849998	4902569		Moraxella_phage(50.0%)	2	NA	NA
WP_000731859.1|849049_849223_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001607301.1|849467_849998_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	9.1e-19
>prophage 58
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	853938	857841	4902569		Klosneuvirus(100.0%)	1	NA	NA
WP_174143743.1|853938_857841_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	5.0e-53
>prophage 59
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	871052	872042	4902569		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|871052_872042_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 60
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	877001	886414	4902569	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837936.1|877001_878135_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	53.8	7.5e-103
WP_001295593.1|878275_878710_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157412.1|881034_881970_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123755.1|882097_883471_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
WP_000387388.1|883943_884927_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001607292.1|885181_886414_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 61
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	892737	893253	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|892737_893253_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 62
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	910477	911560	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057954.1|910477_911560_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	3.3e-23
>prophage 63
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	930901	932919	4902569		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|930901_931708_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135012.1|931755_932919_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	9.6e-29
>prophage 64
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	941853	943788	4902569		Lactococcus_phage(100.0%)	1	NA	NA
WP_174143754.1|941853_943788_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	1.8e-32
>prophage 65
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	951600	952191	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|951600_952191_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 66
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	957101	962393	4902569	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001304419.1|957101_959699_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|960078_960330_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422035.1|960365_961415_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|961634_962393_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 67
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	970891	973849	4902569		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763544.1|970891_972487_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195270.1|972490_973849_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.1e-36
>prophage 68
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	983811	985826	4902569		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|983811_984816_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110950.1|984812_985826_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 69
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	995392	1001754	4902569		Citrobacter_phage(33.33%)	7	NA	NA
WP_000068076.1|995392_996010_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|996613_997027_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|997170_998079_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_174143760.1|998280_999294_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|999385_1000291_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001311640.1|1000403_1000862_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1000911_1001754_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
>prophage 70
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1010509	1012048	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_174143762.1|1010509_1012048_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 71
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1023179	1029448	4902569		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|1023179_1023410_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063608.1|1023679_1024780_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170956.1|1025184_1025292_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|1025440_1026295_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|1026330_1027140_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|1027143_1027536_-	SirB family protein	NA	NA	NA	NA	NA
WP_174143764.1|1027532_1028366_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1028365_1029448_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 72
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1032584	1035336	4902569		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1032584_1033532_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033350.1|1033656_1035336_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
>prophage 73
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1047785	1048544	4902569		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|1047785_1048544_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 74
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1064461	1066149	4902569		Salmonella_phage(50.0%)	2	NA	NA
WP_000457596.1|1064461_1065730_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
WP_137506631.1|1065729_1066149_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	1.8e-38
>prophage 75
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1081013	1083882	4902569		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000332288.1|1081013_1081745_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
WP_000373109.1|1081965_1082370_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032144256.1|1082422_1082548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|1082631_1083882_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 76
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1087018	1088389	4902569		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423735.1|1087018_1088389_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
>prophage 77
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1093410	1095388	4902569		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|1093410_1094547_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|1094530_1095388_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 78
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1098663	1102386	4902569		Vibrio_phage(50.0%)	4	NA	NA
WP_000952747.1|1098663_1099485_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	1.2e-22
WP_000291259.1|1099500_1100412_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251363.1|1100440_1101685_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|1101684_1102386_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 79
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1109673	1109931	4902569		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1109673_1109931_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 80
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1122253	1123896	4902569		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267918.1|1122253_1123258_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257002.1|1123254_1123896_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 81
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1127168	1128350	4902569		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1127168_1127405_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|1127615_1128350_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 82
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1140706	1141648	4902569		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001305885.1|1140706_1141648_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 83
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1157529	1157775	4902569		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1157529_1157775_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 84
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1162438	1163359	4902569		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|1162438_1163359_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 85
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1172666	1173200	4902569		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1172666_1173200_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 86
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1177336	1178170	4902569		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1177336_1178170_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 87
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1181559	1182927	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_000409839.1|1181559_1182927_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 88
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1189745	1190534	4902569		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|1189745_1190534_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 89
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1205131	1207231	4902569		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028098.1|1205131_1205626_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_174143768.1|1205646_1206975_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	1.2e-232
WP_001273658.1|1207057_1207231_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 90
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1210261	1222678	4902569		Klosneuvirus(20.0%)	13	NA	NA
WP_000420626.1|1210261_1211182_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|1211181_1211487_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209905.1|1211741_1212341_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063141.1|1212337_1214884_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.6	2.9e-70
WP_001230247.1|1214883_1216056_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|1216185_1216878_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264953.1|1216850_1217879_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054740.1|1217961_1220694_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	3.2e-38
WP_000818462.1|1220776_1221850_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1221898_1222072_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|1222061_1222292_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1222266_1222455_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1222465_1222678_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 91
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1233674	1234334	4902569	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1233674_1234334_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 92
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1238568	1240623	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_001385262.1|1238568_1240623_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 93
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1253233	1255141	4902569		Tupanvirus(100.0%)	1	NA	NA
WP_000053085.1|1253233_1255141_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 94
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1263896	1274694	4902569	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_174143773.1|1263896_1264664_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_174143774.1|1264706_1267319_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001385261.1|1267584_1268787_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117890.1|1268955_1270356_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	1.2e-81
WP_000977925.1|1270958_1272047_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	8.3e-99
WP_000462693.1|1272231_1273422_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109456.1|1273471_1274119_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1274145_1274694_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 95
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1289399	1293939	4902569		Bacillus_phage(100.0%)	3	NA	NA
WP_000551259.1|1289399_1291148_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705730.1|1291184_1293449_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1293654_1293939_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 96
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1299025	1300114	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057123.1|1299025_1300114_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	1.2e-81
>prophage 97
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1304212	1307427	4902569		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292820.1|1304212_1306495_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000111043.1|1306686_1307427_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 98
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1310512	1398176	4902569	tail,integrase,tRNA,capsid,plate,terminase,lysis,head,portal,protease	Salmonella_phage(55.74%)	92	1390804:1390818	1401381:1401395
WP_000213098.1|1310512_1311130_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_089579098.1|1311140_1313585_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|1313823_1315116_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1315206_1316550_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001385256.1|1316560_1317172_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_174143778.1|1317330_1321452_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1321586_1322081_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|1322624_1323590_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_174143779.1|1323712_1325479_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_174143780.1|1325479_1327201_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	2.0e-14
WP_001241678.1|1327242_1327947_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1328231_1328450_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1329135_1331412_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1331442_1331763_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1332085_1332310_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188133.1|1332382_1334329_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746478.1|1334325_1335441_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|1335591_1336548_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599803.1|1336544_1338203_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1338627_1339323_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491132.1|1339642_1340542_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458843.1|1340685_1342338_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001524402.1|1342349_1343318_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_174143781.1|1343450_1345169_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566364.1|1345205_1346207_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_021575982.1|1346217_1347648_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001524393.1|1347746_1348760_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021555168.1|1348756_1349587_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	29.4	1.3e-06
WP_001160737.1|1349583_1349907_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001295906.1|1350032_1350548_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1350765_1351494_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|1351511_1352243_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|1352249_1352966_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1352965_1353634_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1353859_1354591_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021575980.1|1354619_1355747_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	1.3e-27
WP_000389260.1|1355787_1356276_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061639.1|1356335_1357181_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001607105.1|1357177_1358122_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1358131_1359265_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|1359359_1360472_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1360821_1361298_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1361385_1362288_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|1362348_1363071_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|1363054_1363342_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_024705195.1|1363501_1363759_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	2.3e-23
WP_000681104.1|1363788_1364166_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|1364435_1366121_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1366356_1366575_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_174143782.1|1366665_1367769_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	2.3e-173
WP_174143783.1|1367765_1368251_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_174143784.1|1368247_1371325_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|1371317_1371437_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|1371451_1371754_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|1371808_1372324_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046145.1|1372333_1373506_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.0e-203
WP_174143785.1|1373648_1373915_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	77.8	5.8e-30
WP_174143786.1|1373940_1374534_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	61.4	7.3e-57
