The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	0	54478	5200581	tail,terminase,transposase,head,protease,capsid	Stx2-converting_phage(30.0%)	44	NA	NA
WP_042106365.1|0_1662_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_042106366.1|1725_3663_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.6	0.0e+00
WP_016238136.1|3707_3929_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	1.7e-35
WP_000125988.1|6617_6944_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|6953_7304_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_089611539.1|7300_7747_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_042103714.1|7743_8088_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	1.2e-56
WP_042103716.1|8153_8870_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	98.3	2.0e-125
WP_042103718.1|8884_9259_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	95.2	3.6e-62
WP_159032355.1|9354_9564_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	7.4e-33
WP_174144320.1|9611_12878_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	77.0	0.0e+00
WP_000343412.1|12870_13212_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_042104956.1|13411_14575_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	67.2	1.1e-141
WP_174144321.1|14784_15483_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.1	7.1e-128
WP_174144322.1|15493_16237_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	5.4e-150
WP_148935101.1|16182_16815_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	6.7e-101
WP_174144323.1|17535_21009_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	91.5	0.0e+00
WP_000078852.1|21207_21348_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_174144325.1|21490_23200_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	91.7	4.8e-202
WP_174144326.1|23242_23911_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	92.2	2.3e-112
WP_001016257.1|24091_24838_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|24852_26394_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_174144327.1|26976_28212_+	YadA-like family protein	NA	Q9LA60	Enterobacterial_phage	55.4	1.5e-80
WP_174144329.1|28298_28772_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	8.3e-88
WP_174144330.1|29143_33136_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	94.2	0.0e+00
WP_001079498.1|34049_34556_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_042103537.1|34601_35102_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_042103539.1|35187_35367_-	general stress protein	NA	NA	NA	NA	NA
WP_001563169.1|35747_36554_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|36553_37747_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_072130397.1|37758_39120_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_096840728.1|39120_40716_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	2.2e-52
WP_001194623.1|40715_42278_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|42369_42414_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285692.1|42551_43433_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|43429_44050_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291206.1|46182_47058_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001563175.1|47227_48229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001563176.1|48239_48548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174144332.1|48599_49190_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|49186_49945_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422061.1|50164_51214_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
WP_001031530.1|51249_51501_-	YciN family protein	NA	NA	NA	NA	NA
WP_001309471.1|51880_54478_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	9.2e-88
>prophage 2
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	59402	59993	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|59402_59993_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	67807	69742	5200581		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484973.1|67807_69742_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.0	1.5e-31
>prophage 4
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	78675	80693	5200581		Salmonella_phage(50.0%)	2	NA	NA
WP_000135015.1|78675_79839_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	9.6e-29
WP_000573407.1|79886_80693_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 5
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	93483	94749	5200581		Klosneuvirus(100.0%)	1	NA	NA
WP_042107110.1|93483_94749_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.4e-25
>prophage 6
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	108755	109838	5200581		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068008.1|108755_109838_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	9.6e-23
>prophage 7
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	127061	127577	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945000.1|127061_127577_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.4e-24
>prophage 8
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	132350	139620	5200581	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001306539.1|132350_133583_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|133837_134821_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001272254.1|135298_136672_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	5.1e-53
WP_000081418.1|136800_137736_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001295593.1|137911_138346_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|138486_139620_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 9
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	144579	145569	5200581		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|144579_145569_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 10
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	158128	162031	5200581		Klosneuvirus(100.0%)	1	NA	NA
WP_001563326.1|158128_162031_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 11
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	165969	166918	5200581		Escherichia_phage(50.0%)	2	NA	NA
WP_001317803.1|165969_166500_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
WP_000731852.1|166744_166918_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	2.6e-07
>prophage 12
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	180137	187185	5200581		Phage_TP(25.0%)	7	NA	NA
WP_001317809.1|180137_182099_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.6e-23
WP_000494243.1|182190_182421_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813796.1|182642_182819_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-12
WP_076838470.1|182862_183279_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.0	6.3e-31
WP_000760605.1|183357_184764_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047448.1|185008_186154_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220433.1|186171_187185_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.9	1.7e-26
>prophage 13
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	194317	196420	5200581		Salmonella_phage(100.0%)	1	NA	NA
WP_000689295.1|194317_196420_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	1.9e-136
>prophage 14
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	210096	213217	5200581		Bacillus_phage(50.0%)	2	NA	NA
WP_000236739.1|210096_211146_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.1	2.4e-18
WP_001176572.1|211240_213217_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.0e-160
>prophage 15
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	217783	219328	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|217783_219328_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 16
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	230574	232015	5200581		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|230574_230859_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|231004_232015_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 17
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	235422	239229	5200581		Klosneuvirus(50.0%)	2	NA	NA
WP_001695733.1|235422_237822_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
WP_000426268.1|237846_239229_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 18
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	244507	251443	5200581		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_032284788.1|244507_247291_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832481.1|247347_249720_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628553.1|249757_251443_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 19
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	272950	274486	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194895.1|272950_274486_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	6.8e-22
>prophage 20
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	282358	283777	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_000558450.1|282358_283777_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 21
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	290520	290904	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|290520_290904_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 22
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	293906	294797	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_000592798.1|293906_294797_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	36.4	4.0e-19
>prophage 23
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	299688	374033	5200581	integrase,tail,terminase,holin,portal,protease	Escherichia_phage(46.43%)	77	333790:333805	356114:356129
WP_000214712.1|299688_299892_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527790.1|299927_301388_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_174144338.1|303060_303732_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	94.6	2.3e-120
WP_174144339.1|303773_305498_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	91.5	8.0e-205
WP_000078852.1|305640_305781_-	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_174144340.1|305979_309453_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	92.1	0.0e+00
WP_148935101.1|309877_310510_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	6.7e-101
WP_174144322.1|310455_311199_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	5.4e-150
WP_042107075.1|311209_311908_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.1e-128
WP_032211147.1|311907_312237_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	5.2e-57
WP_174144341.1|312233_314882_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.4	0.0e+00
WP_174144342.1|314933_315230_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.7	2.3e-43
WP_174144343.1|315256_315679_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	90.0	1.1e-62
WP_073568571.1|315694_316444_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	96.0	1.0e-132
WP_042102290.1|316451_316850_-|tail	tail protein	tail	S5MW30	Escherichia_phage	98.5	3.8e-70
WP_073568572.1|316859_317486_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	86.5	1.4e-87
WP_042105614.1|317488_317770_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	91.4	2.2e-43
WP_042105617.1|317762_318089_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	95.4	2.6e-48
WP_174144345.1|318177_320202_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.6	0.0e+00
WP_042105441.1|320146_321649_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	95.8	5.0e-280
WP_122990836.1|321648_321861_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	92.9	4.7e-27
WP_174144346.1|323870_325757_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.1	6.9e-178
WP_042105662.1|325753_325948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144348.1|326409_326682_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_174144350.1|331976_332204_-	hypothetical protein	NA	NA	NA	NA	NA
333790:333805	attL	AACAGCGCAGCAGGTT	NA	NA	NA	NA
WP_052431183.1|333887_334466_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.1	5.6e-54
WP_001095275.1|334525_334729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042102722.1|334741_335980_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.7	6.6e-60
WP_042102729.1|336141_337149_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.8	4.5e-200
WP_042102724.1|337145_337622_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.2	9.2e-79
WP_174144315.1|338893_339088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144352.1|339247_339781_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	9.6e-101
WP_174144354.1|339823_340810_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	55.2	7.0e-81
WP_000284506.1|340814_341030_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_174144316.1|341108_341381_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	73.3	5.7e-09
WP_174144356.1|341406_341601_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	83.1	1.1e-17
WP_174144358.1|341752_343735_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	71.4	4.2e-274
WP_042105379.1|344513_345572_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.9	4.9e-189
WP_000917768.1|345722_345920_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_042102145.1|346137_346821_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.9e-58
WP_174144364.1|346817_347183_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	9.3e-39
WP_174144366.1|347183_348242_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	6.2e-91
WP_042105094.1|348243_348516_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	51.6	6.5e-13
WP_042105097.1|348638_348983_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	96.5	2.5e-54
WP_024025772.1|349104_349317_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	98.6	2.3e-29
WP_148935074.1|349361_349469_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	82.8	8.8e-06
WP_174144368.1|349496_350162_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_174144370.1|350427_350772_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_077886833.1|350758_351064_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	79.0	7.8e-39
WP_077886881.1|351060_351336_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.9e-28
WP_174144372.1|351368_352085_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.9	1.9e-67
WP_174144373.1|352113_352854_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	87.6	9.8e-120
WP_042105942.1|353782_354208_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_042105941.1|354204_354492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148935084.1|354594_354966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042105939.1|354996_355392_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	57.1	4.0e-11
WP_042105938.1|355427_355619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042105936.1|355619_355907_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_174144317.1|356170_356428_+	hypothetical protein	NA	NA	NA	NA	NA
356114:356129	attR	AACAGCGCAGCAGGTT	NA	NA	NA	NA
WP_042105945.1|356381_356639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144375.1|357138_357327_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_174144377.1|357491_359984_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	3.1e-56
WP_000005551.1|360054_360306_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_042103212.1|360340_361615_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.0	4.7e-154
WP_077775823.1|361640_361751_-	transporter	NA	NA	NA	NA	NA
WP_000836040.1|361808_362828_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
WP_001295394.1|362839_364054_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|364259_364586_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_042102259.1|364720_365062_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|365096_365657_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|365659_366370_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001317855.1|366477_366783_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041658.1|366981_369408_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001695753.1|369468_371892_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000213028.1|371902_372520_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526519.1|372521_373376_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148698.1|373418_374033_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
>prophage 24
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	391793	393095	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_000732513.1|391793_393095_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	5.5e-17
>prophage 25
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	402990	404802	5200581		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945910.1|402990_404802_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 26
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	424780	426055	5200581	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|424780_426055_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 27
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	432966	434465	5200581		Salmonella_phage(50.0%)	2	NA	NA
WP_001298528.1|432966_433488_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250656.1|433568_434465_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 28
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	444699	453503	5200581		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101182.1|444699_445527_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|445654_446236_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701039.1|446381_447551_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|447716_447806_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|448104_449130_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|449126_450059_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|450171_451383_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|451673_452822_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493956.1|452861_453503_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.8	7.4e-23
>prophage 29
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	459008	461275	5200581		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587571.1|459008_459821_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
WP_001069962.1|459824_460610_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001317862.1|460606_461275_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 30
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	469564	474648	5200581		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|469564_470785_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907963.1|470781_472053_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948882.1|472027_472774_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	9.9e-11
WP_001304330.1|472783_474271_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|474279_474648_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 31
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	493294	512836	5200581	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001317865.1|493294_494941_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	1.1e-30
WP_038994876.1|494997_497376_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	7.9e-171
WP_000368046.1|497708_498542_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|498698_499745_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|499876_500068_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175715.1|500071_501508_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001317866.1|501570_502284_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|502530_502995_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|503072_503822_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|503821_504373_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|504435_505416_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|505516_505816_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672341.1|505820_508208_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|508222_509206_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|509489_509534_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|509656_510013_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|510066_510264_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|510361_510904_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144205.1|510907_512836_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	7.2e-130
>prophage 32
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	522212	524474	5200581		Tupanvirus(100.0%)	1	NA	NA
WP_000077869.1|522212_524474_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.2	8.7e-143
>prophage 33
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	530811	531639	5200581		Bacillus_virus(100.0%)	1	NA	NA
WP_000175017.1|530811_531639_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 34
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	539115	540336	5200581		Klosneuvirus(100.0%)	1	NA	NA
WP_174144379.1|539115_540336_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	1.4e-25
>prophage 35
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	547099	547753	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_001317871.1|547099_547753_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 36
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	552143	554099	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_001520656.1|552143_554099_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 37
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	559023	559665	5200581		Tupanvirus(100.0%)	1	NA	NA
WP_042104331.1|559023_559665_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	5.0e-19
>prophage 38
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	562908	563763	5200581		Indivirus(100.0%)	1	NA	NA
WP_001317875.1|562908_563763_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.9e-10
>prophage 39
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	567081	571658	5200581		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|567081_568365_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621387.1|568511_569987_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|570167_571658_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 40
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	586405	594511	5200581	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|586405_588091_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|588295_588877_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220956.1|588915_589611_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_001357789.1|589668_591579_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	3.5e-92
WP_000158029.1|591711_592056_+	RidA family protein	NA	NA	NA	NA	NA
WP_001695821.1|592417_592777_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457331.1|592896_593076_-	YoaH family protein	NA	NA	NA	NA	NA
WP_042102661.1|593149_594511_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 41
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	598373	599930	5200581		Moraxella_phage(100.0%)	1	NA	NA
WP_000394990.1|598373_599930_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 42
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	605570	605780	5200581		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|605570_605780_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 43
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	611113	613162	5200581		Moraxella_phage(100.0%)	1	NA	NA
WP_001055809.1|611113_613162_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 44
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	620658	625127	5200581		Escherichia_phage(33.33%)	7	NA	NA
WP_000812744.1|620658_621315_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	6.8e-56
WP_000976472.1|621709_622051_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879316.1|622063_622936_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|622939_623314_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916759.1|623452_623683_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011673.1|623784_624441_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|624464_625127_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 45
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	633183	634659	5200581		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|633183_634659_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 46
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	638657	645719	5200581		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|638657_639980_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_024186182.1|639995_640928_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|641006_641762_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571474.1|641758_642544_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|642688_643699_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|643707_644319_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|644457_644523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024940.1|644593_645196_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|645197_645719_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 47
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	649737	651788	5200581		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639254.1|649737_650556_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|650608_651004_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|651044_651788_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 48
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	658404	660138	5200581	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|658404_660138_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 49
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	664658	670302	5200581		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|664658_665048_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|665062_666112_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204341.1|666114_666975_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001551268.1|666993_668595_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	1.2e-13
WP_001551269.1|668640_670302_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 50
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	680389	681904	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|680389_681904_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 51
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	693895	694648	5200581		Bacillus_virus(100.0%)	1	NA	NA
WP_001273009.1|693895_694648_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 52
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	706463	708383	5200581	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334568.1|706463_707135_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.6e-81
WP_174144385.1|707174_708383_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	8.3e-209
>prophage 53
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	725650	738034	5200581		Bacillus_phage(28.57%)	12	NA	NA
WP_077817110.1|725650_727345_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.0e-18
WP_000009307.1|727515_727698_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|727776_728694_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|728867_729788_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|729776_730247_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|730227_731646_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365545.1|731712_732408_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_001313057.1|732447_732813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824362.1|733380_734454_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_042105294.1|735045_735897_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826746.1|736004_737363_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|737362_738034_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 54
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	741578	742109	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|741578_742109_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 55
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	773461	778600	5200581	transposase	Shigella_phage(25.0%)	7	NA	NA
WP_085947772.1|773461_774674_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000581504.1|775577_776033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|776111_776345_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234629.1|776444_777263_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.6e-44
WP_000860076.1|777344_777824_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|777839_778316_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|778378_778600_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 56
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	782942	784109	5200581		Stx2-converting_phage(100.0%)	1	NA	NA
WP_042105928.1|782942_784109_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	3.8e-227
>prophage 57
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	791753	792653	5200581		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|791753_792653_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 58
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	800010	806216	5200581		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000704893.1|800010_801177_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	1.9e-109
WP_000043505.1|801424_802831_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
WP_157904593.1|802936_804010_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016242238.1|804057_804855_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016242239.1|804889_805357_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_021562653.1|805346_806216_-	SDR family oxidoreductase	NA	A0A167RG57	Powai_lake_megavirus	31.4	7.7e-31
>prophage 59
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	814776	817239	5200581		Bacillus_phage(50.0%)	2	NA	NA
WP_000183060.1|814776_815670_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_042104483.1|815844_817239_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.3	8.3e-19
>prophage 60
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	823239	830209	5200581		Bacillus_phage(25.0%)	6	NA	NA
WP_001410433.1|823239_824610_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	3.8e-32
WP_024243380.1|824978_826415_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	2.8e-46
WP_001718496.1|826417_827641_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024243381.1|827637_828117_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043623.1|828119_829085_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000048190.1|829087_830209_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 61
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	834453	845401	5200581		uncultured_marine_virus(16.67%)	11	NA	NA
WP_000654503.1|834453_835293_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_128997350.1|835470_837633_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|837635_838079_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|838084_839224_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_174144389.1|839532_839682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000454700.1|839882_841466_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001563602.1|841540_841879_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687872.1|841868_842159_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001252358.1|842211_844065_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|844086_844668_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|844759_845401_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 62
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	850127	851480	5200581		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469732.1|850127_851480_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 63
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	865250	871378	5200581	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_001563612.1|865250_866654_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_042106704.1|866650_867373_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	4.9e-31
WP_000929408.1|867563_867896_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476037.1|868043_869405_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	3.2e-217
WP_001350699.1|869746_870064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042102817.1|870478_871378_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	4.4e-13
>prophage 64
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	880517	884074	5200581		Serratia_phage(50.0%)	4	NA	NA
WP_052912792.1|880517_881522_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
WP_000011945.1|881518_882484_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|882457_883204_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|883255_884074_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 65
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	894723	896757	5200581	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001563647.1|894723_896757_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	3.6e-55
>prophage 66
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	909262	918708	5200581		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001563693.1|909262_910399_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	9.0e-165
WP_001563695.1|910395_912399_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	97.3	0.0e+00
WP_001296231.1|912523_912985_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_052920575.1|913026_913497_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_000598641.1|913543_914263_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|914259_915945_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240405.1|916166_916898_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|916957_917065_+	protein YohO	NA	NA	NA	NA	NA
WP_000783127.1|917045_917777_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_021539241.1|917781_918708_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 67
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	945174	946695	5200581		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|945174_946695_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 68
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	950389	954163	5200581		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|950389_951058_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425460.1|951315_952152_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_174144393.1|952183_954163_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 69
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	958232	959090	5200581		Catovirus(100.0%)	1	NA	NA
WP_001561664.1|958232_959090_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 70
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	973573	977873	5200581		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_042106624.1|973573_975040_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198811.1|975157_976144_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001317950.1|976182_976896_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|977306_977873_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 71
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	983627	996093	5200581	integrase	Vibrio_phage(50.0%)	13	987277:987289	995221:995233
WP_000194916.1|983627_985217_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|985220_985565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|985898_987089_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234854.1|987116_987812_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
987277:987289	attL	CTGATGGTCAAAC	NA	NA	NA	NA
WP_000578065.1|987961_989722_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	3.8e-101
WP_000494186.1|989846_990131_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|990269_991277_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|991458_991686_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256203.1|991705_993466_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_042106635.1|993835_995077_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.3	4.7e-98
WP_042106634.1|995175_995406_+	hypothetical protein	NA	NA	NA	NA	NA
995221:995233	attR	CTGATGGTCAAAC	NA	NA	NA	NA
WP_028131524.1|995573_995780_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_174144401.1|995916_996093_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	46.6	3.2e-05
>prophage 72
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1001540	1003727	5200581	terminase,head,capsid	Enterobacteria_phage(50.0%)	3	NA	NA
WP_096849059.1|1001540_1002596_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.9	6.0e-70
WP_174144412.1|1002607_1002943_+|head	head decoration protein	head	NA	NA	NA	NA
WP_174144414.1|1003166_1003727_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	45.7	2.1e-34
>prophage 73
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1012608	1013226	5200581		Bacillus_virus(100.0%)	1	NA	NA
WP_001305183.1|1012608_1013226_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 74
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1021994	1027796	5200581		Bacillus_phage(25.0%)	5	NA	NA
WP_000422234.1|1021994_1023638_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.4	3.3e-14
WP_000884929.1|1023713_1024364_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	8.3e-06
WP_000786347.1|1024363_1025428_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000406059.1|1025501_1026557_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865545.1|1026668_1027796_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.9	4.5e-116
>prophage 75
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1032074	1036917	5200581		Hokovirus(50.0%)	2	NA	NA
WP_042107340.1|1032074_1034924_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001317952.1|1035090_1036917_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	7.5e-20
>prophage 76
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1051840	1065730	5200581		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281251.1|1051840_1054468_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990764.1|1054614_1055337_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_106889491.1|1055477_1059236_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.6	7.9e-24
WP_001075170.1|1059931_1062217_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|1062362_1063493_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135039.1|1063492_1063747_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
WP_000301031.1|1063800_1064451_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779080.1|1064653_1065730_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 77
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1071623	1072583	5200581	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140533.1|1071623_1072583_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.2e-69
>prophage 78
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1078046	1083050	5200581		Tupanvirus(50.0%)	4	NA	NA
WP_001317957.1|1078046_1078649_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	4.4e-09
WP_001695997.1|1078956_1080096_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_000461633.1|1080099_1081068_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_052920610.1|1081067_1083050_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
>prophage 79
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1116434	1119662	5200581		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|1116434_1117034_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|1117092_1118925_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_042103457.1|1119011_1119662_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 80
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1130222	1132095	5200581		Sodalis_phage(50.0%)	2	NA	NA
WP_000156126.1|1130222_1131125_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	1.8e-67
WP_001293612.1|1131321_1132095_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 81
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1136306	1137824	5200581		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1136306_1137824_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 82
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1144288	1145425	5200581		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699117.1|1144288_1145425_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	8.5e-22
>prophage 83
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1153960	1155046	5200581		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|1153960_1155046_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 84
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1171352	1172285	5200581		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1171352_1172285_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 85
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1175324	1176758	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_000194528.1|1175324_1176758_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
>prophage 86
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1183411	1190988	5200581		Bacillus_phage(50.0%)	4	NA	NA
WP_001317965.1|1183411_1187005_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001317966.1|1187060_1188206_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1188279_1189224_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283467.1|1189293_1190988_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 87
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1194679	1195600	5200581		Morganella_phage(100.0%)	1	NA	NA
WP_000484405.1|1194679_1195600_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 88
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1199418	1200153	5200581		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1199418_1200153_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 89
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1225846	1241228	5200581		Streptococcus_phage(33.33%)	15	NA	NA
WP_052920466.1|1225846_1227862_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	5.0e-150
WP_001299866.1|1227932_1228931_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1229160_1229922_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1230106_1231078_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1231461_1231719_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1231763_1233491_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1233531_1234041_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|1234082_1234934_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719960.1|1235038_1235407_+	YfeK family protein	NA	NA	NA	NA	NA
WP_042104155.1|1235409_1236321_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.7e-57
WP_000021036.1|1236454_1237552_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1237541_1238417_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|1238416_1239250_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|1239249_1240266_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1240436_1241228_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 90
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1244714	1249649	5200581		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001317977.1|1244714_1246016_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	25.6	2.1e-08
WP_000084590.1|1246073_1246973_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|1247068_1247644_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1247704_1248154_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1248140_1248566_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|1248779_1249649_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 91
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1268391	1269342	5200581		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1268391_1269342_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 92
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1287343	1288057	5200581		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1287343_1288057_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 93
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1295504	1299506	5200581		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1295504_1296794_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1296879_1297506_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1297830_1298868_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_042106558.1|1298867_1299506_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	5.3e-29
>prophage 94
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1305752	1312241	5200581		Escherichia_phage(66.67%)	7	NA	NA
WP_000017555.1|1305752_1305905_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	7.1e-17
WP_000076001.1|1305922_1306114_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|1306424_1306943_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1306958_1307498_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|1307590_1309168_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1309236_1310703_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937871.1|1310864_1312241_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.9e-42
>prophage 95
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1332721	1333153	5200581		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1332721_1333153_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 96
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1343341	1349679	5200581		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133604.1|1343341_1344625_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523616.1|1344683_1344884_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1344895_1345231_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196594.1|1345232_1347083_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.2	1.2e-102
WP_000384413.1|1347099_1347615_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1347710_1348034_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1348050_1348437_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1348464_1349679_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 97
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1364815	1366327	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493464.1|1364815_1366327_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 98
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1372084	1383373	5200581		Bacillus_phage(50.0%)	7	NA	NA
WP_000919149.1|1372084_1373338_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
WP_042105881.1|1373665_1374856_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1374900_1375239_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1375299_1376634_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_042105880.1|1376623_1377337_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001317988.1|1377501_1378929_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_000970172.1|1379485_1383373_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	2.9e-130
>prophage 99
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1387492	1387753	5200581		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|1387492_1387753_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 100