WP_174144214.1|1374505_1374958_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	97.3	7.4e-78
WP_000104775.1|1374929_1376339_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	1.7e-152
WP_001086832.1|1376335_1376941_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_089582192.1|1376933_1377842_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.6e-143
WP_000177585.1|1377828_1378188_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	4.2e-52
WP_000993758.1|1378184_1378763_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	5.5e-94
WP_000829113.1|1379612_1380056_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	7.3e-62
WP_001039945.1|1380048_1380480_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_009008394.1|1380575_1381004_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.9	5.2e-57
WP_174143787.1|1381000_1381516_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.3e-89
WP_000171568.1|1381496_1381712_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1381715_1381919_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_063085725.1|1381918_1382383_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000059191.1|1382478_1383129_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|1383132_1384191_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216238.1|1384207_1385041_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098426.1|1385183_1386950_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520390.1|1386949_1387975_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.8	1.3e-173
WP_021536371.1|1388019_1388832_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_000215882.1|1389190_1389931_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	91.1	7.8e-133
WP_001217562.1|1390059_1390293_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|1390303_1390492_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000017513.1|1390645_1393060_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
1390804:1390818	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
WP_000104188.1|1393056_1393914_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	6.2e-158
WP_000145291.1|1393910_1394213_-	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	45.5	1.7e-09
WP_000752613.1|1394209_1394437_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|1394436_1394670_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|1394737_1395079_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956194.1|1395042_1395243_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	95.5	1.8e-31
WP_000460898.1|1395250_1395760_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.6	2.9e-86
WP_000188450.1|1395824_1396028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001385249.1|1396173_1396743_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	2.5e-38
WP_000900883.1|1396758_1396950_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290929.1|1397138_1398176_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.2e-102
1401381:1401395	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 99
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1404310	1405513	4902569		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1404310_1405513_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 100
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1416847	1418719	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295896.1|1416847_1418719_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 101
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1421934	1428818	4902569		Synechococcus_phage(33.33%)	5	NA	NA
WP_001295895.1|1421934_1422597_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	9.7e-26
WP_001295894.1|1422727_1423627_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209354.1|1423632_1426065_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114251.1|1426210_1427026_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_021540191.1|1427225_1428818_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	1.7e-60
>prophage 102
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1433815	1439041	4902569		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1433815_1434331_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1434383_1434449_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1434683_1435571_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1435870_1436374_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1436777_1437524_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1437662_1438322_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1438318_1439041_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 103
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1445429	1457000	4902569		Synechococcus_phage(20.0%)	10	NA	NA
WP_000990158.1|1445429_1446107_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
WP_000146357.1|1446180_1446447_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|1446711_1446972_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443542.1|1447110_1448196_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_021575974.1|1448335_1449298_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218670.1|1449325_1451476_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	8.2e-42
WP_000007116.1|1452011_1453373_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001295890.1|1453601_1454273_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|1454275_1455271_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001385246.1|1455263_1457000_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 104
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1467599	1468508	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295887.1|1467599_1468508_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 105
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1474835	1476125	4902569		Klosneuvirus(100.0%)	1	NA	NA
WP_021536363.1|1474835_1476125_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
>prophage 106
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1486387	1492962	4902569		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891664.1|1486387_1487446_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
WP_000604037.1|1487448_1488138_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|1488137_1488911_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1489077_1489227_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147446.1|1489355_1490144_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096844.1|1490211_1491684_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001265440.1|1491945_1492962_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 107
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1497325	1500845	4902569		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109194.1|1497325_1498378_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
WP_000784342.1|1498693_1499074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951270.1|1499187_1500129_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	7.5e-24
WP_000345426.1|1500125_1500845_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	27.4	8.9e-17
>prophage 108
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1532695	1533487	4902569		Kaumoebavirus(100.0%)	1	NA	NA
WP_174143797.1|1532695_1533487_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.8	9.8e-09
>prophage 109
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1536865	1548699	4902569		Hokovirus(40.0%)	10	NA	NA
WP_001032722.1|1536865_1538347_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
WP_137495915.1|1538389_1539808_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	1.2e-60
WP_001075783.1|1539804_1540314_-	YbgA family protein	NA	NA	NA	NA	NA
WP_000424788.1|1540414_1540621_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|1540933_1541023_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_174143799.1|1541022_1542696_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087995.1|1542718_1544767_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	7.1e-27
WP_045132892.1|1544775_1545348_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001298625.1|1545340_1548025_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_000186082.1|1548021_1548699_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 110
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1555355	1556120	4902569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|1555355_1556120_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 111
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1560265	1562911	4902569	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_001287134.1|1560265_1561930_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_174143800.1|1562149_1562911_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	9.7e-30
>prophage 112
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1567404	1568163	4902569		Moraxella_phage(100.0%)	1	NA	NA
WP_000480543.1|1567404_1568163_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 113
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1571217	1573164	4902569		Vibrio_phage(100.0%)	1	NA	NA
WP_001023117.1|1571217_1573164_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
>prophage 114
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1577789	1579454	4902569		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1577789_1579454_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 115
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1584020	1585061	4902569		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1584020_1585061_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 116
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1593013	1593739	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631387.1|1593013_1593739_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	9.9e-32
>prophage 117
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1600678	1603261	4902569	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157896.1|1600678_1603261_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 118
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1610271	1612711	4902569		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231421.1|1610271_1611360_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1611499_1612711_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 119
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1617130	1617776	4902569		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1617130_1617514_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1617566_1617776_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 120
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1631864	1633979	4902569		Morganella_phage(50.0%)	2	NA	NA
WP_001295855.1|1631864_1632293_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
WP_001385239.1|1632413_1633979_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 121
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1637084	1638907	4902569		Streptococcus_phage(50.0%)	2	NA	NA
WP_174143803.1|1637084_1638305_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	3.9e-57
WP_000502950.1|1638277_1638907_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 122
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1653198	1659241	4902569		Klosneuvirus(50.0%)	3	NA	NA
WP_000140634.1|1653198_1654014_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
WP_174143806.1|1654010_1655144_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_174143807.1|1655359_1659241_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	2.0e-62
>prophage 123
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1670264	1673408	4902569		Leptospira_phage(100.0%)	1	NA	NA
WP_000573908.1|1670264_1673408_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	4.4e-60
>prophage 124
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1676553	1678669	4902569		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|1676553_1677237_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_001524240.1|1677226_1678669_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.0e-11
>prophage 125
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1687460	1691935	4902569	tail,tRNA	Enterobacteria_phage(33.33%)	6	NA	NA
WP_001111239.1|1687460_1687817_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	68.2	1.5e-54
WP_000025786.1|1688566_1688764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729155.1|1688804_1689671_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190282.1|1689672_1689885_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143516.1|1689992_1690514_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912352.1|1690549_1691935_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 126
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1704270	1705416	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_174143811.1|1704270_1705416_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	1.7e-49
>prophage 127
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1711605	1713387	4902569		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014640108.1|1711605_1713387_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 128
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1724492	1725179	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1724492_1725179_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 129
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1728435	1729113	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_174143818.1|1728435_1729113_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	8.9e-27
>prophage 130
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1734482	1737724	4902569		Escherichia_phage(66.67%)	3	NA	NA
WP_174143820.1|1734482_1736987_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	7.7e-116
WP_000806442.1|1737044_1737386_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057523.1|1737421_1737724_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 131
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1745963	1754421	4902569		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801793.1|1745963_1746923_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.2	1.3e-15
WP_174143823.1|1746919_1747882_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001313630.1|1748013_1748658_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1748838_1750713_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1750822_1751428_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1751427_1751757_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000121992.1|1751809_1753741_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1753869_1754421_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 132
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1761259	1764409	4902569		Leptospira_phage(100.0%)	1	NA	NA
WP_001132478.1|1761259_1764409_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 133
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1774804	1778351	4902569		Bacillus_phage(100.0%)	2	NA	NA
WP_001256207.1|1774804_1776586_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.5e-41
WP_001235630.1|1776578_1778351_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
>prophage 134
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1781674	1782370	4902569		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817231.1|1781674_1782370_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 135
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1785510	1790557	4902569	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1785510_1785783_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_024221213.1|1785991_1788346_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	9.4e-225
WP_000130305.1|1788533_1789808_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1789933_1790557_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 136
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1811991	1820834	4902569	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1811991_1812462_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150440.1|1812550_1813654_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_000543535.1|1813657_1814107_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001298536.1|1814257_1814797_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295827.1|1815095_1815980_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1816017_1816365_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1816494_1817466_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934823.1|1817476_1819324_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1819351_1819684_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1819706_1820834_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 137
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1827785	1837883	4902569		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|1827785_1829081_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|1829138_1829828_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001356972.1|1830017_1831220_+	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	26.4	1.8e-06
WP_174143830.1|1831216_1834360_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001331503.1|1834485_1835670_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219313.1|1835938_1836847_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1836971_1837883_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 138
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1842172	1843288	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1842172_1843288_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 139