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1391213	1394955	5200581		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1391213_1391894_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1392165_1393140_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1393155_1394955_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 101
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1400726	1406808	5200581	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1400726_1402061_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001296304.1|1402093_1402975_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189225.1|1403077_1403665_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1403719_1404103_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262718.1|1404407_1405097_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	7.1e-56
WP_000997418.1|1405144_1406182_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1406388_1406808_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 102
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1412099	1413398	5200581		Burkholderia_virus(100.0%)	1	NA	NA
WP_174144424.1|1412099_1413398_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.8e-45
>prophage 103
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1419169	1421743	5200581		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001317994.1|1419169_1421743_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	1.5e-127
>prophage 104
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1429090	1430161	5200581		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|1429090_1430161_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 105
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1443907	1444390	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|1443907_1444390_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 106
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1449399	1453451	5200581		Klosneuvirus(50.0%)	4	NA	NA
WP_032284950.1|1449399_1450680_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001298180.1|1450917_1452318_+	GABA permease	NA	NA	NA	NA	NA
WP_042105537.1|1452338_1453001_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_023282039.1|1453001_1453451_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 107
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1457386	1462808	5200581		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1457386_1457632_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001561907.1|1457628_1458039_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	45.2	2.7e-18
WP_042105530.1|1458011_1460156_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.4e-195
WP_000777934.1|1460165_1461125_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_000985490.1|1461605_1462808_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 108
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1477684	1483070	5200581	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1477684_1477870_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_042104200.1|1478104_1480735_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	1.2e-79
WP_042104202.1|1480862_1481363_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1481431_1482493_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_042104206.1|1482572_1483070_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	5.7e-31
>prophage 109
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1488537	1489503	5200581		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|1488537_1489503_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 110
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1497074	1498088	5200581		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001317999.1|1497074_1498088_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	2.7e-27
>prophage 111
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1516377	1523516	5200581		Escherichia_phage(80.0%)	5	NA	NA
WP_001272914.1|1516377_1518939_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
WP_001318002.1|1519750_1520518_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	7.4e-70
WP_000848000.1|1520713_1521622_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590398.1|1521618_1522881_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278992.1|1522877_1523516_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
>prophage 112
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1528729	1532445	5200581		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1528729_1529722_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1529784_1530924_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|1531063_1531690_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1531683_1532445_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 113
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1535557	1537590	5200581		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|1535557_1536163_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090371.1|1536162_1537590_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 114
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1562601	1563387	5200581		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021322.1|1562601_1563387_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 115
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1567919	1572841	5200581		Vibrio_phage(33.33%)	3	NA	NA
WP_001199973.1|1567919_1568591_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_000036723.1|1569818_1571117_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1571203_1572841_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 116
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1576237	1580352	5200581		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046790.1|1576237_1577539_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|1577595_1580352_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 117
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1587885	1588734	5200581		Vibrio_phage(100.0%)	1	NA	NA
WP_174144428.1|1587885_1588734_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 118
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1593590	1594346	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_001318010.1|1593590_1594346_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	8.5e-10
>prophage 119
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1605872	1608378	5200581	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001318012.1|1605872_1607078_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_000184260.1|1607077_1607521_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117724.1|1607571_1608378_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
>prophage 120
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1617450	1622471	5200581		Cronobacter_phage(50.0%)	2	NA	NA
WP_052920090.1|1617450_1620087_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	3.4e-98
WP_174144430.1|1620098_1622471_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.4	5.0e-16
>prophage 121
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1626481	1628968	5200581		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_174144432.1|1626481_1628968_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	38.8	3.4e-07
>prophage 122
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1643886	1660675	5200581		Acanthocystis_turfacea_Chlorella_virus(14.29%)	10	NA	NA
WP_001318019.1|1643886_1644834_-	phosphoglycerate dehydrogenase	NA	M1I1Q8	Acanthocystis_turfacea_Chlorella_virus	27.3	1.4e-14
WP_001089172.1|1644904_1645501_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	2.4e-23
WP_000382402.1|1645503_1646679_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810569.1|1646678_1648259_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_001318021.1|1648290_1649115_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|1649371_1650625_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1650856_1652188_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_022646057.1|1652425_1654252_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.4	2.3e-24
WP_001561995.1|1654251_1657794_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	8.9e-09
WP_001138159.1|1657786_1660675_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 123
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1666152	1672925	5200581		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1666152_1666947_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1666953_1667829_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|1667979_1670226_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1670238_1670769_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082192.1|1671453_1672143_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1672211_1672925_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 124
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1682556	1685051	5200581		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1682556_1683975_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1684289_1685051_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 125
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1691099	1691492	5200581		Stx2-converting_phage(100.0%)	1	NA	NA
WP_042106898.1|1691099_1691492_-	antitermination protein	NA	A0A0P0ZCW9	Stx2-converting_phage	86.5	5.5e-61
>prophage 126
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1695131	1708269	5200581	integrase	Streptococcus_phage(12.5%)	17	1687528:1687542	1710518:1710532
1687528:1687542	attL	ACCACTAACCCACCA	NA	NA	NA	NA
WP_042106888.1|1695131_1696322_+	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	65.1	1.4e-139
WP_032211279.1|1696728_1697022_-	PerC family transcriptional regulator	NA	S4TT84	Salmonella_phage	44.8	2.4e-05
WP_042106885.1|1696990_1697458_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	44.6	2.8e-11
WP_174144434.1|1697475_1697916_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_042106883.1|1697934_1698294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106880.1|1698717_1700856_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	42.8	1.2e-130
WP_042106877.1|1700852_1701152_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042106876.1|1701217_1701412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106875.1|1701415_1701601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144436.1|1701593_1702058_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_077775860.1|1702050_1702509_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_064753015.1|1702721_1702910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042104408.1|1703849_1704650_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	39.8	3.8e-24
WP_042104406.1|1704714_1704912_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.9	9.2e-09
WP_042104403.1|1705156_1705858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042104410.1|1705985_1707200_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.1	5.9e-138
WP_001562018.1|1707516_1708269_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
1710518:1710532	attR	ACCACTAACCCACCA	NA	NA	NA	NA
>prophage 127
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1732550	1736688	5200581		environmental_Halophage(50.0%)	3	NA	NA
WP_001280192.1|1732550_1733951_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|1733968_1735285_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1735320_1736688_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
>prophage 128
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1741854	1747941	5200581	tRNA	Catovirus(25.0%)	5	NA	NA
WP_000003071.1|1741854_1743372_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1743381_1744480_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813191.1|1744570_1746304_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715230.1|1746309_1747020_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1747044_1747941_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 129
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1751756	1756227	5200581		Pandoravirus(50.0%)	2	NA	NA
WP_001389468.1|1751756_1753190_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
WP_000195042.1|1753353_1756227_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 130
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1764363	1765596	5200581		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1764363_1765596_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 131
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1786680	1787589	5200581		Yersinia_phage(100.0%)	1	NA	NA
WP_000646928.1|1786680_1787589_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	1.5e-53
>prophage 132
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1795456	1862342	5200581	tRNA,protease,transposase,integrase	Stx2-converting_phage(25.0%)	61	1826121:1826137	1855444:1855460
WP_001062128.1|1795456_1796611_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001696135.1|1797047_1798442_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001696137.1|1798518_1799016_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286497.1|1799110_1799818_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_042104642.1|1799897_1800629_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_042104644.1|1800641_1801592_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001318029.1|1801700_1802264_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1802263_1802680_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001696140.1|1802853_1803834_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1803851_1804556_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1804573_1805140_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277194.1|1805136_1805427_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174747.1|1805434_1806028_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239950.1|1806020_1807157_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|1807472_1808459_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577036.1|1808503_1809007_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378929.1|1809006_1810308_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745229.1|1810363_1811371_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394103.1|1811487_1812534_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1812709_1813429_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107566.1|1813612_1813939_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1813938_1814658_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001318031.1|1814818_1815871_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1815898_1816174_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|1816238_1817318_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001298251.1|1817519_1818776_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001318032.1|1818821_1820957_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_174144438.1|1821348_1822056_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001178612.1|1822432_1823470_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_174144440.1|1823537_1825019_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_174144442.1|1825011_1826502_-	UvrD-helicase domain-containing protein	NA	A0A1Q1N957	Escherichia_phage	29.9	1.1e-45
1826121:1826137	attL	CCGGTACCGCATCAGCA	NA	NA	NA	NA
WP_174144444.1|1826872_1828411_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	1.2e-297
WP_000612591.1|1828460_1828808_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1828804_1829185_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_050437324.1|1831629_1831854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042104464.1|1832092_1833370_+	YadA-like family protein	NA	B0FIT1	Escherichia_phage	40.4	8.4e-10
WP_042104462.1|1833800_1834376_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_042104460.1|1834754_1834982_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_042104458.1|1835664_1836651_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	58.4	1.0e-108
WP_042104455.1|1836750_1837485_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_001562717.1|1837520_1838456_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042104453.1|1838505_1839615_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_021519846.1|1839627_1840338_-	N-acetylnuraminic acid outer membrane channel protein	NA	NA	NA	NA	NA
WP_042104451.1|1840383_1841214_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000376548.1|1841217_1842690_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_042104449.1|1842738_1843614_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_042104447.1|1843647_1844565_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_040078191.1|1845467_1846154_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.0	5.7e-29
WP_000005864.1|1846265_1847213_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000521993.1|1848397_1848781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042103650.1|1848896_1849526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032211072.1|1849607_1849985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555830.1|1850180_1850660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042104168.1|1850742_1851135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875212.1|1851763_1852783_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042105652.1|1853014_1853356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091033.1|1853388_1854291_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_001038412.1|1855390_1855690_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
1855444:1855460	attR	CCGGTACCGCATCAGCA	NA	NA	NA	NA
WP_089611701.1|1856497_1857653_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.1e-68
WP_042105655.1|1858908_1860957_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	8.5e-12
WP_085948812.1|1861135_1862342_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
>prophage 133
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1868320	1870909	5200581	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_032211182.1|1868320_1869892_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	2.7e-167
WP_000624622.1|1869911_1870259_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032211181.1|1870258_1870909_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.5	3.6e-17
>prophage 134
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1880658	1881378	5200581		Hirudovirus(100.0%)	1	NA	NA
WP_042106834.1|1880658_1881378_-	3-oxoacyl-ACP reductase FabG	NA	V5L4T3	Hirudovirus	35.6	4.9e-07
>prophage 135
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	1908836	2063013	5200581	protease,plate,transposase	Stx2-converting_phage(41.38%)	122	NA	NA
WP_042103366.1|1908836_1909757_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	39.1	5.6e-40
WP_032211181.1|1910323_1910974_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.5	3.6e-17
WP_000624622.1|1910973_1911321_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032211182.1|1911340_1912912_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	2.7e-167
WP_000021267.1|1913457_1914087_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_024165505.1|1914268_1916014_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001124814.1|1916242_1917463_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.6	1.6e-63
WP_174144444.1|1917973_1919512_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	1.2e-297
WP_000612591.1|1919561_1919909_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1919905_1920286_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001237806.1|1921030_1921219_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_033884677.1|1921293_1921809_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042104808.1|1921932_1922409_-	LuxR family transcriptional regulator	NA	Q9LA52	Enterobacteria_phage	45.8	4.3e-28
WP_032211017.1|1922413_1922650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042104811.1|1922777_1923980_-	YadA-like family protein	NA	Q9MCI8	Enterobacteria_phage	62.5	1.0e-41
WP_042104813.1|1924245_1926114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089611462.1|1926272_1927532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042104818.1|1933743_1934991_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174144451.1|1935050_1937198_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.1	8.5e-23
WP_042104820.1|1937202_1938471_-	TolC family protein	NA	NA	NA	NA	NA
WP_032211183.1|1939161_1939428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042104824.1|1939971_1941015_+	subtilase AB5 cytotoxin subunit A	NA	NA	NA	NA	NA
WP_024189712.1|1941031_1941454_+	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	44.3	3.6e-26
WP_159107720.1|1941702_1941906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106006.1|1942770_1946640_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.2	1.9e-198
WP_174144453.1|1947483_1947621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144444.1|1947916_1949455_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	1.2e-297
WP_000612591.1|1949504_1949852_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1949848_1950229_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_174144455.1|1960502_1962275_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	3.5e-22
WP_000833174.1|1962790_1963180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273203.1|1963244_1964303_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001442995.1|1964343_1965066_+	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_001499180.1|1965062_1965884_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001148680.1|1965858_1966116_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000132059.1|1966127_1966379_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_001442994.1|1966383_1966965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077064.1|1966961_1968320_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_001323876.1|1968306_1968660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000115632.1|1968650_1970327_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000930894.1|1970330_1970753_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000670566.1|1970749_1971355_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000180199.1|1971323_1973642_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_000597708.1|1973638_1974223_+	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_032210106.1|1974224_1975394_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_000020242.1|1975390_1975855_+	3-hydroxy-fatty acyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000091658.1|1975854_1976586_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_000198472.1|1976582_1977812_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000416157.1|1978651_1979683_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916811.1|1979953_1980397_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_085457331.1|1980412_1980700_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|1980712_1981969_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_077775336.1|1982320_1982470_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	57.1	1.5e-08
WP_077239192.1|1983004_1983226_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174144457.1|1983770_1986215_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000200205.1|1986851_1988249_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001068592.1|1988303_1988609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174144586.1|1988674_1990420_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042103884.1|1990654_1991857_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	65.0	2.1e-79