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1850702	1851860	4902569		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830764.1|1850702_1851860_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 140
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1858768	1862236	4902569		Planktothrix_phage(50.0%)	4	NA	NA
WP_000939359.1|1858768_1859536_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
WP_001018402.1|1859548_1860511_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001141271.1|1860816_1861092_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842109.1|1861126_1862236_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 141
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1865315	1867276	4902569		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_021540120.1|1865315_1866329_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.2e-43
WP_174143834.1|1866325_1867276_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	34.9	3.3e-35
>prophage 142
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1872686	1876966	4902569		Enterobacteria_phage(50.0%)	2	NA	NA
WP_089579553.1|1872686_1873769_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.6	3.5e-190
WP_174143835.1|1873891_1876966_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.1	0.0e+00
>prophage 143
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1891460	1892510	4902569		Tupanvirus(100.0%)	1	NA	NA
WP_000692730.1|1891460_1892510_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 144
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1903900	1911468	4902569	integrase,holin	Vibrio_phage(33.33%)	5	1897412:1897425	1912495:1912508
1897412:1897425	attL	TTGCCGTTGGTGAA	NA	NA	NA	NA
WP_174143843.1|1903900_1905934_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001385220.1|1906062_1906650_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001545821.1|1906663_1908136_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159126.1|1908149_1909820_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	1.2e-59
WP_174143844.1|1910904_1911468_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.8	2.1e-53
1912495:1912508	attR	TTGCCGTTGGTGAA	NA	NA	NA	NA
>prophage 145
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1921374	1924679	4902569		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_174143846.1|1921374_1922700_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	5.5e-113
WP_000474088.1|1922808_1923045_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295800.1|1923056_1923650_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_162828489.1|1923809_1924679_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	8.4e-54
>prophage 146
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1930721	1931573	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_174143848.1|1930721_1931573_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	5.7e-47
>prophage 147
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1949863	1978272	4902569	integrase,holin	Enterobacteria_phage(16.67%)	28	1970717:1970731	1977652:1977666
WP_001034005.1|1949863_1953994_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	2.5e-281
WP_001059463.1|1954149_1954644_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174143851.1|1955069_1955417_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	3.4e-22
WP_000588629.1|1955983_1956271_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_142434402.1|1956530_1956971_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.4	1.8e-44
WP_142434408.1|1957000_1957978_-	Abi family protein	NA	NA	NA	NA	NA
WP_115791316.1|1958848_1959463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142434400.1|1959481_1961587_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	37.0	7.9e-90
WP_021562074.1|1961586_1963008_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	2.2e-123
WP_000909175.1|1963007_1963685_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|1963678_1964140_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|1964156_1964318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142434398.1|1964902_1967659_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.5	6.1e-300
WP_001208878.1|1967645_1968017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142434397.1|1968009_1968351_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.6	1.2e-32
WP_115791313.1|1968361_1968964_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.8	1.1e-25
WP_000181940.1|1968956_1969178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142434396.1|1969174_1969438_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
WP_001065741.1|1969434_1969629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142434395.1|1969621_1970689_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.3	2.1e-14
WP_000476151.1|1970685_1970865_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
1970717:1970731	attL	AAACGCGCCAGCGGT	NA	NA	NA	NA
WP_001019378.1|1970857_1971691_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412531.1|1971703_1972135_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|1972134_1972338_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_016235909.1|1972989_1974204_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	8.3e-132
WP_000893305.1|1974559_1975813_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_001285288.1|1975824_1976928_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|1977216_1978272_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
1977652:1977666	attR	AAACGCGCCAGCGGT	NA	NA	NA	NA
>prophage 148
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1983010	1984162	4902569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001311432.1|1983010_1984162_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
>prophage 149
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1989172	1992495	4902569		Clostridioides_phage(50.0%)	4	NA	NA
WP_000093933.1|1989172_1989922_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|1990233_1990974_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1990944_1991712_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1991916_1992495_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 150
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	1996926	2001128	4902569		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_001385210.1|1996926_1997658_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|1997722_1998190_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|1998186_1998909_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052747.1|1998942_1999698_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1999769_2001128_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
>prophage 151
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2010758	2011790	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|2010758_2011790_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 152
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2024748	2028864	4902569		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294797.1|2024748_2028231_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.7	1.8e-208
WP_000569423.1|2028267_2028864_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 153
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2037692	2038451	4902569		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2037692_2038451_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 154
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2050031	2051456	4902569	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|2050031_2051456_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 155
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2055385	2055730	4902569		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2055385_2055730_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 156
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2061641	2062439	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2061641_2062439_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 157
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2068439	2119499	4902569	bacteriocin,transposase,tRNA	Acanthamoeba_polyphaga_mimivirus(16.67%)	48	NA	NA
WP_000244358.1|2068439_2069813_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000110512.1|2070092_2070809_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001035606.1|2070854_2071421_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000918174.1|2071761_2074287_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_174144216.1|2074380_2076810_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.0e-41
WP_001294702.1|2076883_2077414_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396050.1|2077428_2078133_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2078310_2078766_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_001523999.1|2078802_2079729_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2079767_2081186_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_001526621.1|2081182_2081662_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001526620.1|2081994_2082588_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001526619.1|2082669_2083395_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_174143860.1|2083435_2086033_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_174143861.1|2086047_2086605_+	fimbrial protein	NA	NA	NA	NA	NA
WP_115763320.1|2086619_2087225_+	fimbrial protein	NA	NA	NA	NA	NA
WP_174143862.1|2087245_2087836_+	fimbrial protein	NA	NA	NA	NA	NA
WP_021575864.1|2087847_2088960_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000805472.1|2089092_2089887_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000905370.1|2089898_2090750_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000404123.1|2090831_2091029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174143863.1|2091097_2092030_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	5.0e-60
WP_000621515.1|2092303_2092684_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000277940.1|2092687_2093917_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_174143864.1|2093980_2094421_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000972203.1|2094525_2095296_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150638.1|2095292_2096219_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2096327_2096990_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2097030_2097567_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001523987.1|2097772_2100163_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_021555027.1|2100209_2101760_-	multicopper oxidase CueO	NA	NA	NA	NA	NA
WP_001295568.1|2101925_2102273_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000818414.1|2102378_2103245_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734300.1|2103260_2104055_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000384306.1|2104092_2104455_-	YacL family protein	NA	NA	NA	NA	NA
WP_001295775.1|2104629_2107227_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_174143865.1|2107581_2109339_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_000102485.1|2109580_2111005_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000963518.1|2111212_2113105_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_174143866.1|2113119_2115783_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000331776.1|2115943_2116708_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000282229.1|2117163_2117454_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311382.1|2117454_2117694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000543776.1|2117861_2118152_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000085117.1|2118205_2118394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282230.1|2118516_2118807_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311382.1|2118807_2119047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471924.1|2119214_2119499_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 158
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2124074	2124626	4902569		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|2124074_2124626_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 159
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2128872	2129916	4902569		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2128872_2129916_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 160
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2155887	2157612	4902569		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001765377.1|2155887_2157612_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 161
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2169089	2169788	4902569		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916265.1|2169089_2169788_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	4.0e-22
>prophage 162
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2176151	2181574	4902569		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035603.1|2176151_2178503_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.1	6.7e-37
WP_174143870.1|2178667_2181574_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 163
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2189351	2191312	4902569		Microcystis_phage(50.0%)	4	NA	NA
WP_000257181.1|2189351_2190200_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160966.1|2190196_2190511_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|2190513_2190747_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_089536762.1|2190832_2191312_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 164
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2199205	2204865	4902569		Vibrio_phage(50.0%)	4	NA	NA
WP_000787104.1|2199205_2200720_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_174143872.1|2200750_2201893_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_174143873.1|2202021_2203239_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001385198.1|2203311_2204865_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
>prophage 165
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2210368	2211517	4902569		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|2210368_2211517_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 166
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2216326	2219143	4902569	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286821.1|2216326_2219143_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 167
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2225570	2238559	4902569		uncultured_Caudovirales_phage(16.67%)	12	NA	NA
WP_000681384.1|2225570_2226737_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
WP_000494928.1|2226971_2228231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174143876.1|2228359_2229853_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	6.8e-27
WP_001274829.1|2229873_2230635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000809168.1|2231247_2231400_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	78.0	1.6e-13
WP_001118464.1|2231503_2232634_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2232722_2234639_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_174143877.1|2235010_2235415_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102393.1|2235440_2236154_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2236302_2236869_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|2236903_2237491_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|2237605_2238559_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 168
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2250223	2252337	4902569		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219582.1|2250223_2251648_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_001188689.1|2251647_2252337_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 169
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2255614	2260779	4902569		Bacillus_phage(33.33%)	3	NA	NA
WP_000409423.1|2255614_2257552_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|2257758_2259426_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000093834.1|2259546_2260779_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 170
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2268545	2269868	4902569		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477800.1|2268545_2269868_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
>prophage 171
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2275454	2278330	4902569		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2275454_2275616_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001385192.1|2275742_2276348_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2276740_2278330_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 172
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2286160	2287440	4902569		Salmonella_phage(50.0%)	2	NA	NA
WP_001298056.1|2286160_2286700_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000799911.1|2286702_2287440_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 173
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2298063	2299728	4902569		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001531300.1|2298063_2299728_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 174
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2307111	2309457	4902569		Liberibacter_phage(100.0%)	1	NA	NA
WP_000099605.1|2307111_2309457_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.3	1.1e-28
>prophage 175
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2315519	2316440	4902569	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181193.1|2315519_2316440_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 176
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2322389	2322941	4902569		Clostridioides_phage(100.0%)	1	NA	NA
WP_174143889.1|2322389_2322941_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	1.3e-36
>prophage 177
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2331982	2338236	4902569		Ostreococcus_tauri_virus(33.33%)	5	NA	NA
WP_001385180.1|2331982_2333722_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.6	2.0e-38
WP_001051320.1|2333734_2334517_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001020473.1|2334534_2335422_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000706590.1|2335496_2336639_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.2	6.1e-44
WP_001199690.1|2336694_2338236_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.9	3.2e-11
>prophage 178
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2348588	2350049	4902569		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|2348588_2350049_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 179
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2359120	2360797	4902569		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2359120_2359717_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790574.1|2360194_2360797_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	4.0e-55
>prophage 180
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2364167	2365148	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_174143895.1|2364167_2365148_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	56.0	1.4e-100
>prophage 181
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2373967	2378527	4902569		Yersinia_phage(50.0%)	4	NA	NA
WP_174143901.1|2373967_2374786_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.3	3.3e-44
WP_174143902.1|2376570_2377185_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001064742.1|2377302_2377521_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_174143903.1|2377741_2378527_-	hypothetical protein	NA	A0A223LJT0	Erwinia_phage	44.6	5.0e-13
>prophage 182
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2381783	2403587	4902569	integrase,tRNA	Plesiomonas_phage(14.29%)	13	2382046:2382062	2405908:2405924
WP_174143907.1|2381783_2383493_+	type I restriction-modification system subunit M	NA	A0A2I6PG28	Plesiomonas_phage	26.0	5.4e-12
2382046:2382062	attL	CAGAAGAGCTGGAAGTT	NA	NA	NA	NA
WP_174143908.1|2383479_2384871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174143909.1|2384863_2386057_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_174143910.1|2386072_2389207_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.0	3.2e-79
WP_174143911.1|2390455_2391334_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_174143912.1|2391542_2392811_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.8	1.6e-82
WP_001385631.1|2393291_2394311_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	7.1e-44
WP_001385630.1|2394440_2395943_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	7.9e-84
WP_001295681.1|2396070_2397153_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2397152_2398253_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2398519_2400031_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2400288_2400732_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416385.1|2400731_2403587_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
2405908:2405924	attR	AACTTCCAGCTCTTCTG	NA	NA	NA	NA
>prophage 183
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2413934	2420031	4902569		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_136761545.1|2413934_2414870_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	8.5e-52
WP_174143917.1|2414882_2415344_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2415416_2415803_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_174143918.1|2416008_2418705_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	2.0e-45
WP_001387276.1|2418845_2418899_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_174143919.1|2419083_2420031_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.9e-12
>prophage 184
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2423669	2426430	4902569		Vibrio_phage(50.0%)	2	NA	NA
WP_000187799.1|2423669_2425808_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106230.1|2425965_2426430_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	1.3e-53
>prophage 185
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2430619	2437180	4902569		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2430619_2431618_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595993.1|2431650_2432646_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001312395.1|2432632_2433655_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205840.1|2433668_2435171_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|2435383_2436340_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2436649_2437180_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 186
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2483778	2484942	4902569		Ralstonia_phage(100.0%)	1	NA	NA
WP_174143925.1|2483778_2484942_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.4e-80
>prophage 187
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2488784	2501809	4902569	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_174143926.1|2488784_2491226_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001177639.1|2491264_2491690_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2491894_2493193_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2493296_2493494_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2493575_2494580_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|2494582_2495842_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|2495927_2497208_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2497283_2497592_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280359.1|2497677_2498628_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001296676.1|2498620_2500468_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_000990268.1|2500477_2501809_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	7.4e-17
>prophage 188
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2505724	2506270	4902569		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2505724_2506270_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 189
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2513990	2514968	4902569		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2513990_2514968_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 190
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2519888	2520422	4902569		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2519888_2520422_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 191
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2524626	2526610	4902569		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2524626_2526273_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2526316_2526610_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 192
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2540887	2544099	4902569	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856826.1|2540887_2542345_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_000003806.1|2542581_2544099_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 193
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2552254	2556106	4902569		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001034119.1|2552254_2556106_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.6	0.0e+00
>prophage 194
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2579256	2580759	4902569		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|2579256_2580759_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 195
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2585625	2586414	4902569		Pithovirus(100.0%)	1	NA	NA
WP_021539669.1|2585625_2586414_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.5e-12
>prophage 196
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2592018	2593568	4902569		Bacillus_virus(50.0%)	2	NA	NA
WP_001075531.1|2592018_2592777_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
WP_000611411.1|2592887_2593568_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 197
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2599663	2606031	4902569		Bacillus_virus(50.0%)	5	NA	NA
WP_001577549.1|2599663_2601196_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.8e-12
WP_174143942.1|2601174_2602155_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_174143943.1|2602165_2602861_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_174143944.1|2602844_2603774_+	allose kinase	NA	NA	NA	NA	NA
WP_174143945.1|2604045_2606031_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	3.8e-150
>prophage 198
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2611276	2613424	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|2611276_2613424_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 199
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2617341	2618869	4902569		Planktothrix_phage(100.0%)	2	NA	NA
WP_000132446.1|2617341_2618178_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156927.1|2618164_2618869_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
>prophage 200
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2628695	2630654	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021576642.1|2628695_2630654_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	4.3e-90
>prophage 201
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2634708	2636058	4902569		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|2634708_2636058_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 202
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2639875	2643489	4902569		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2639875_2640412_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|2640666_2643489_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 203
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2653432	2654851	4902569		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_174143951.1|2653432_2654851_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	1.6e-38
>prophage 204
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2660250	2664379	4902569		Cronobacter_phage(25.0%)	4	NA	NA
WP_001606623.1|2660250_2661255_-	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.2	2.3e-26
WP_174143953.1|2661251_2661809_-	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	27.7	3.2e-14
WP_001147315.1|2661831_2662911_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	3.1e-29
WP_001296639.1|2662963_2664379_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 205
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2676674	2677283	4902569		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2676674_2677283_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 206
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2684635	2685751	4902569		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2684635_2685751_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 207
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2710092	2713776	4902569		Dickeya_phage(100.0%)	1	NA	NA
WP_001606609.1|2710092_2713776_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 208
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2727570	2729160	4902569		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_174143962.1|2727570_2729160_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 209
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2734522	2736286	4902569		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2734522_2734795_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941119.1|2734981_2735572_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2735614_2736286_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 210
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2744582	2752911	4902569		Vibrio_phage(50.0%)	2	NA	NA
WP_000653953.1|2744582_2748806_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.4	2.5e-66
WP_000263098.1|2748882_2752911_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 211
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2756906	2759959	4902569		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2756906_2758091_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2759008_2759959_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 212
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2768308	2774091	4902569	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
WP_174143964.1|2768308_2770153_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
WP_000186997.1|2770521_2771622_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2771661_2772021_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2772020_2772671_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_174143965.1|2772774_2774091_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
>prophage 213
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2789842	2797089	4902569		Serratia_phage(33.33%)	5	NA	NA
WP_000184856.1|2789842_2792140_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2792190_2792511_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004463.1|2792525_2793605_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185130.1|2793913_2796415_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424857.1|2796426_2797089_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
>prophage 214
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2803902	2805456	4902569		Pandoravirus(100.0%)	1	NA	NA
WP_174143968.1|2803902_2805456_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	7.8e-10
>prophage 215
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2816538	2857331	4902569	integrase,tail,capsid,plate,terminase,portal,head,protease	Enterobacteria_phage(77.14%)	52	2807790:2807803	2825632:2825645
2807790:2807803	attL	TTCGGTCGGGCCGG	NA	NA	NA	NA
WP_000208242.1|2816538_2817069_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|2817078_2818410_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|2818476_2819403_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2819495_2819981_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_097481384.1|2820086_2821082_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	1.3e-103
WP_000025789.1|2821151_2821493_-	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	39.5	5.9e-11
WP_001206784.1|2821596_2822118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813375.1|2822583_2822922_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.9	3.1e-44
WP_000817261.1|2822960_2823203_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_097481385.1|2823395_2823689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125224.1|2823699_2823909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180704.1|2824156_2824639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248670.1|2824873_2825428_+	DNA-binding protein	NA	A0A2I7QQL0	Vibrio_phage	40.3	4.6e-05
WP_157922028.1|2825437_2826058_+	ash family protein	NA	S5MQL6	Escherichia_phage	45.7	1.0e-08
2825632:2825645	attR	TTCGGTCGGGCCGG	NA	NA	NA	NA
WP_097481388.1|2826044_2826458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097481389.1|2826463_2828974_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	50.8	5.0e-208
WP_000196517.1|2828970_2829402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086827.1|2829398_2829593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080487.1|2829604_2829919_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	93.3	1.9e-48
WP_000951718.1|2829920_2830130_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	98.6	7.2e-36
WP_072668117.1|2830339_2830528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024211219.1|2831018_2831522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087835.1|2831588_2832644_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	82.3	6.8e-175
WP_000613852.1|2832643_2834395_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	84.6	7.4e-291
WP_029400548.1|2834549_2835386_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	69.8	5.9e-105
WP_077248672.1|2835414_2836554_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	74.7	8.2e-150
WP_045145341.1|2836556_2837333_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	82.6	1.3e-101
WP_045145342.1|2837435_2837930_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	76.7	6.4e-67
WP_045145344.1|2837929_2838127_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	76.9	2.5e-22
WP_097481391.1|2838120_2838411_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_029400708.1|2838407_2838953_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	41.3	5.9e-29
WP_001354614.1|2838949_2839357_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	42.5	2.1e-15
WP_000920257.1|2839488_2839953_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	70.7	1.9e-60
WP_024211221.1|2840010_2840625_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	69.3	1.8e-74
WP_000990789.1|2840621_2841203_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	69.4	1.9e-73
WP_001354617.1|2841199_2841550_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	74.1	5.1e-42
WP_029490450.1|2841553_2842450_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	79.5	1.6e-127
WP_045146041.1|2842442_2843006_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	77.9	2.1e-74
WP_097481392.1|2843009_2844890_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	67.1	1.0e-72
WP_097481393.1|2844889_2845501_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.6	6.5e-61
WP_000979935.1|2845571_2846060_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	80.7	6.1e-70
WP_097481394.1|2846071_2849383_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	53.0	2.6e-268
WP_001115715.1|2849369_2849525_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	84.3	3.8e-18
WP_000662443.1|2849533_2849896_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	62.1	1.9e-28