WP_000035090.1|1992053_1992272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001562492.1|1992702_1993707_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001137931.1|1993964_1994396_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000974466.1|1994398_1994935_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032156124.1|1994915_1996016_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001562489.1|1995970_1997734_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000146517.1|1997867_1999466_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_042103730.1|1999465_2002855_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_033802303.1|2002847_2003987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033802316.1|2003989_2004256_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045148881.1|2004620_2005445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045148883.1|2005437_2007459_-	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	33.3	3.0e-09
WP_001054501.1|2007461_2009993_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_042102312.1|2010515_2011082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042102313.1|2011078_2013736_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	3.0e-94
WP_033802299.1|2013904_2014396_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_089611028.1|2014401_2016132_-	OmpA family protein	NA	NA	NA	NA	NA
WP_042103412.1|2016134_2016788_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000708639.1|2016784_2018122_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000930196.1|2018137_2019682_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000098938.1|2019702_2020200_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032211181.1|2020739_2021390_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.5	3.6e-17
WP_000624622.1|2021389_2021737_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032211182.1|2021756_2023328_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	2.7e-167
WP_033805368.1|2023410_2023620_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042106151.1|2023639_2023873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106154.1|2023961_2024585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106155.1|2024705_2024888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013312.1|2024893_2025307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271024.1|2025303_2025687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221479.1|2025947_2026517_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001164058.1|2027244_2027469_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_077759065.1|2028271_2028532_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001562314.1|2028617_2029190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106915.1|2032142_2033015_+	GTPase family protein	NA	NA	NA	NA	NA
WP_042106914.1|2033344_2036467_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_174144459.1|2036587_2039104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581504.1|2039179_2039635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|2039713_2039947_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|2040046_2040865_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_174144461.1|2040919_2041405_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	5.8e-12
WP_001186726.1|2041420_2041897_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|2041956_2042178_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001280952.1|2042340_2042715_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854904.1|2042761_2043139_+	toxin	NA	NA	NA	NA	NA
WP_000779175.1|2043135_2043624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839249.1|2043635_2043833_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000875212.1|2044046_2045066_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001280528.1|2045349_2046192_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000942807.1|2046534_2047071_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000097200.1|2047072_2048251_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000633196.1|2048247_2049225_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_001318033.1|2049221_2049827_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820091.1|2049823_2050195_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115149.1|2050191_2050755_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087296.1|2050758_2051214_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173415.1|2051230_2052454_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000249319.1|2052453_2053947_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001318034.1|2053946_2056007_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_001696202.1|2056036_2056996_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001298257.1|2057013_2057424_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001318036.1|2057489_2058299_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_052920111.1|2058462_2063013_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
>prophage 136
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2077372	2078545	5200581		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524954.1|2077372_2078545_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.4	1.0e-38
>prophage 137
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2100757	2101642	5200581		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_174144466.1|2100757_2101642_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	3.1e-64
>prophage 138
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2107485	2119616	5200581		Staphylococcus_phage(25.0%)	10	NA	NA
WP_000013152.1|2107485_2108313_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691608.1|2108512_2109439_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848523.1|2109489_2109747_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095186.1|2109788_2112008_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2112118_2113531_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|2113605_2114343_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281871.1|2114576_2116835_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.3	4.0e-79
WP_000288665.1|2116972_2118580_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|2118688_2119171_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712658.1|2119223_2119616_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 139
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2125741	2127531	5200581		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_042103701.1|2125741_2126725_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.3	3.8e-10
WP_000940874.1|2126721_2127531_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
>prophage 140
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2138440	2146518	5200581		Bacillus_virus(25.0%)	8	NA	NA
WP_000195296.1|2138440_2140333_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_042103696.1|2140361_2140943_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2140942_2141770_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2141794_2142217_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2142217_2142847_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2143051_2144533_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2144680_2145352_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2145357_2146518_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 141
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2152410	2153064	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076997.1|2152410_2153064_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 142
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2156977	2158411	5200581		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2156977_2158411_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 143
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2163548	2164787	5200581	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708508.1|2163548_2164787_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 144
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2171196	2187342	5200581	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|2171196_2172210_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|2172447_2172663_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918822.1|2172773_2174519_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	8.4e-77
WP_000437371.1|2174713_2176555_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2176632_2177139_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|2177392_2178157_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|2178445_2179069_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094688.1|2179172_2180693_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_032140334.1|2181110_2182490_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.0e-32
WP_000450588.1|2182531_2182864_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212433.1|2183082_2184066_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082840.1|2184249_2187342_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	5.9e-158
>prophage 145
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2199664	2200630	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2199664_2200630_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 146
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2221425	2223720	5200581		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861710.1|2221425_2223720_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 147
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2229874	2231020	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_001318056.1|2229874_2231020_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	5.7e-50
>prophage 148
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2250072	2257869	5200581		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2250072_2250936_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249129.1|2251001_2253038_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246864.1|2252995_2253391_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2253410_2254001_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_042105915.1|2254010_2254586_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147602.1|2254698_2255739_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2255811_2256447_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001346703.1|2256574_2257093_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449457.1|2257072_2257516_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189301.1|2257566_2257869_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	5.0e-14
>prophage 149
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2263571	2265461	5200581		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|2263571_2265461_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 150
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2270937	2277576	5200581		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2270937_2273610_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2273634_2275122_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2275149_2275602_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2276232_2277576_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 151
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2281656	2284529	5200581	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2281656_2282505_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2282594_2284529_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 152
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2291158	2292636	5200581		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2291158_2292130_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|2292357_2292636_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 153
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2296704	2311498	5200581		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438239.1|2296704_2297514_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	3.7e-19
WP_000922872.1|2297723_2298701_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001318060.1|2298714_2299701_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	5.6e-38
WP_000030016.1|2299721_2300288_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2300284_2300860_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2300828_2301386_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2301392_2302118_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2302165_2303599_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2303621_2303909_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2304026_2304518_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2304563_2305418_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2305414_2305687_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2305899_2306532_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047075.1|2306528_2307257_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2307253_2307907_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2308136_2310473_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001306030.1|2310568_2311498_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 154
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2318247	2322995	5200581		Salmonella_phage(50.0%)	5	NA	NA
WP_000445162.1|2318247_2319375_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000605257.1|2319434_2319899_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000208991.1|2319895_2320771_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2320767_2321457_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108472.1|2321504_2322995_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 155
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2326701	2327199	5200581	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|2326701_2327199_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 156
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2331165	2332533	5200581	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001316675.1|2331165_2332533_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	1.3e-21
>prophage 157
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2350186	2351230	5200581		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2350186_2351230_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 158
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2361795	2362680	5200581		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258942.1|2361795_2362680_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	1.6e-23
>prophage 159
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2369184	2373338	5200581		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738596.1|2369184_2370210_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	9.0e-71
WP_001318065.1|2370277_2371459_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001318066.1|2371468_2372572_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078348.1|2372579_2373338_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 160
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2383666	2385138	5200581	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|2383666_2384176_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000004420.1|2384190_2385138_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 161
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2406353	2408306	5200581		Vibrio_phage(100.0%)	1	NA	NA
WP_001562179.1|2406353_2408306_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 162
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2417136	2425704	5200581		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773176.1|2417136_2419839_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.8e-41
WP_000031783.1|2420130_2421315_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2421385_2423500_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2423596_2424067_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2424163_2424538_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903375.1|2424663_2424951_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|2424958_2425318_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209690.1|2425317_2425704_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 163
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2431274	2440815	5200581		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2431274_2433188_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_042103628.1|2433187_2434210_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2434203_2434422_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2434475_2435345_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2435399_2435804_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2436105_2436738_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001571992.1|2436788_2438879_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_001525813.1|2438945_2440166_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_042103625.1|2440251_2440815_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	5.1e-60
>prophage 164
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2459855	2460692	5200581		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2459855_2460692_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 165
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2477666	2482178	5200581		Bacillus_phage(66.67%)	5	NA	NA
WP_001298201.1|2477666_2479289_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493756.1|2479405_2479723_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650976.1|2479781_2480078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253707.1|2480109_2481462_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|2481458_2482178_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 166
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2488741	2489635	5200581		Sodalis_phage(100.0%)	1	NA	NA
WP_042102758.1|2488741_2489635_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	4.3e-69
>prophage 167
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2495783	2498177	5200581		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081881.1|2495783_2498177_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 168
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2502567	2503794	5200581		Ralstonia_phage(100.0%)	1	NA	NA
WP_042104387.1|2502567_2503794_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	9.8e-133
>prophage 169
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2519203	2521651	5200581		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|2519203_2521651_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 170
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2539047	2540858	5200581		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073619.1|2539047_2539791_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.7	2.0e-11
WP_000907828.1|2539787_2540858_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 171
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2544289	2546455	5200581		Escherichia_phage(33.33%)	4	NA	NA
WP_000155159.1|2544289_2544667_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	49.2	1.6e-25
WP_000557315.1|2544663_2544885_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000416895.1|2544972_2545686_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2545687_2546455_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 172
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2552178	2554997	5200581		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2552178_2553033_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2553277_2554336_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2554328_2554997_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 173
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2558003	2562303	5200581		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2558003_2558630_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106587.1|2558703_2560902_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.3e-119
WP_000130619.1|2561170_2561416_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2561637_2562303_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 174
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2570196	2576093	5200581		Bacillus_virus(33.33%)	6	NA	NA
WP_000173650.1|2570196_2571003_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	1.0e-16
WP_001190062.1|2571008_2571410_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593557.1|2571529_2571889_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001260301.1|2571885_2572161_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	2.9e-16
WP_001318088.1|2572233_2573358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_052920229.1|2573357_2576093_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 175
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2585777	2587820	5200581		Indivirus(100.0%)	1	NA	NA
WP_001296496.1|2585777_2587820_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 176
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2591167	2593302	5200581		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008966.1|2591167_2591521_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	9.7e-25
WP_001318093.1|2591574_2592864_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	6.0e-173
WP_000065766.1|2592876_2593302_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	2.8e-50
>prophage 177
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2606381	2607851	5200581		Pithovirus(50.0%)	2	NA	NA
WP_000622315.1|2606381_2607152_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
WP_001696281.1|2607203_2607851_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	1.0e-16
>prophage 178
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2653795	2655780	5200581		Bacillus_virus(50.0%)	2	NA	NA
WP_000107036.1|2653795_2654800_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196486.1|2654796_2655780_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 179
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2667476	2669810	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_072130343.1|2667476_2669810_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.1	4.5e-70
>prophage 180
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2673464	2673677	5200581		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2673464_2673677_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 181
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2677906	2678902	5200581		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182665.1|2677906_2678902_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	7.0e-12
>prophage 182
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2684219	2685761	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|2684219_2685761_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 183
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2714222	2716067	5200581		Tupanvirus(100.0%)	1	NA	NA
WP_000582416.1|2714222_2716067_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 184
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2738630	2748136	5200581		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2738630_2738882_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2739022_2739454_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2739698_2741243_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|2741252_2742536_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483826.1|2742539_2743499_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982099.1|2743485_2744520_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2744758_2745784_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2745793_2746990_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|2747203_2748136_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 185