WP_045146048.1|2849936_2850455_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	77.2	1.8e-72
WP_097481395.1|2850454_2851645_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	84.3	9.7e-194
WP_097481396.1|2851770_2852898_+	hypothetical protein	NA	A0A0A7NQ97	Enterobacteria_phage	76.0	1.5e-156
WP_029400762.1|2852941_2853193_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_097481397.1|2853335_2853551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059327858.1|2855061_2855202_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	64.4	2.0e-10
WP_001296623.1|2855815_2856061_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2856485_2857331_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 216
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2868941	2873801	4902569		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033719.1|2868941_2869640_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2869636_2871010_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270237.1|2871114_2871789_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166055.1|2871937_2872921_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001340151.1|2873180_2873801_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	6.4e-64
>prophage 217
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2891596	2897823	4902569		Catovirus(50.0%)	3	NA	NA
WP_000105776.1|2891596_2893432_-	ATP-binding protein	NA	A0A1V0SAD6	Catovirus	24.0	6.6e-24
WP_000753590.1|2893742_2894579_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077633385.1|2894772_2897823_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 218
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2906691	2909471	4902569		Escherichia_phage(50.0%)	3	NA	NA
WP_001523571.1|2906691_2907477_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	4.1e-23
WP_000621625.1|2907510_2908407_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718885.1|2908574_2909471_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 219
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2923196	2925667	4902569		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190574.1|2923196_2924246_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
WP_001315107.1|2924257_2925667_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 220
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2929788	2932575	4902569		uncultured_virus(100.0%)	1	NA	NA
WP_000250047.1|2929788_2932575_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 221
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2946270	2946885	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|2946270_2946885_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 222
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2955756	2959043	4902569		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109949.1|2955756_2956533_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459600.1|2956535_2957051_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2957054_2957324_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187544.1|2957402_2959043_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 223
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2981036	2982545	4902569		Vibrio_phage(100.0%)	1	NA	NA
WP_174143982.1|2981036_2982545_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.3	1.4e-08
>prophage 224
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	2990397	2993810	4902569	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_000133649.1|2990397_2991258_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
WP_000928839.1|2991295_2991916_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_001442069.1|2991980_2993810_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 225
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3000414	3008254	4902569		Bacillus_phage(66.67%)	7	NA	NA
WP_000383407.1|3000414_3002577_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213586.1|3002660_3003377_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130676.1|3003376_3004273_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_000812795.1|3004269_3004977_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_001160654.1|3004973_3005798_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000799889.1|3005834_3006038_-	lipoprotein	NA	NA	NA	NA	NA
WP_021536640.1|3006226_3008254_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	67.2	4.8e-84
>prophage 226
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3016389	3018045	4902569		Tetraselmis_virus(100.0%)	1	NA	NA
WP_174143985.1|3016389_3018045_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.4e-44
>prophage 227
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3026052	3032196	4902569		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612050.1|3026052_3027183_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145166.1|3027187_3027862_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|3027839_3028721_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226626.1|3028739_3029807_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000006610.1|3029806_3031069_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|3031065_3032196_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 228
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3036238	3041652	4902569		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3036238_3036568_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|3036698_3037964_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001385573.1|3038099_3039584_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|3039630_3041652_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 229
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3049248	3050895	4902569		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012583.1|3049248_3050895_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	2.5e-67
>prophage 230
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3064292	3070145	4902569		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3064292_3065183_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_174143989.1|3065207_3066173_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|3066177_3067683_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001296586.1|3067690_3068110_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|3068276_3070145_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 231
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3073313	3074306	4902569		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845115.1|3073313_3074306_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 232
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3086261	3093777	4902569		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_174143990.1|3086261_3087632_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334086.1|3087793_3089623_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000867146.1|3089936_3090977_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3091063_3092023_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251985.1|3092022_3092913_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3093003_3093777_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 233
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3104148	3105486	4902569		Moraxella_phage(100.0%)	1	NA	NA
WP_001606486.1|3104148_3105486_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.9	2.6e-62
>prophage 234
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3115684	3123053	4902569		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3115684_3115942_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3115905_3116265_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3116281_3116422_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122134670.1|3116651_3116732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|3117028_3118432_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3118436_3119537_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_053886697.1|3119536_3120610_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_001312204.1|3120638_3123053_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
>prophage 235
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3127757	3128906	4902569		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|3127757_3128906_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 236
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3133327	3145205	4902569		Cyanophage(16.67%)	12	NA	NA
WP_001243437.1|3133327_3133741_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3133852_3134281_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001279774.1|3134477_3136139_+	putative transporter	NA	NA	NA	NA	NA
WP_174143995.1|3136228_3137095_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_174143996.1|3137261_3138977_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	9.5e-41
WP_000828502.1|3138973_3140467_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	8.6e-30
WP_001296568.1|3140526_3140874_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3140863_3141226_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148034.1|3141222_3141720_+	radical SAM protein	NA	NA	NA	NA	NA
WP_174143997.1|3141727_3142912_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	2.0e-13
WP_001312198.1|3143312_3143411_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168498.1|3143516_3145205_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 237
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3153846	3155181	4902569		Moraxella_phage(100.0%)	1	NA	NA
WP_022296286.1|3153846_3155181_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	8.6e-66
>prophage 238
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3161773	3168598	4902569		Enterobacteria_phage(100.0%)	9	NA	NA
WP_174143999.1|3161773_3164107_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856729.1|3164121_3164442_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_174144000.1|3164577_3165033_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|3165025_3165313_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_174144001.1|3165305_3165905_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.0	6.6e-50
WP_001149160.1|3165901_3166168_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|3166720_3167455_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_174144002.1|3167451_3167952_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_174144003.1|3168025_3168598_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.5e-94
>prophage 239
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3171782	3172958	4902569	integrase	Enterobacteria_phage(100.0%)	1	3165109:3165122	3182634:3182647
3165109:3165122	attL	CAAAATCAATATCT	NA	NA	NA	NA
WP_174144006.1|3171782_3172958_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.8	8.6e-211
WP_174144006.1|3171782_3172958_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.8	8.6e-211
3182634:3182647	attR	CAAAATCAATATCT	NA	NA	NA	NA
>prophage 240
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3186328	3187720	4902569		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3186328_3187720_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 241
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3192021	3197042	4902569		Bordetella_phage(33.33%)	4	NA	NA
WP_000280473.1|3192021_3194130_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3194148_3194424_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3194478_3195102_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001296534.1|3195359_3197042_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.0	5.7e-22
>prophage 242
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3201060	3205623	4902569		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3201060_3201519_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050156.1|3201496_3202717_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	1.9e-43
WP_001297375.1|3202888_3203557_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3203773_3204010_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3204030_3204198_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3204295_3205105_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171873.1|3205143_3205623_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 243
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3213062	3215156	4902569		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_174144014.1|3213062_3214091_+	glycosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	9.4e-12
WP_000064006.1|3214172_3215156_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 244
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3218564	3228069	4902569		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|3218564_3219497_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213845.1|3219710_3220907_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000646018.1|3220916_3221942_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982097.1|3222180_3223215_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_022296277.1|3223201_3224161_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214150.1|3224164_3225448_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_174144015.1|3225457_3227002_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3227245_3227677_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3227817_3228069_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 245
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3249930	3254542	4902569		Tupanvirus(50.0%)	3	NA	NA
WP_001527904.1|3249930_3251775_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_174144019.1|3251965_3253117_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_174144020.1|3253246_3254542_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	1.1e-20
>prophage 246
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3278590	3280132	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_109552724.1|3278590_3280132_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	8.6e-17
>prophage 247
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3285448	3286444	4902569		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182627.1|3285448_3286444_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	5.4e-12
>prophage 248
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3290664	3290877	4902569		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3290664_3290877_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 249
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3294531	3296865	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_174144026.1|3294531_3296865_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.8e-72
>prophage 250
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3308468	3310462	4902569		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196477.1|3308468_3309452_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_157702495.1|3309448_3310462_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 251
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3358721	3360191	4902569		Bacillus_virus(50.0%)	2	NA	NA
WP_000123131.1|3358721_3359369_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
WP_000622316.1|3359420_3360191_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 252
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3370864	3371290	4902569		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001525865.1|3370864_3371290_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.0e-49
>prophage 253
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3374429	3376472	4902569		Indivirus(100.0%)	1	NA	NA
WP_001525860.1|3374429_3376472_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	1.1e-46
>prophage 254
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3386158	3388894	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000972085.1|3386158_3388894_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.9e-22
>prophage 255
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3396332	3397139	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|3396332_3397139_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 256
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3405032	3409164	4902569		Dickeya_phage(50.0%)	4	NA	NA
WP_001100463.1|3405032_3405698_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
WP_000130621.1|3405918_3406164_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_096950628.1|3406265_3408464_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000964718.1|3408537_3409164_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 257
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3412170	3414988	4902569		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3412170_3412839_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3412831_3413890_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3414133_3414988_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 258
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3421468	3422951	4902569		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3421468_3422236_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3422237_3422951_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 259
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3426492	3428303	4902569		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907820.1|3426492_3427563_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_174144041.1|3427559_3428303_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.8	4.9e-10
>prophage 260
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3439175	3441272	4902569		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001296481.1|3439175_3441272_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.7	6.1e-42
>prophage 261