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2752295	2753324	5200581		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_001696312.1|2752295_2753324_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	8.0e-11
>prophage 186
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2760762	2765325	5200581		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|2760762_2761242_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114537.1|2761280_2762090_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2762187_2762355_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2762375_2762612_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001318112.1|2762828_2763497_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|2763668_2764889_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|2764866_2765325_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 187
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2769343	2774367	5200581		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001318113.1|2769343_2771029_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.4	7.9e-24
WP_001295237.1|2771286_2771910_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2771964_2772240_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2772258_2774367_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 188
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2778809	2780201	5200581		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2778809_2780201_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 189
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2793461	2794499	5200581		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|2793461_2794499_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 190
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2799939	2801274	5200581		Moraxella_phage(100.0%)	1	NA	NA
WP_072130345.1|2799939_2801274_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	2.5e-65
>prophage 191
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2808696	2821105	5200581		Micromonas_sp._RCC1109_virus(16.67%)	13	NA	NA
WP_000168476.1|2808696_2810385_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001312198.1|2810490_2810589_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2811152_2811242_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001696327.1|2811521_2812706_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148034.1|2812713_2813211_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2813207_2813570_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2813559_2813907_-	YidH family protein	NA	NA	NA	NA	NA
WP_000828511.1|2813966_2815460_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	26.8	7.7e-31
WP_001087170.1|2815456_2817172_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	7.3e-41
WP_001318136.1|2817338_2818205_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279774.1|2818294_2819956_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|2820151_2820580_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2820691_2821105_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 192
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2825534	2826683	5200581		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2825534_2826683_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 193
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2831386	2838755	5200581		Bacillus_virus(33.33%)	8	NA	NA
WP_174144474.1|2831386_2833801_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2833829_2834903_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2834902_2836003_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2836007_2837411_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|2837707_2837788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2838017_2838158_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2838174_2838534_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2838497_2838755_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 194
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2849080	2850418	5200581		Moraxella_phage(100.0%)	1	NA	NA
WP_001318140.1|2849080_2850418_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 195
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2856918	2858132	5200581	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947772.1|2856918_2858132_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 196
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2862050	2865891	5200581		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|2862050_2862824_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|2862914_2863805_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2863804_2864764_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2864850_2865891_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 197
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2871425	2874787	5200581		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334086.1|2871425_2873255_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933716.1|2873416_2874787_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	5.3e-34
>prophage 198
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2886742	2887735	5200581		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|2886742_2887735_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 199
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2890903	2896756	5200581		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102323.1|2890903_2892772_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.2	1.0e-64
WP_001318146.1|2892938_2893358_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|2893365_2894871_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|2894875_2895841_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2895865_2896756_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 200
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2910139	2911786	5200581		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012580.1|2910139_2911786_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 201
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2919440	2924852	5200581		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|2919440_2921462_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001318147.1|2921508_2922993_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047508.1|2923126_2924392_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2924522_2924852_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 202
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2928894	2935038	5200581		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|2928894_2930025_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006610.1|2930021_2931284_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226614.1|2931283_2932351_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.3e-101
WP_000676063.1|2932369_2933251_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	1.5e-106
WP_001145171.1|2933228_2933903_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|2933907_2935038_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 203
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2943056	2944712	5200581		Tetraselmis_virus(100.0%)	1	NA	NA
WP_174144476.1|2943056_2944712_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 204
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2952823	2954881	5200581		Salmonella_phage(100.0%)	1	NA	NA
WP_000611183.1|2952823_2954881_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	67.6	6.0e-82
>prophage 205
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2957883	2961742	5200581		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|2957883_2958780_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2958779_2959496_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2959579_2961742_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 206
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2969108	2970938	5200581		Catovirus(100.0%)	1	NA	NA
WP_000035580.1|2969108_2970938_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 207
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	2979377	2980886	5200581		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|2979377_2980886_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 208
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3002880	3006167	5200581		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|3002880_3004521_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3004599_3004869_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3004872_3005388_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3005390_3006167_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 209
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3014957	3015572	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_001318154.1|3014957_3015572_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.3e-19
>prophage 210
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3029256	3032043	5200581		uncultured_virus(100.0%)	1	NA	NA
WP_174144480.1|3029256_3032043_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.1e-70
>prophage 211
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3036121	3038592	5200581		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3036121_3037531_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3037542_3038592_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 212
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3045713	3050444	5200581		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|3045713_3046502_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_000196715.1|3046541_3047438_-	sugar kinase	NA	NA	NA	NA	NA
WP_001306655.1|3047610_3048489_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	1.6e-47
WP_000094544.1|3048513_3049401_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|3049433_3050444_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 213
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3062611	3065662	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_077249483.1|3062611_3065662_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 214
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3076679	3145688	5200581	integrase,tail,terminase,holin,lysis,head,portal,protease,capsid	Escherichia_phage(37.74%)	85	3072213:3072229	3142493:3142509
3072213:3072229	attL	CGCGCCAGTTCAGCATC	NA	NA	NA	NA
WP_001340151.1|3076679_3077300_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	6.4e-64
WP_001166043.1|3077559_3078543_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|3078691_3079366_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3079471_3080845_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3080841_3081540_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|3081689_3082190_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_032210843.1|3082376_3083360_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	65.2	1.2e-117
WP_032210845.1|3083444_3083753_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	45.5	3.0e-14
WP_032210878.1|3083885_3084161_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	47.7	3.6e-19
WP_032210846.1|3084410_3084596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148723868.1|3085018_3085399_+	ash family protein	NA	NA	NA	NA	NA
WP_032210847.1|3085399_3085657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159103208.1|3085752_3085908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042105586.1|3085919_3086495_+	3'-5' exoribonuclease	NA	A0A2I7R2S7	Vibrio_phage	31.9	9.9e-19
WP_032210849.1|3086496_3086715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052431193.1|3086717_3088832_+	hypothetical protein	NA	V5UQJ3	Shigella_phage	28.6	9.6e-43
WP_042105584.1|3088824_3089046_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174144482.1|3089029_3089824_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	46.9	4.8e-48
WP_174144588.1|3089856_3090132_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.5e-28
WP_077886833.1|3090128_3090434_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	79.0	7.8e-39
WP_174144484.1|3090640_3091285_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	52.0	4.5e-52
WP_042103135.1|3091369_3091621_+	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	54.7	2.9e-15
WP_042103137.1|3091731_3092418_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	71.4	8.6e-86
WP_159107718.1|3092424_3093048_+	ash family protein	NA	K7PLX4	Enterobacteria_phage	50.0	9.8e-12
WP_052431184.1|3093044_3094967_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	37.8	1.5e-111
WP_042103142.1|3095116_3095362_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	39.5	2.7e-10
WP_042103145.1|3095372_3096446_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	39.9	3.2e-63
WP_042103148.1|3096447_3097140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032210866.1|3097229_3097628_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	4.4e-34
WP_012906750.1|3097653_3097833_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032210867.1|3098265_3098526_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032210883.1|3098585_3098960_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028985991.1|3099247_3099679_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	1.3e-66
WP_032210869.1|3099675_3099834_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.2	3.3e-09
WP_174144486.1|3100816_3102784_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	68.0	3.8e-251
WP_174144488.1|3102911_3103094_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	95.0	1.1e-24
WP_032210872.1|3103119_3103404_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	61.7	1.1e-05
WP_000284506.1|3103481_3103697_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_032210873.1|3103701_3104211_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	84.1	8.5e-30
WP_071996845.1|3104158_3104419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032210874.1|3104530_3105064_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	4.0e-99
WP_042106139.1|3105227_3105425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032210876.1|3105509_3105977_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	89.7	3.4e-70
WP_032210877.1|3106000_3106225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032211162.1|3106712_3107219_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	49.4	1.9e-34
WP_174144489.1|3107190_3109119_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	2.5e-263
WP_000259002.1|3109102_3109309_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_042102894.1|3109305_3110898_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_042102892.1|3110887_3112393_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.8e-99
WP_000256801.1|3112429_3112777_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_042102890.1|3112834_3113863_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.1e-113
WP_042102887.1|3113913_3114282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042102885.1|3114274_3114628_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.9	3.9e-42
WP_174144491.1|3114642_3115221_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	88.0	3.0e-71
WP_042106356.1|3115217_3115613_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	1.7e-57
WP_042106357.1|3115620_3116370_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	3.6e-130
WP_174144343.1|3116385_3116808_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	90.0	1.1e-62
WP_072018709.1|3116834_3117239_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	85.4	3.1e-43
WP_174144493.1|3117219_3119835_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	84.2	0.0e+00
WP_032211147.1|3119831_3120161_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	5.2e-57
WP_042107075.1|3120160_3120859_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.1e-128
WP_174144322.1|3120869_3121613_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	5.4e-150
WP_148935101.1|3121558_3122191_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	6.7e-101
WP_174144340.1|3122677_3126151_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	92.1	0.0e+00
WP_000078852.1|3126349_3126490_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_174144339.1|3126632_3128357_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	91.5	8.0e-205
WP_174144495.1|3128398_3129070_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	93.2	1.3e-118
WP_042107367.1|3129832_3130735_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001318165.1|3130915_3131878_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_042105077.1|3132197_3133187_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001298413.1|3133293_3134049_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3134103_3134871_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_042105079.1|3134978_3135578_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_021516633.1|3135678_3136119_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|3136330_3136630_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|3136656_3137085_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796345.1|3137089_3137836_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3137932_3138943_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136790.1|3139113_3140622_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3140644_3141490_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3141915_3142161_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872909.1|3142245_3142731_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
3142493:3142509	attR	CGCGCCAGTTCAGCATC	NA	NA	NA	NA
WP_000139496.1|3142823_3143750_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3143816_3145148_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3145157_3145688_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 215
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3158358	3159909	5200581		Pandoravirus(100.0%)	1	NA	NA
WP_000859436.1|3158358_3159909_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
>prophage 216
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3169764	3177011	5200581		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424857.1|3169764_3170427_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185118.1|3170438_3172940_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.3e-11
WP_001004470.1|3173248_3174328_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3174342_3174663_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184863.1|3174713_3177011_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 217
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3189154	3190369	5200581		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690928.1|3189154_3190369_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	1.7e-44
>prophage 218
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3197120	3199004	5200581		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591386.1|3197120_3199004_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	26.8	2.0e-07
>prophage 219
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3207342	3210395	5200581		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3207342_3208293_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3209210_3210395_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 220
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3214511	3222840	5200581		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3214511_3218540_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3218616_3222840_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 221
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3231281	3233045	5200581		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3231281_3231953_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3231995_3232586_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3232772_3233045_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 222
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3238413	3240003	5200581		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187539.1|3238413_3240003_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.7e-68
>prophage 223
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3253467	3257151	5200581		Dickeya_phage(100.0%)	1	NA	NA
WP_052920534.1|3253467_3257151_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 224
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3280742	3281858	5200581		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3280742_3281858_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 225
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3289215	3289824	5200581		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3289215_3289824_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 226
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3294862	3297410	5200581		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3294862_3296278_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|3296330_3297410_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 227
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3301617	3305231	5200581		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3301617_3304440_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3304694_3305231_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 228
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3309047	3310397	5200581		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3309047_3310397_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 229
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3314530	3316489	5200581		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078235.1|3314530_3316489_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	3.3e-90
>prophage 230
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3326111	3328259	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_077249496.1|3326111_3328259_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 231
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3333503	3339872	5200581		Tetraselmis_virus(50.0%)	5	NA	NA
WP_042102604.1|3333503_3335489_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	8.4e-150
WP_001171673.1|3335761_3336691_-	allose kinase	NA	NA	NA	NA	NA
WP_001317554.1|3336674_3337370_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507104.1|3337380_3338361_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235265.1|3338339_3339872_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
>prophage 232
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3345987	3347537	5200581		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611436.1|3345987_3346668_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075536.1|3346778_3347537_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
>prophage 233
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3353141	3353930	5200581		Pithovirus(100.0%)	1	NA	NA
WP_001193381.1|3353141_3353930_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	5.5e-12
>prophage 234
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3358769	3360272	5200581		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|3358769_3360272_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 235
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3381479	3384691	5200581	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003805.1|3381479_3382997_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3383233_3384691_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 236
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3392227	3403091	5200581	transposase	Stx2-converting_phage(33.33%)	14	NA	NA
WP_032211182.1|3392227_3393799_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	2.7e-167
WP_000624622.1|3393818_3394166_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032211181.1|3394165_3394816_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.5	3.6e-17
WP_174144590.1|3394903_3395785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042104007.1|3396135_3397524_+	replicative DNA helicase	NA	O80281	Escherichia_phage	49.7	8.9e-114
WP_042104009.1|3397513_3399139_+	ParB family protein	NA	NA	NA	NA	NA
WP_042104011.1|3399128_3399860_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000069531.1|3399856_3400435_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_042104015.1|3400431_3400680_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.3	2.7e-05
WP_042104017.1|3400689_3400947_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	81.2	1.3e-31
WP_062867735.1|3400933_3401668_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	78.4	3.9e-100
WP_062867734.1|3402181_3402655_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	67.5	1.5e-36
WP_042106571.1|3402651_3402867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106570.1|3402863_3403091_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	58.8	1.5e-15
>prophage 237
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3406618	3411691	5200581	transposase	Streptococcus_phage(33.33%)	5	NA	NA
WP_042103769.1|3406618_3408631_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.1	3.2e-40
WP_001682053.1|3409365_3409830_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_042103772.1|3409923_3410127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042103774.1|3410139_3410697_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	60.9	5.4e-54
WP_174144503.1|3410743_3411691_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	38.3	4.0e-41
>prophage 238
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3429725	3431816	5200581		Acinetobacter_phage(100.0%)	1	NA	NA
WP_042102112.1|3429725_3431816_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	1.2e-08
>prophage 239
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3441135	3446884	5200581		Escherichia_phage(33.33%)	3	NA	NA
WP_042104684.1|3441135_3442227_+	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	48.3	5.8e-36
WP_042104687.1|3442314_3442788_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.8	1.7e-80
WP_174144507.1|3443077_3446884_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	63.3	0.0e+00
>prophage 240
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3455791	3464890	5200581	transposase	Campylobacter_phage(25.0%)	9	NA	NA
WP_042101989.1|3455791_3456946_-	adenine-specific methyltransferase EcoRI family protein	NA	A0A1B0XVT8	Campylobacter_phage	37.0	5.6e-29
WP_001125909.1|3457113_3457437_-	CcdB family protein	NA	NA	NA	NA	NA
WP_077775912.1|3457436_3457685_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_042106650.1|3458829_3460719_+	SAM-dependent DNA methyltransferase	NA	P95687	Staphylococcus_phage	30.0	6.3e-62
WP_102384962.1|3461224_3462452_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_148935098.1|3462581_3463028_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_042106693.1|3463075_3463807_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_042106691.1|3464184_3464448_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_042106690.1|3464749_3464890_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	82.2	2.3e-14
>prophage 241
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3468583	3481017	5200581		Salmonella_phage(16.67%)	14	NA	NA
WP_072018715.1|3468583_3469315_-	hypothetical protein	NA	S4TQ39	Salmonella_phage	41.5	8.5e-23
WP_001672448.1|3469858_3470260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174144509.1|3470425_3470806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089611145.1|3470906_3471386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894582.1|3471538_3471922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062867590.1|3472014_3472998_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.0	1.7e-50
WP_000287296.1|3473108_3473468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042103336.1|3473535_3473874_+	hypothetical protein	NA	A0A1W6JKX4	Lactococcus_phage	40.0	2.3e-07
WP_042103339.1|3473950_3474385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852732.1|3474492_3475470_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_042103342.1|3475551_3478467_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	86.6	0.0e+00
WP_042103344.1|3478469_3480431_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	56.6	2.1e-193
WP_106894585.1|3480473_3480680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116834860.1|3480753_3481017_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	95.9	6.3e-21
>prophage 242
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3486229	3491387	5200581	integrase,tail	Ralstonia_phage(66.67%)	6	3482908:3482921	3492273:3492286
3482908:3482921	attL	GGCCAGATTCTGAC	NA	NA	NA	NA
WP_042102132.1|3486229_3487423_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.4	5.2e-38
WP_089577059.1|3487993_3488371_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.4	6.7e-24
WP_064753000.1|3488375_3488615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077775843.1|3489008_3490241_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_042103952.1|3490237_3490888_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_042103932.1|3490904_3491387_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	35.0	7.3e-07
3492273:3492286	attR	GGCCAGATTCTGAC	NA	NA	NA	NA
>prophage 243
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3502785	3504294	5200581		Vibrio_phage(100.0%)	1	NA	NA
WP_042104507.1|3502785_3504294_+	ATP-dependent helicase	NA	A0A2I7R5Z1	Vibrio_phage	29.7	2.4e-40
>prophage 244
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3515267	3517251	5200581		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3515267_3515561_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3515604_3517251_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 245
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3521451	3521985	5200581		Morganella_phage(100.0%)	1	NA	NA
WP_042104917.1|3521451_3521985_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	1.6e-47
>prophage 246
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3526905	3527883	5200581		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3526905_3527883_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 247
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3535879	3536425	5200581		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3535879_3536425_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 248
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3540461	3553493	5200581	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990273.1|3540461_3541799_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122460.1|3541808_3543656_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280339.1|3543648_3544599_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3544684_3544993_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3545069_3546350_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312479.1|3546435_3547695_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3547697_3548702_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3548783_3548981_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3549084_3550383_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3550587_3551013_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076315.1|3551051_3553493_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 249
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3557335	3558499	5200581		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943967.1|3557335_3558499_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	6.4e-81
>prophage 250
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3603867	3610355	5200581		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3603867_3604398_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|3604707_3605664_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205816.1|3605803_3607306_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001298067.1|3607319_3608342_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595993.1|3608328_3609324_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3609356_3610355_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 251
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3614672	3617433	5200581		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|3614672_3615137_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187805.1|3615294_3617433_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	2.0e-266
>prophage 252
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3621062	3627158	5200581		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3621062_3622010_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3622194_3622248_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471848.1|3622387_3625084_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3625289_3625676_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3625748_3626210_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3626222_3627158_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 253
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3635552	3647506	5200581	tRNA,integrase	Klosneuvirus(20.0%)	8	3632901:3632914	3650706:3650719
3632901:3632914	attL	GCGGCTAACTGCAG	NA	NA	NA	NA
WP_000416377.1|3635552_3638408_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	1.6e-141
WP_000786399.1|3638407_3638851_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3638984_3640496_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3640762_3641863_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3641862_3642945_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001317595.1|3643105_3644608_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001314371.1|3644737_3645757_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_052920518.1|3646237_3647506_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.8	3.7e-82
3650706:3650719	attR	CTGCAGTTAGCCGC	NA	NA	NA	NA
>prophage 254
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3667206	3675341	5200581	transposase	Shigella_phage(33.33%)	7	NA	NA
WP_085948812.1|3667206_3668413_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
WP_042106716.1|3669043_3669727_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_042106715.1|3669765_3670779_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_042106714.1|3670790_3671576_+	hypothetical protein	NA	A0A223LJT0	Erwinia_phage	43.5	3.2e-12
WP_042106713.1|3671790_3672009_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772910.1|3672126_3672741_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_024223204.1|3674522_3675341_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.3	2.2e-43
>prophage 255
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3684159	3685140	5200581		Escherichia_phage(100.0%)	1	NA	NA
WP_000991418.1|3684159_3685140_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	56.0	8.8e-100
>prophage 256
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3688502	3690179	5200581		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3688502_3689105_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044710.1|3689582_3690179_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 257
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3700370	3701831	5200581		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208189.1|3700370_3701831_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 258
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3707592	3708147	5200581		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151852.1|3707592_3708147_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	3.5e-37
>prophage 259
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3723121	3727090	5200581		Acinetobacter_phage(50.0%)	2	NA	NA
WP_004996206.1|3723121_3724591_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_000819020.1|3724657_3727090_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 260
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3738043	3743417	5200581		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_052920182.1|3738043_3739717_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410129.1|3739765_3741127_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3741341_3742256_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024225553.1|3742394_3743417_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 261
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3746641	3747921	5200581		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3746641_3747379_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|3747381_3747921_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 262
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3755750	3758626	5200581		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|3755750_3757340_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_032284815.1|3757732_3758338_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3758464_3758626_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 263
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3764362	3765685	5200581		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3764362_3765685_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 264
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3772428	3778367	5200581		Enterococcus_phage(33.33%)	5	NA	NA
WP_000093813.1|3772428_3773661_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001317608.1|3773752_3774085_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|3774086_3774371_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046743.1|3774426_3776094_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000409451.1|3776429_3778367_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 265
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3781553	3783667	5200581		Bacillus_phage(50.0%)	2	NA	NA
WP_001188671.1|3781553_3782243_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
WP_001219593.1|3782242_3783667_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	2.5e-10
>prophage 266
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3795434	3809955	5200581	tRNA	Cyanophage(16.67%)	14	NA	NA
WP_000130187.1|3795434_3796388_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094681.1|3796502_3797090_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3797124_3797691_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102366.1|3797839_3798553_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843575.1|3798578_3798983_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3799358_3801275_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3801363_3802494_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|3802597_3802807_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000681352.1|3803335_3804502_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
WP_000062878.1|3804561_3805467_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|3805562_3805826_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001695414.1|3805928_3806147_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|3806154_3807096_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286827.1|3807138_3809955_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 267
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3814361	3815510	5200581		Halovirus(100.0%)	1	NA	NA
WP_001317611.1|3814361_3815510_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 268
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3821014	3826663	5200581		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001317612.1|3821014_3822568_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.0e-34
WP_000349928.1|3822640_3823858_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3823975_3825118_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3825148_3826663_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 269
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3834556	3836504	5200581		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|3834556_3835036_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125563.1|3835121_3835355_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001306201.1|3835357_3835546_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000148634.1|3835542_3835659_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257195.1|3835655_3836504_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 270
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3844249	3849671	5200581		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117001.1|3844249_3847156_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035731.1|3847319_3849671_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.0e-37
>prophage 271
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3856119	3856818	5200581		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916317.1|3856119_3856818_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.4e-22
>prophage 272
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3868298	3870023	5200581		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425653.1|3868298_3870023_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 273
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3896107	3897151	5200581		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3896107_3897151_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 274
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3901396	3901948	5200581		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923730.1|3901396_3901948_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.9e-11
>prophage 275
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3910575	3912000	5200581		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001695428.1|3910575_3912000_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	5.5e-42
>prophage 276
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3919649	3926266	5200581		Mamastrovirus(33.33%)	5	NA	NA
WP_052920196.1|3919649_3921200_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_042106510.1|3921395_3923786_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3923991_3924528_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3924568_3925231_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3925339_3926266_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 277
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3929528	3930449	5200581	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339897.1|3929528_3930449_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.0	4.1e-59
>prophage 278
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3940656	3947462	5200581	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3940656_3942075_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_032148612.1|3942113_3943010_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3943076_3943532_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396038.1|3943709_3944414_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|3944428_3944959_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001317623.1|3945032_3947462_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.6	3.0e-40
>prophage 279
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3952549	3953347	5200581		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3952549_3953347_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 280
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	3959258	3959603	5200581		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3959258_3959603_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 282
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4040940	4079836	5200581	tail,plate,transposase,head,protease	Shigella_phage(57.89%)	57	NA	NA
WP_124071276.1|4040940_4041678_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.9e-103
WP_032210709.1|4041631_4041832_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042107250.1|4042450_4042696_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_032210708.1|4042731_4042914_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	57.9	2.0e-10
WP_124071272.1|4043062_4045099_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	77.8	1.3e-267
WP_124071270.1|4045198_4045759_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	75.0	7.3e-75
WP_077903095.1|4045969_4046194_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	60.9	2.0e-15
WP_174144524.1|4046315_4046840_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	47.7	4.0e-43
WP_124071266.1|4046868_4047039_-|tail	phage tail protein	tail	A0A0C4UQV0	Shigella_phage	53.8	1.3e-11
WP_032210705.1|4047749_4048307_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	46.3	4.7e-42
WP_001146835.1|4048297_4049380_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_032210704.1|4049379_4049817_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	3.3e-38
WP_073568532.1|4049809_4050424_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	52.0	7.3e-52
WP_032210703.1|4050413_4051547_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.8	6.4e-94
WP_174144526.1|4051530_4052880_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	32.7	2.8e-56
WP_073568534.1|4052866_4054942_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.8	1.6e-71
WP_042107237.1|4055069_4055546_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_032210699.1|4055560_4055926_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	50.8	2.6e-25
WP_174144528.1|4055934_4057434_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	50.8	5.2e-136
WP_047086398.1|4057430_4057676_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047086396.1|4057751_4058018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174144530.1|4058135_4058693_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.8	3.3e-43
WP_151296783.1|4058689_4059109_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	1.6e-34
WP_174144532.1|4059105_4059489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032210694.1|4059533_4060481_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	66.9	7.9e-122
WP_174144533.1|4060480_4061605_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.3	1.8e-77
WP_000094813.1|4061781_4062255_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_033805801.1|4062376_4063708_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.6	2.3e-151
WP_044723563.1|4063691_4065281_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.5	4.2e-168
WP_001057670.1|4065280_4066945_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000360581.1|4066944_4067526_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279079.1|4067528_4067819_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000270159.1|4067815_4068124_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342749.1|4068104_4068332_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|4068342_4068561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4068544_4068973_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4069007_4069508_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4069579_4070005_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214359.1|4070074_4070584_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000370523.1|4070580_4070877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|4070866_4071064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|4071056_4071389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595948.1|4071427_4071613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973021.1|4071609_4072161_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|4072164_4072680_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000564281.1|4072679_4073213_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000323221.1|4073216_4073759_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|4073856_4074387_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|4074398_4074692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4074696_4074969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4074965_4075247_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4075248_4075503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|4075515_4075737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|4075739_4076672_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_044723559.1|4076743_4078834_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.2	5.2e-166