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3451601	3454049	4902569		Dickeya_phage(100.0%)	1	NA	NA
WP_174144045.1|3451601_3454049_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 262
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3462653	3463880	4902569		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|3462653_3463880_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 263
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3468270	3470664	4902569		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_174144051.1|3468270_3470664_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 264
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3476702	3477113	4902569	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023908544.1|3476702_3477113_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	42.5	9.3e-11
>prophage 265
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3483703	3487471	4902569		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3483703_3484423_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253709.1|3484419_3485772_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|3485848_3487471_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 266
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3504375	3505212	4902569		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3504375_3505212_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 267
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3524116	3533668	4902569		Acinetobacter_phage(25.0%)	9	NA	NA
WP_001525814.1|3524116_3524680_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
WP_174144058.1|3524765_3525986_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_042091219.1|3526063_3528154_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000242755.1|3528204_3528837_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3529138_3529543_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274684.1|3529597_3530467_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907083.1|3530520_3530739_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	8.9e-05
WP_001525812.1|3530732_3531755_-	hydrolase	NA	NA	NA	NA	NA
WP_000634789.1|3531754_3533668_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 268
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3539237	3547804	4902569		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_174144060.1|3539237_3539624_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	1.1e-18
WP_000820731.1|3539623_3539983_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903381.1|3539989_3540277_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3540402_3540777_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3540873_3541344_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3541440_3543555_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3543625_3544810_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_174144061.1|3545101_3547804_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.4	2.2e-39
>prophage 269
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3556634	3558587	4902569		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|3556634_3558587_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 270
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3579811	3581283	4902569	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004421.1|3579811_3580759_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3580773_3581283_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 271
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3591625	3595779	4902569		Bacillus_virus(50.0%)	4	NA	NA
WP_000078344.1|3591625_3592384_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001296459.1|3592391_3593495_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001385517.1|3593504_3594686_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_174144063.1|3594753_3595779_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	5.3e-71
>prophage 272
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3602283	3603168	4902569		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258953.1|3602283_3603168_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.2e-24
>prophage 273
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3608504	3613017	4902569		Escherichia_phage(50.0%)	4	NA	NA
WP_000843962.1|3608504_3609335_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275540.1|3609676_3610531_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001298583.1|3610566_3611457_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132914.1|3611517_3613017_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.7	1.1e-11
>prophage 274
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3622305	3623349	4902569		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3622305_3623349_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 275
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3641001	3642369	4902569	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001296452.1|3641001_3642369_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 276
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3646336	3650347	4902569	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366127.1|3646336_3646834_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000074796.1|3646941_3647733_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|3647854_3648748_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_174144069.1|3648856_3650347_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	2.9e-09
>prophage 277
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3659050	3673844	4902569		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001296449.1|3659050_3659980_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809780.1|3660075_3662412_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_000719791.1|3662641_3663295_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047069.1|3663291_3664020_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_174144070.1|3664016_3664649_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3664861_3665134_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3665130_3665985_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183674.1|3666030_3666522_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3666639_3666927_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_087903123.1|3666949_3668383_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3668430_3669156_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3669162_3669720_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030531.1|3669688_3670264_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3670260_3670827_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3670847_3671834_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922880.1|3671847_3672825_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3673034_3673844_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 278
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3677912	3679395	4902569		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3677912_3678191_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3678423_3679395_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 279
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3686024	3688897	4902569	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3686024_3687959_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764749.1|3688048_3688897_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.6	7.5e-23
>prophage 280
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3692982	3699621	4902569		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|3692982_3694326_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3694956_3695409_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3695436_3696924_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133040.1|3696948_3699621_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 281
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3705102	3706992	4902569		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3705102_3706992_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 282
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3712694	3720490	4902569		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189305.1|3712694_3712997_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	5.0e-14
WP_000449450.1|3713047_3713491_+	YhbP family protein	NA	NA	NA	NA	NA
WP_001350449.1|3713470_3713989_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001385509.1|3714116_3714752_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_021581077.1|3714824_3715865_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3715977_3716553_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|3716562_3717153_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246833.1|3717172_3717568_-	YraN family protein	NA	NA	NA	NA	NA
WP_174144073.1|3717525_3719562_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_001525741.1|3719626_3720490_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.3e-49
>prophage 283
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3738110	3739256	4902569		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|3738110_3739256_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 284
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3745409	3747704	4902569		Tetraselmis_virus(100.0%)	1	NA	NA
WP_021576493.1|3745409_3747704_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	5.1e-159
>prophage 285
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3767514	3768480	4902569		Escherichia_phage(100.0%)	1	NA	NA
WP_001098827.1|3767514_3768480_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 286
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3781135	3797884	4902569	tRNA	Herpes_simplex_virus(14.29%)	13	NA	NA
WP_174144084.1|3781135_3784228_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.4	1.7e-157
WP_000212450.1|3784411_3785395_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|3785613_3785946_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|3785987_3787367_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094716.1|3787784_3789305_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_000018005.1|3789411_3790035_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001525692.1|3790322_3791087_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228936.1|3791340_3791847_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001183950.1|3791903_3792467_-	NADAR family protein	NA	A8E2M1	Enterococcus_phage	44.1	2.4e-33
WP_000437380.1|3792525_3794367_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918810.1|3794561_3796307_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_001144069.1|3796417_3796633_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264377.1|3796870_3797884_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
>prophage 287
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3804184	3805423	4902569	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_096950272.1|3804184_3805423_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	46.9	4.5e-93
>prophage 288
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3810560	3811994	4902569		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|3810560_3811994_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 289
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3817465	3818119	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|3817465_3818119_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 290
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3829358	3841804	4902569		Ralstonia_phage(16.67%)	11	NA	NA
WP_000442882.1|3829358_3830519_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
WP_000831555.1|3830524_3831196_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735289.1|3831343_3832825_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3833029_3833659_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3833659_3834082_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444744.1|3834106_3834934_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3834933_3835515_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195274.1|3835543_3837436_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_001240664.1|3837499_3839641_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000940874.1|3840014_3840824_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_000986445.1|3840820_3841804_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.3	5.5e-09
>prophage 291
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3847929	3852969	4902569		Stx_converting_phage(50.0%)	4	NA	NA
WP_000712658.1|3847929_3848322_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_174144087.1|3848374_3848857_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001606161.1|3848965_3850573_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174144088.1|3850710_3852969_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	2.4e-84
>prophage 292
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3863154	3867677	4902569		Pseudomonas_phage(50.0%)	4	NA	NA
WP_000095158.1|3863154_3865374_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3865415_3865673_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_174144092.1|3865732_3866650_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013141.1|3866849_3867677_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	3.6e-62
>prophage 293
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3873520	3874405	4902569		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001531969.1|3873520_3874405_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.5	9.8e-66
>prophage 294
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3896618	3897791	4902569		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524961.1|3896618_3897791_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	7.2e-40
>prophage 295
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3931110	3932130	4902569		Tupanvirus(100.0%)	1	NA	NA
WP_001024188.1|3931110_3932130_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.1	4.1e-84
>prophage 296
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3938199	3941754	4902569		Ralstonia_phage(33.33%)	3	NA	NA
WP_000924566.1|3938199_3939768_+	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	30.3	2.4e-46
WP_000584102.1|3939764_3940496_+	hypothetical protein	NA	M1H491	Acanthocystis_turfacea_Chlorella_virus	31.1	1.3e-18
WP_000685104.1|3940584_3941754_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	53.7	2.4e-112
>prophage 297
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3950313	3951297	4902569		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001385480.1|3950313_3951297_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 298
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3974981	3976136	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3974981_3976136_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 299
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3984516	3985425	4902569		Yersinia_phage(100.0%)	1	NA	NA
WP_174144100.1|3984516_3985425_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	6.7e-54
>prophage 300
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	3991128	3991806	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_174144103.1|3991128_3991806_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	2.9e-09
>prophage 301
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4005343	4006576	4902569		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4005343_4006576_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 302
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4014712	4019172	4902569		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195015.1|4014712_4017586_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	6.3e-263
WP_001339296.1|4017738_4019172_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 303
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4022977	4038368	4902569	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|4022977_4023874_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715230.1|4023898_4024609_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_174144108.1|4024614_4026348_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.2e-59
WP_001701073.1|4026438_4027536_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|4027546_4029064_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001606086.1|4029106_4029655_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_174144109.1|4029709_4029802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312075.1|4029776_4029902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296348.1|4029903_4031352_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	2.1e-25
WP_001527622.1|4031787_4033707_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838413.1|4033706_4034195_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012167.1|4034230_4035598_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_001295158.1|4035633_4036950_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280189.1|4036967_4038368_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 304
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4062646	4063402	4902569		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4062646_4063402_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 305
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4067688	4068450	4902569		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000603518.1|4067688_4068450_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 306
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4079813	4086586	4902569		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4079813_4080527_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082183.1|4080595_4081285_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4081969_4082500_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|4082512_4084759_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4084909_4085785_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4085791_4086586_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 307
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4092062	4103210	4902569		Klosneuvirus(25.0%)	5	NA	NA
WP_001138102.1|4092062_4094951_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.2e-67
WP_021539830.1|4094943_4098486_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	5.2e-09
WP_001525544.1|4098485_4100312_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_000237947.1|4100393_4101725_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4101956_4103210_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 308
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4107081	4108697	4902569		Tetraselmis_virus(50.0%)	2	NA	NA
WP_001066236.1|4107081_4107678_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_001525535.1|4107749_4108697_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	3.4e-16
>prophage 309
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4123180	4132275	4902569		Microcystis_virus(50.0%)	4	NA	NA
WP_000580995.1|4123180_4124065_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.4e-16
WP_000631305.1|4124061_4124958_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.2	4.8e-20
WP_001385460.1|4127164_4129627_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.4	5.2e-16
WP_000147343.1|4129638_4132275_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
>prophage 310
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4140611	4143117	4902569	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000117716.1|4140611_4141418_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000184272.1|4141468_4141912_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001312063.1|4141911_4143117_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.1e-74
>prophage 311
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4154657	4155437	4902569		Bacillus_phage(100.0%)	1	NA	NA
WP_089708907.1|4154657_4155437_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 312
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4160295	4161144	4902569		Vibrio_phage(100.0%)	1	NA	NA
WP_174144119.1|4160295_4161144_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 313
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4168677	4172792	4902569		Hokovirus(50.0%)	2	NA	NA
WP_000186432.1|4168677_4171434_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.4e-54
WP_000046819.1|4171490_4172792_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 314
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4176188	4183636	4902569		Only_Syngen_Nebraska_virus(25.0%)	6	NA	NA
WP_000210878.1|4176188_4177826_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4177913_4179212_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268442.1|4179271_4180144_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199974.1|4180437_4181109_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001232702.1|4181193_4182201_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012896831.1|4182226_4183636_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
>prophage 315
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4190936	4191722	4902569		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|4190936_4191722_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 316
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4206385	4208418	4902569		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|4206385_4207813_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173651.1|4207812_4208418_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
>prophage 317
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4211528	4215244	4902569		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_174144124.1|4211528_4212290_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	1.0e-58
WP_000254708.1|4212283_4212910_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272584.1|4213049_4214189_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4214251_4215244_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 318
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4219610	4226750	4902569		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|4219610_4220249_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_174144126.1|4220245_4221508_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	4.9e-135
WP_000847997.1|4221504_4222413_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001296319.1|4222608_4223376_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|4223426_4224083_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|4224188_4226750_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 319
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4250764	4251730	4902569		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|4250764_4251730_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 320
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4257198	4342803	4902569	integrase,tail,tRNA,capsid,plate,terminase,portal,head,lysis	Salmonella_phage(66.04%)	98	4295043:4295080	4331540:4331577
WP_174144132.1|4257198_4257696_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.0	2.2e-30
WP_000963143.1|4257775_4258837_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4258905_4259406_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047157.1|4259534_4262165_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000906486.1|4262399_4262585_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|4263774_4264341_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000005714.1|4264337_4264766_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611785.1|4264838_4266395_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130208.1|4266544_4267060_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001605992.1|4267110_4268223_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001097131.1|4268219_4268927_-	RNA ligase family protein	NA	NA	NA	NA	NA
WP_001296316.1|4269184_4270723_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_174144133.1|4270739_4271912_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378443.1|4272038_4272569_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|4272659_4272995_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|4272984_4273722_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_174144134.1|4273845_4275030_-	MFS transporter	NA	NA	NA	NA	NA
WP_174144135.1|4275221_4276214_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774965.1|4276270_4277335_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985509.1|4277327_4278530_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777934.1|4278885_4279845_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_001605988.1|4279854_4281999_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.7	1.3e-196
WP_000080947.1|4281971_4282382_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4282378_4282624_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|4282870_4283200_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|4283351_4283696_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|4283732_4284182_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115381.1|4284849_4285254_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229463.1|4285300_4285825_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137290.1|4285834_4286134_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|4286316_4286475_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|4286558_4287008_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_174144136.1|4287008_4287671_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001385446.1|4287691_4289092_-	GABA permease	NA	NA	NA	NA	NA
WP_174144137.1|4289328_4290609_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_000772888.1|4290622_4292071_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271888.1|4292096_4293362_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993108.1|4293381_4294359_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
4295043:4295080	attL	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_174144227.1|4295197_4295878_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	63.8	2.8e-73
WP_032184949.1|4296443_4297460_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.7	1.2e-189
WP_032184948.1|4297462_4298095_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	52.4	2.8e-59
WP_000102105.1|4298216_4298459_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_113075941.1|4298491_4299001_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_174144138.1|4299008_4299305_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	8.4e-22
WP_001747374.1|4299422_4299764_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001244216.1|4299831_4300065_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|4300064_4300292_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_174144139.1|4300288_4301146_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	4.6e-161
WP_174144140.1|4301142_4303557_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_021534477.1|4303711_4303900_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	93.3	2.0e-24
WP_088537758.1|4304485_4305421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001146828.1|4306062_4306977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4306973_4307714_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_174144141.1|4307748_4308786_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	2.4e-172
WP_001098431.1|4308785_4310552_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_174144142.1|4310694_4311528_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.4	9.7e-124
WP_174144143.1|4311544_4312603_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
WP_000059191.1|4312606_4313257_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_174144144.1|4313352_4313817_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	2.1e-75
WP_000868175.1|4313816_4314020_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4314023_4314239_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_174144145.1|4314219_4314735_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	4.0e-88
WP_174144146.1|4314731_4315160_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.9	5.2e-57
WP_001039936.1|4315255_4315687_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_174144147.1|4315679_4316132_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.3	3.7e-61
WP_174144148.1|4316170_4316923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144149.1|4317015_4317594_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	1.8e-92
WP_000177588.1|4317590_4317950_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	8.0e-51
WP_174144150.1|4317936_4318845_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.7e-143
WP_001086820.1|4318837_4319443_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_174144151.1|4319439_4320840_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	81.7	1.1e-159
WP_096272323.1|4320861_4321302_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	4.3e-54
WP_096272325.1|4321273_4321867_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.0	2.9e-53
WP_174144228.1|4321866_4322361_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	92.2	3.3e-79
WP_001463281.1|4322391_4322958_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_174144152.1|4323100_4324273_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|4324282_4324798_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_022645432.1|4324852_4325155_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_000763311.1|4325169_4325289_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_174144153.1|4325281_4328359_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	67.2	0.0e+00
WP_000980396.1|4328355_4328841_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_174144154.1|4328837_4329938_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	1.7e-176
WP_000972389.1|4330028_4330247_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000380485.1|4330508_4330682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151541.1|4330650_4331424_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000162574.1|4332109_4332592_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4331540:4331577	attR	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600193.1|4332723_4333200_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|4333189_4333480_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4333541_4333883_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_174144155.1|4334031_4335693_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|4335778_4336657_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4336779_4337373_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4337426_4338713_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001314062.1|4338733_4339525_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4339691_4341053_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4341189_4341438_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4341456_4342005_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|4342035_4342803_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 321
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4346222	4347293	4902569		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4346222_4347293_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 322
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4353197	4355771	4902569		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4353197_4355771_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 323
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4361553	4362852	4902569		Burkholderia_virus(100.0%)	1	NA	NA
WP_174144156.1|4361553_4362852_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	1.8e-44
>prophage 324
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4368145	4374228	4902569	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4368145_4368565_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|4368771_4369809_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|4369856_4370546_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|4370850_4371234_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189207.1|4371289_4371877_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_174144157.1|4371979_4372861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4372893_4374228_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 325
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4379999	4383741	4902569		Tupanvirus(50.0%)	3	NA	NA
WP_000790169.1|4379999_4381799_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002554.1|4381814_4382789_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4383060_4383741_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 326
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4387201	4387462	4902569		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196294.1|4387201_4387462_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
>prophage 327
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4391581	4402889	4902569		Bacillus_phage(50.0%)	7	NA	NA
WP_000970063.1|4391581_4395469_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	3.8e-130
WP_001385434.1|4396044_4397472_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_001215879.1|4397636_4398350_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4398339_4399674_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4399734_4400073_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883120.1|4400117_4401308_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4401635_4402889_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 328
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4408647	4410159	4902569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_174144161.1|4408647_4410159_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
>prophage 329
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4420277	4426615	4902569		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4420277_4421492_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4421519_4421906_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4421922_4422246_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4422341_4422857_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|4422873_4424724_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|4424725_4425061_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523612.1|4425072_4425273_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001607871.1|4425331_4426615_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.1	6.4e-34
>prophage 330
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4436471	4436903	4902569		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|4436471_4436903_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 331
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4457396	4463876	4902569		Escherichia_phage(66.67%)	7	NA	NA
WP_000937875.1|4457396_4458764_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	2.3e-42
WP_174144168.1|4458925_4460392_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138290.1|4460460_4462038_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_174144169.1|4462130_4462670_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	97.8	1.0e-41
WP_001311989.1|4462685_4463204_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|4463514_4463706_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017560.1|4463723_4463876_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	2.4e-17