WP_001310454.1|4078835_4079084_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|4079251_4079836_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
>prophage 283
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4093984	4163858	5200581	holin,integrase,transposase	Streptococcus_phage(16.67%)	59	4104103:4104137	4171395:4171429
WP_174144537.1|4093984_4095121_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001561474.1|4095190_4095961_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|4096114_4096588_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973081.1|4096630_4099075_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|4099314_4099893_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4100008_4100776_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4100746_4101487_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000729706.1|4102048_4102309_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_123009815.1|4102494_4103268_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
WP_001561476.1|4103444_4103942_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
4104103:4104137	attL	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_052920260.1|4104159_4105899_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_011076207.1|4105840_4106629_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_174144539.1|4106699_4107755_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_071800230.1|4107751_4108204_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042105334.1|4108382_4108649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023063669.1|4108808_4108949_+	peptide chain release factor	NA	NA	NA	NA	NA
WP_001292999.1|4109005_4110463_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|4110723_4111182_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_042105312.1|4111273_4112518_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174682.1|4112575_4112977_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_042105313.1|4113015_4114071_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|4114359_4115463_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_042105314.1|4115474_4116728_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.7	2.9e-95
WP_042105316.1|4117138_4117324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|4117538_4118153_+	YagU family protein	NA	NA	NA	NA	NA
WP_032148604.1|4118401_4118731_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_021525526.1|4119044_4119755_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265664.1|4119723_4121367_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131109.1|4121356_4123882_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716404.1|4123907_4124576_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730984.1|4124632_4125220_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|4125294_4125837_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000866436.1|4126920_4127061_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|4127060_4127324_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|4127687_4127789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526135.1|4127917_4128376_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001317639.1|4128981_4129224_-	NADH-flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_000910706.1|4129583_4130477_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172276.1|4130507_4131497_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174468.1|4131523_4132375_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	8.8e-48
WP_000092636.1|4132940_4137188_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000621016.1|4137312_4138170_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|4139446_4140040_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4140051_4140288_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046289.1|4140396_4141722_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000339603.1|4141947_4142802_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102115.1|4143329_4144049_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295802.1|4144059_4145487_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370406.1|4145479_4146175_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000003133.1|4146415_4147084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088435459.1|4147265_4148459_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001695470.1|4149598_4150360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001317642.1|4150513_4151308_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001362381.1|4151637_4152201_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_174144541.1|4153363_4155052_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	8.1e-61
WP_000089090.1|4155065_4156538_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|4156551_4157139_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|4157267_4159301_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_072130334.1|4159874_4163858_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.7	8.4e-125
4171395:4171429	attR	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 284
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4175862	4180400	5200581		Bacillus_virus(50.0%)	4	NA	NA
WP_000447342.1|4175862_4177347_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.0e-11
WP_000818903.1|4177339_4178311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750344.1|4178307_4179264_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021564016.1|4179350_4180400_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	6.3e-72
>prophage 285
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4186715	4187615	5200581		Lactobacillus_phage(100.0%)	1	NA	NA
WP_042107188.1|4186715_4187615_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	5.5e-16
>prophage 286
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4192156	4196436	5200581		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177889.1|4192156_4195231_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.9	0.0e+00
WP_000805866.1|4195353_4196436_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	1.0e-189
>prophage 287
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4201847	4203808	5200581		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044319.1|4201847_4202798_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
WP_001013518.1|4202794_4203808_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	9.2e-44
>prophage 288
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4206987	4208097	5200581		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4206987_4208097_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 289
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4213384	4214152	5200581		Planktothrix_phage(100.0%)	1	NA	NA
WP_042106456.1|4213384_4214152_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	1.9e-25
>prophage 290
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4221021	4222179	5200581		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830732.1|4221021_4222179_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 291
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4229606	4230707	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_001317655.1|4229606_4230707_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 292
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4234993	4244961	5200581		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4234993_4235905_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|4236029_4236938_+	fructokinase	NA	NA	NA	NA	NA
WP_001695489.1|4237076_4238261_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698960.1|4238386_4241530_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.5e-12
WP_001221284.1|4241526_4242729_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4242918_4243608_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893610.1|4243665_4244961_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
>prophage 293
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4252039	4260881	5200581	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4252039_4253167_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4253189_4253522_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4253549_4255397_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4255407_4256379_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4256507_4256855_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4256892_4257777_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|4258075_4258615_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4258765_4259215_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_042105308.1|4259218_4260322_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	7.4e-55
WP_001021161.1|4260410_4260881_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 294
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4282518	4287565	5200581	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4282518_4283142_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4283267_4284542_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4284729_4287084_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4287292_4287565_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 295
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4290705	4291401	5200581		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4290705_4291401_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 296
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4294724	4298271	5200581		Bacillus_phage(100.0%)	2	NA	NA
WP_001235643.1|4294724_4296497_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256161.1|4296489_4298271_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	6.8e-42
>prophage 297
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4307107	4310257	5200581		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|4307107_4310257_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 298
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4317265	4325723	5200581		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4317265_4317817_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122014.1|4317945_4319877_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4319929_4320259_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4320258_4320864_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4320973_4322848_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4323028_4323673_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250105.1|4323804_4324767_+	ferrochelatase	NA	NA	NA	NA	NA
WP_042102480.1|4324763_4325723_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.9e-14
>prophage 299
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4333913	4337155	5200581		Escherichia_phage(66.67%)	3	NA	NA
WP_000057523.1|4333913_4334216_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
WP_000806442.1|4334251_4334593_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_052920301.1|4334650_4337155_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 300
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4345054	4345732	5200581		Bacillus_virus(100.0%)	1	NA	NA
WP_001317661.1|4345054_4345732_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	8.9e-27
>prophage 301
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4348868	4349555	5200581		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110563.1|4348868_4349555_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	4.5e-34
>prophage 302
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4356462	4358244	5200581		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001309310.1|4356462_4358244_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 303
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4364436	4365582	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_001317663.1|4364436_4365582_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	1.6e-47
>prophage 304
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4377397	4434045	5200581	integrase,tail,tRNA,terminase,lysis,head,portal,protease,capsid	Enterobacteria_phage(58.62%)	70	4377034:4377049	4384230:4384245
4377034:4377049	attL	GTGGCTTTTTGTTTCA	NA	NA	NA	NA
WP_000912345.1|4377397_4378783_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143512.1|4378818_4379340_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4379447_4379660_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729156.1|4379661_4380528_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.0e-30
WP_000051902.1|4380890_4382054_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|4382252_4382531_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4382578_4382797_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|4382895_4383177_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|4383187_4383379_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|4383351_4383534_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_042105967.1|4383530_4384211_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.1	6.0e-132
WP_000100847.1|4384207_4384993_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
4384230:4384245	attR	GTGGCTTTTTGTTTCA	NA	NA	NA	NA
WP_000995439.1|4384998_4385295_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|4385370_4385577_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_077775895.1|4386164_4387772_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|4387878_4388571_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_000184665.1|4388681_4388909_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182871.1|4388939_4389479_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_174144543.1|4389475_4390495_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.3	1.3e-109
WP_032217951.1|4390491_4391193_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	2.1e-127
WP_021580089.1|4391189_4391510_+	phage exclusion protein Ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.2e-42
WP_001070442.1|4391560_4391893_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|4391984_4392092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|4392149_4393676_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|4393787_4394105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|4394309_4395239_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|4395337_4395439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|4395435_4395891_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|4395890_4396061_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|4396053_4396344_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|4396340_4396703_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|4396699_4396840_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|4396925_4397309_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|4397498_4398596_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|4399184_4399400_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4399399_4399897_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4400113_4400296_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4400386_4400680_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|4401039_4401234_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453587.1|4401622_4402168_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|4402142_4404068_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|4404064_4404271_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|4404267_4405869_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_174144545.1|4405849_4407169_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	2.2e-231
WP_001369910.1|4407178_4407511_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|4407566_4408592_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|4408633_4409029_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|4409040_4409394_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|4409405_4409984_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|4409980_4410376_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|4410383_4411124_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|4411139_4411562_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|4411543_4411978_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|4411970_4414532_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|4414528_4414858_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|4414857_4415556_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|4415561_4416305_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|4416241_4416874_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_174144547.1|4416934_4420348_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.5	0.0e+00
WP_001233093.1|4420418_4421018_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_072018708.1|4421082_4424478_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	34.5	2.0e-10
WP_174144549.1|4424477_4425053_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	4.2e-102
WP_000086514.1|4425150_4425741_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|4426057_4426291_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4426359_4426473_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|4426838_4427507_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|4428052_4429537_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|4429723_4430677_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_174144551.1|4432191_4432848_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001357859.1|4433091_4434045_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 305
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4440939	4443055	5200581		Hokovirus(50.0%)	2	NA	NA
WP_000253850.1|4440939_4442382_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	25.7	3.9e-11
WP_000770953.1|4442371_4443055_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 306
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4446200	4449344	5200581		Leptospira_phage(100.0%)	1	NA	NA
WP_001695523.1|4446200_4449344_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
>prophage 307
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4461270	4467313	5200581		Tupanvirus(50.0%)	3	NA	NA
WP_000077757.1|4461270_4465152_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096734.1|4465367_4466501_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140635.1|4466497_4467313_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 308
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4481664	4483487	5200581		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|4481664_4482294_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029774.1|4482266_4483487_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	9.4e-59
>prophage 309
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4486593	4488708	5200581		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4486593_4488159_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001295855.1|4488279_4488708_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
>prophage 310
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4502799	4503446	5200581		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4502799_4503009_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4503062_4503446_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 311
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4508264	4510704	5200581		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4508264_4509476_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|4509615_4510704_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 312
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4517714	4522837	5200581	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157896.1|4517714_4520297_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
WP_174144553.1|4520531_4521014_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_174144555.1|4521058_4521994_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4522111_4522837_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 313
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4530733	4531774	5200581		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4530733_4531774_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 314
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4536340	4538005	5200581		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000337084.1|4536340_4538005_-	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	38.5	6.1e-85
>prophage 315
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4542771	4546585	5200581	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023120.1|4542771_4544718_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	2.7e-07
WP_001287170.1|4544920_4546585_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 316
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4550736	4554544	5200581	transposase	Mycobacterium_phage(50.0%)	4	NA	NA
WP_000773272.1|4550736_4551501_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
WP_000848387.1|4551685_4552231_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001317696.1|4552256_4553897_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000526135.1|4554085_4554544_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 317
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4560199	4566180	5200581		Bacillus_phage(33.33%)	4	NA	NA
WP_000186067.1|4560199_4560877_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
WP_001317700.1|4560873_4563558_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	2.5e-11
WP_001298627.1|4563550_4564123_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000088005.1|4564131_4566180_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	2.7e-26
>prophage 318
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4579432	4584041	5200581		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_174144557.1|4579432_4581238_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.3	7.7e-33
WP_001039055.1|4581239_4581566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112021467.1|4583396_4584041_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	50.9	1.0e-27
>prophage 319
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4589307	4592250	5200581		Hokovirus(50.0%)	2	NA	NA
WP_052920332.1|4589307_4590726_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	1.5e-60
WP_001562782.1|4590768_4592250_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.9e-45
>prophage 320
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4595628	4596420	5200581		Kaumoebavirus(100.0%)	1	NA	NA
WP_052920336.1|4595628_4596420_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.5	2.9e-08
>prophage 321
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4628558	4632078	5200581		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|4628558_4629278_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951276.1|4629274_4630216_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000784342.1|4630329_4630710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109211.1|4631025_4632078_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	5.7e-81
>prophage 322