>prophage 332
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4470123	4474125	4902569		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028626.1|4470123_4470762_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296287.1|4470761_4471799_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001295473.1|4472123_4472750_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|4472835_4474125_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 333
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4481603	4482317	4902569		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4481603_4482317_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 334
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4499558	4500509	4902569		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4499558_4500509_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 335
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4519063	4540791	4902569		Streptococcus_phage(25.0%)	22	NA	NA
WP_000102892.1|4519063_4519933_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|4520146_4520572_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001296281.1|4520558_4521008_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838953.1|4521068_4521644_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4521739_4522639_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001040456.1|4522816_4524241_-	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001175628.1|4524244_4525141_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000517447.1|4525420_4526212_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_174144171.1|4526369_4527386_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458408.1|4527385_4528219_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4528218_4529094_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021032.1|4529083_4530181_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_174144172.1|4530315_4531227_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	2.7e-58
WP_000719967.1|4531229_4531598_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096640.1|4531702_4532554_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4532596_4533106_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4533146_4534874_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4534918_4535176_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4535559_4536531_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4536715_4537477_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001607835.1|4537706_4538705_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_174144173.1|4538775_4540791_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	1.1e-149
>prophage 336
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4566328	4567063	4902569		Clostridioides_phage(100.0%)	1	NA	NA
WP_001298580.1|4566328_4567063_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	4.7e-13
>prophage 337
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4570881	4571802	4902569		Morganella_phage(100.0%)	1	NA	NA
WP_001527459.1|4570881_4571802_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 338
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4575491	4583067	4902569		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283510.1|4575491_4577186_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|4577255_4578200_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296273.1|4578272_4579418_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_115762997.1|4579473_4583067_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 339
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4591153	4604070	4902569	integrase	Escherichia_phage(83.33%)	6	4583964:4583978	4593788:4593802
4583964:4583978	attL	TTTTTTTTGCACCTC	NA	NA	NA	NA
WP_001224626.1|4591153_4591723_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181153.1|4592471_4593101_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.5	2.4e-119
WP_000243049.1|4593419_4594040_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	2.0e-118
4593788:4593802	attR	GAGGTGCAAAAAAAA	NA	NA	NA	NA
WP_174144180.1|4594064_4601972_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	94.9	0.0e+00
WP_001406120.1|4602031_4602550_+	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	98.3	6.1e-84
WP_000368122.1|4603137_4604070_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	4.6e-167
>prophage 340
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4620204	4621290	4902569		Pandoravirus(100.0%)	1	NA	NA
WP_001311967.1|4620204_4621290_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 341
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4629826	4630963	4902569		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_174144189.1|4629826_4630963_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	1.9e-21
>prophage 342
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4637601	4639119	4902569		Mollivirus(100.0%)	1	NA	NA
WP_000334228.1|4637601_4639119_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 343
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4643330	4644104	4902569		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293612.1|4643330_4644104_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 344
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4654774	4658002	4902569		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203415.1|4654774_4655425_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
WP_001012895.1|4655511_4657344_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813854.1|4657402_4658002_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 345
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4691318	4696322	4902569		Tupanvirus(50.0%)	4	NA	NA
WP_000860315.1|4691318_4693301_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461639.1|4693300_4694269_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
WP_000012636.1|4694272_4695412_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	5.5e-29
WP_174144194.1|4695719_4696322_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	7.5e-09
>prophage 346
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4699925	4704460	4902569	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001296250.1|4699925_4701131_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
WP_001385412.1|4701187_4702477_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992982.1|4702494_4703298_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150336.1|4703338_4703536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140525.1|4703548_4704460_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	1.3e-68
>prophage 347
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4710352	4724169	4902569		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779084.1|4710352_4711429_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301031.1|4711630_4712281_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4712334_4712589_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4712588_4713719_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_174144195.1|4713807_4716093_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_174144229.1|4716774_4720533_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.7e-21
WP_000990769.1|4720672_4721395_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281247.1|4721541_4724169_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 348
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4739092	4743935	4902569		Bacillus_phage(50.0%)	2	NA	NA
WP_001374746.1|4739092_4740919_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	1.7e-19
WP_024224031.1|4741085_4743935_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 349
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4748212	4754014	4902569		Enterobacteria_phage(25.0%)	5	NA	NA
WP_021576301.1|4748212_4749340_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	3.8e-115
WP_021576300.1|4749451_4750507_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786370.1|4750580_4751645_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884927.1|4751644_4752295_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000422201.1|4752370_4754014_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	2.8e-13
>prophage 350
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4762782	4763400	4902569		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4762782_4763400_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 351
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4772700	4789321	4902569	integrase	Vibrio_phage(42.86%)	17	4773564:4773578	4786482:4786496
WP_048230357.1|4772700_4773237_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	41.6	5.6e-08
WP_059278464.1|4773272_4773698_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
4773564:4773578	attL	CGCTGTTCCGTCATA	NA	NA	NA	NA
WP_059278465.1|4773933_4776069_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.0	1.2e-173
WP_059278466.1|4776065_4776353_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000919328.1|4776392_4776578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384686.1|4776570_4776759_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001201666.1|4777405_4777597_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_059278467.1|4777880_4779125_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.3	4.2e-99
WP_000256203.1|4779482_4781243_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135664.1|4781262_4781490_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050789.1|4781671_4782679_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|4782817_4783102_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_021576278.1|4783226_4784987_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|4785136_4785832_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213379.1|4785859_4787050_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
4786482:4786496	attR	CGCTGTTCCGTCATA	NA	NA	NA	NA
WP_000202798.1|4787383_4787728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021576277.1|4787731_4789321_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
>prophage 352
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4795075	4799376	4902569		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4795075_4795642_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001297918.1|4796053_4796767_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198798.1|4796805_4797792_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001385409.1|4797909_4799376_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
>prophage 353
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4812764	4813622	4902569		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|4812764_4813622_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 354
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4817690	4821476	4902569		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489278.1|4817690_4819682_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
WP_174144201.1|4819713_4820550_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4820807_4821476_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 355
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4825170	4826691	4902569		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|4825170_4826691_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 356
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4847023	4856467	4902569		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569369.1|4847023_4847950_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	7.4e-24
WP_000783109.1|4847954_4848686_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4848666_4848774_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|4848833_4849565_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|4849786_4851472_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4851468_4852188_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001525036.1|4852234_4852705_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001296231.1|4852745_4853207_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001292751.1|4855330_4856467_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.6e-161
>prophage 357
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4869981	4872015	4902569	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001296226.1|4869981_4872015_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 358
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4884224	4887781	4902569		Paenibacillus_phage(50.0%)	4	NA	NA
WP_021539978.1|4884224_4885043_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	5.5e-23
WP_000434047.1|4885094_4885841_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011976.1|4885814_4886780_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846228.1|4886776_4887781_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 359
NZ_CP054368	Escherichia coli strain SCU-115 chromosome, complete genome	4902569	4896923	4902308	4902569	integrase	Escherichia_phage(44.44%)	10	4889920:4889932	4901686:4901698
4889920:4889932	attL	TAACTCCGCCTTT	NA	NA	NA	NA
WP_000807360.1|4896923_4897823_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001441996.1|4898238_4898556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|4898990_4900004_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|4900119_4900419_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|4900540_4900816_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|4900826_4900997_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217677.1|4900993_4901494_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_032302045.1|4901557_4901782_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
4901686:4901698	attR	AAAGGCGGAGTTA	NA	NA	NA	NA
WP_001754915.1|4901781_4902084_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_001113263.1|4902083_4902308_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
>prophage 1
NZ_CP054369	Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence	148443	1262	72608	148443	integrase,lysis,protease	Bacillus_phage(18.18%)	47	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001523382.1|3231_3510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001523383.1|3564_4092_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001523384.1|4172_4757_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024193368.1|4903_7414_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_174144231.1|7482_8214_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001523388.1|8250_8838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024188653.1|8864_9401_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001523392.1|9420_9942_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001523393.1|9964_10525_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001523394.1|10614_11595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153782243.1|12683_12896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001523396.1|13415_17324_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	31.6	1.7e-157
WP_001523397.1|17491_18001_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_001523398.1|17987_20588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001523399.1|20647_22759_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.8	3.0e-52
WP_001523401.1|22772_24185_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001523402.1|25111_25651_+	chorismate mutase	NA	NA	NA	NA	NA
WP_024193369.1|26333_27236_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_174144232.1|27325_28435_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001523409.1|28974_29925_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001523410.1|30036_31224_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
WP_001523412.1|31220_33161_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	38.6	2.6e-34
WP_032144220.1|33164_34535_+	TolC family protein	NA	NA	NA	NA	NA
WP_000450492.1|38116_39310_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000738422.1|41069_41363_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_077543370.1|41420_41675_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	71.2	7.0e-17
WP_001318220.1|44508_45624_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001523422.1|45763_49423_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
WP_001523423.1|49526_50756_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271274.1|50840_51797_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001523424.1|51841_54019_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	32.5	5.6e-06
WP_000076221.1|54322_54583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001579359.1|56043_57528_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001579360.1|57712_58663_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001523433.1|60915_61563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523434.1|61632_61983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523436.1|62823_63414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174144233.1|63796_64972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021516775.1|65019_65535_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001523439.1|65601_66288_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001523440.1|66278_68786_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001523441.1|68814_69147_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_021516773.1|69232_69937_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001523443.1|70012_70591_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001523444.1|71074_71638_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.4	1.9e-54
WP_001523445.1|71861_72608_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	49.2	8.0e-45