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4636422	4642995	5200581		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|4636422_4637439_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096905.1|4637699_4639172_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.2e-12
WP_001147439.1|4639239_4640028_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4640156_4640306_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101987.1|4640471_4641245_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604031.1|4641244_4641934_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891657.1|4641936_4642995_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	36.0	3.7e-19
>prophage 323
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4653257	4654547	5200581		Klosneuvirus(100.0%)	1	NA	NA
WP_001696826.1|4653257_4654547_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	1.0e-18
>prophage 324
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4661028	4661937	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_001304790.1|4661028_4661937_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 325
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4672211	4683874	5200581		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_001317737.1|4672211_4673948_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|4673940_4674936_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4674938_4675610_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007122.1|4675838_4677200_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001218650.1|4677736_4679887_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	6.3e-42
WP_000386550.1|4679914_4680877_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000253497.1|4681017_4682103_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|4682331_4682592_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4682856_4683123_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990165.1|4683196_4683874_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	4.0e-19
>prophage 326
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4690434	4695660	5200581		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4690434_4691157_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4691153_4691813_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4691951_4692698_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4693101_4693605_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4693904_4694792_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4695026_4695092_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4695144_4695660_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 327
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4700657	4708993	5200581		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|4700657_4702250_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000144237.1|4702490_4703750_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114264.1|4703901_4704717_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209345.1|4704862_4707295_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001317740.1|4707300_4708200_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001317741.1|4708330_4708993_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	5.7e-26
>prophage 328
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4712220	4714092	5200581		Planktothrix_phage(100.0%)	1	NA	NA
WP_001317742.1|4712220_4714092_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	1.5e-15
>prophage 329
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4726380	4727583	5200581		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001695604.1|4726380_4727583_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.7	2.4e-99
>prophage 330
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4736143	4745293	5200581		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|4736143_4736401_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201580.1|4736560_4736848_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189139.1|4736831_4737554_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4737614_4738517_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4738604_4739081_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126102.1|4739431_4740544_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4740638_4741772_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|4741781_4742735_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4742731_4743577_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4743636_4744125_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149700.1|4744165_4745293_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	2.3e-27
>prophage 331
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4748418	4751156	5200581		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4748418_4749147_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|4749364_4749880_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160731.1|4750005_4750329_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255192.1|4750325_4751156_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 332
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4754743	4756462	5200581		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815360.1|4754743_4756462_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
>prophage 333
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4765720	4789843	5200581	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188133.1|4765720_4767667_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4767739_4767964_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4768286_4768607_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4768637_4770914_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4771958_4772177_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4772461_4773166_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202181.1|4773207_4774929_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	5.8e-22
WP_001043586.1|4774929_4776696_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537434.1|4776818_4777784_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	5.5e-62
WP_000228473.1|4778328_4778823_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077032.1|4778957_4783025_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4783183_4783795_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4783805_4785149_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4785239_4786532_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850334.1|4786770_4789215_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_000213098.1|4789225_4789843_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 334
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4794681	4797896	5200581		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4794681_4795422_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4795613_4797896_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 335
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4801994	4803083	5200581		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057158.1|4801994_4803083_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
>prophage 336
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4808170	4812711	5200581		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4808170_4808455_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705722.1|4808661_4810926_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|4810962_4812711_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 337
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4825303	4839088	5200581	tRNA,transposase	Saccharomonospora_phage(16.67%)	10	NA	NA
WP_000526135.1|4825303_4825762_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000926012.1|4826099_4827947_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|4828127_4828676_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|4828702_4829350_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462684.1|4829400_4830591_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977917.1|4830775_4831864_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|4832465_4833866_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001317750.1|4834034_4835237_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193870.1|4835502_4838115_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001090524.1|4838320_4839088_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 338
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4847989	4849897	5200581		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4847989_4849897_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 339
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4862496	4864551	5200581		Bacillus_phage(100.0%)	1	NA	NA
WP_001317751.1|4862496_4864551_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	3.8e-20
>prophage 340
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4868785	4869445	5200581	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4868785_4869445_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 341
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4888715	4944315	5200581	integrase,tail,plate,terminase,holin,lysis,capsid	Enterobacteria_phage(40.85%)	85	4889029:4889044	4949218:4949233
WP_000066490.1|4888715_4888928_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4888938_4889127_+	cold-shock protein	NA	NA	NA	NA	NA
4889029:4889044	attL	GGCGCTAAGTGTATTT	NA	NA	NA	NA
WP_001309400.1|4889101_4889332_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4889321_4889495_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000137002.1|4889543_4890617_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054732.1|4890688_4893433_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	8.3e-39
WP_042106942.1|4893527_4894601_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.6	4.5e-198
WP_001303849.1|4894578_4894797_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001277762.1|4894910_4895090_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	100.0	1.5e-29
WP_000103027.1|4895186_4895834_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	50.4	1.9e-63
WP_042106940.1|4895830_4896337_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	91.4	8.3e-62
WP_001214454.1|4896333_4896501_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_001579639.1|4896497_4896779_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	5.7e-44
WP_000753555.1|4896795_4897110_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_001579638.1|4897121_4897604_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.1	1.2e-78
WP_000065845.1|4897587_4898490_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.1	3.3e-146
WP_042106938.1|4898486_4898795_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	97.1	1.3e-52
WP_001243355.1|4898879_4899032_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|4899016_4899151_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_032234312.1|4899234_4899483_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	98.8	4.5e-37
WP_042106936.1|4899658_4899859_-	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	95.5	2.3e-31
WP_001066173.1|4900072_4900654_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_042106935.1|4900670_4900943_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	93.3	3.1e-23
WP_001095981.1|4901255_4901906_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_000276886.1|4901986_4902172_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001177650.1|4902280_4902559_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_042106933.1|4902593_4903493_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	3.2e-173
WP_042106931.1|4903489_4904191_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.0e-126
WP_042036542.1|4904187_4904478_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.8	4.1e-45
WP_042106929.1|4904551_4904992_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	5.9e-80
WP_000153259.1|4904988_4905516_+	phage N-6-adenine-methyltransferase	NA	K7PMG2	Enterobacteria_phage	100.0	9.5e-101
WP_001254251.1|4905512_4905695_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000567007.1|4905691_4905862_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
WP_024174867.1|4905854_4906466_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	1.8e-98
WP_042106928.1|4906462_4907134_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.5	5.2e-128
WP_000512806.1|4907124_4907613_+	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_042106925.1|4907978_4908194_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	2.0e-33
WP_097434064.1|4908193_4908691_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	6.4e-91
WP_042106262.1|4908687_4909125_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	3.8e-71
WP_042106260.1|4909112_4909265_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	2.4e-20
WP_042106258.1|4909683_4909863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072018707.1|4909976_4910717_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	70.0	4.9e-95
WP_032317197.1|4910898_4911135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106254.1|4911182_4911392_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_042106252.1|4911419_4911971_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	1.2e-66
WP_042106251.1|4911973_4913596_+	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000113487.1|4913595_4915062_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	8.7e-261
WP_077167819.1|4914952_4915687_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	88.5	5.6e-99
WP_042106249.1|4915701_4916922_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	90.2	3.3e-205
WP_042093528.1|4916925_4917432_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
WP_042106247.1|4917443_4918385_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_164965922.1|4918381_4918615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106246.1|4918613_4919021_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	2.8e-68
WP_042106245.1|4919017_4919572_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.2	9.7e-80
WP_042106243.1|4919558_4919948_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	1.2e-65
WP_033544654.1|4919922_4920486_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_042106242.1|4920489_4921635_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	5.2e-160
WP_042106240.1|4921645_4922086_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_042106239.1|4922089_4922542_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	6.8e-55
WP_042106238.1|4922719_4924708_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.6	3.5e-273
WP_042106235.1|4924707_4925295_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	1.5e-83
WP_042106233.1|4925294_4925597_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	3.1e-48
WP_042106232.1|4925599_4926661_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.5	4.5e-158
WP_001214055.1|4926664_4927006_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.8	2.5e-33
WP_000050470.1|4927155_4927887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110002.1|4927886_4928315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106229.1|4928379_4929132_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.5	6.5e-87
WP_001270634.1|4929131_4929485_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_001197075.1|4929484_4930684_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.9	1.3e-185
WP_042106228.1|4930680_4931361_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.4	1.1e-101
WP_042106226.1|4931360_4932056_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	67.8	4.1e-27
WP_001174916.1|4932058_4932499_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	8.9e-52
WP_042106225.1|4932470_4933073_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.5	2.7e-99
WP_042106223.1|4933072_4933648_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.8	2.5e-54
WP_072018706.1|4933641_4933836_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.2	1.4e-12
WP_042106221.1|4934234_4934948_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	97.9	4.7e-135
WP_042106220.1|4934944_4935766_+	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	98.9	1.3e-152
WP_042106219.1|4935762_4936335_+	toxin	NA	A5LH54	Enterobacteria_phage	91.6	3.7e-98
WP_001264952.1|4936697_4937726_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4937698_4938391_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230244.1|4938520_4939693_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_042106216.1|4939692_4942239_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
WP_042106215.1|4942235_4942835_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|4943089_4943395_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420644.1|4943394_4944315_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
4949218:4949233	attR	GGCGCTAAGTGTATTT	NA	NA	NA	NA
>prophage 342
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4947345	4949445	5200581		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|4947345_4947519_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_042104027.1|4947601_4948930_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	4.8e-234
WP_001028089.1|4948950_4949445_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	7.1e-50
>prophage 343
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4964474	4967818	5200581	transposase	Cronobacter_phage(50.0%)	3	NA	NA
WP_000533536.1|4964474_4965263_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
WP_001695651.1|4965825_4966512_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_094122342.1|4966562_4967818_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	3.1e-17
>prophage 344
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4971566	4972400	5200581		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4971566_4972400_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 345
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4976537	4977071	5200581		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4976537_4977071_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 346
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4986378	4987299	5200581		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4986378_4987299_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 347
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	4991961	4992207	5200581		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4991961_4992207_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 348
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5008087	5009029	5200581		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001317765.1|5008087_5009029_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 349
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5022203	5029011	5200581	transposase	Trichoplusia_ni_ascovirus(20.0%)	8	NA	NA
WP_001008539.1|5022203_5022938_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
WP_000103754.1|5023148_5023385_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000044679.1|5023472_5024714_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_000526135.1|5024907_5025366_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000478679.1|5025544_5026354_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_000756841.1|5026356_5027379_+	cell division protein YceG	NA	NA	NA	NA	NA
WP_001257002.1|5027368_5028010_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267936.1|5028006_5029011_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 350
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5041265	5041523	5200581		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|5041265_5041523_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 351
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5048812	5052535	5200581		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|5048812_5049514_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251361.1|5049513_5050758_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|5050786_5051698_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|5051713_5052535_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 352
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5056639	5057776	5200581		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000531594.1|5056639_5057776_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 353
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5062797	5064168	5200581		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|5062797_5064168_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 354
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5067304	5071746	5200581	transposase	Phage_21(25.0%)	6	NA	NA
WP_000444487.1|5067304_5068555_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001317720.1|5068655_5068979_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	65.4	3.0e-41
WP_000526135.1|5069612_5070071_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001695662.1|5070226_5070337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373096.1|5070389_5070794_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332300.1|5071014_5071746_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 355
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5087771	5089459	5200581		Morganella_phage(50.0%)	2	NA	NA
WP_000897377.1|5087771_5088191_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	1.2e-37
WP_000457597.1|5088190_5089459_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.2	3.7e-207
>prophage 356
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5105376	5106135	5200581		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173318.1|5105376_5106135_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.3e-13
>prophage 357
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5118585	5121337	5200581		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033342.1|5118585_5120265_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
WP_001298109.1|5120389_5121337_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 358
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5124473	5130743	5200581		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|5124473_5125556_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_042106477.1|5125555_5126389_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|5126385_5126778_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257058.1|5126781_5127591_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|5127626_5128481_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170956.1|5128629_5128737_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001317783.1|5129142_5130243_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|5130512_5130743_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 359
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5141875	5151885	5200581		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|5141875_5143414_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_052920628.1|5143410_5144121_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|5144120_5144798_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555858.1|5145522_5146365_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001317785.1|5146414_5146873_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|5146985_5147891_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|5147982_5148996_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|5149197_5150106_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|5150250_5150664_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|5151267_5151885_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 360
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5160295	5162310	5200581		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110961.1|5160295_5161309_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.2	5.8e-14
WP_000994905.1|5161305_5162310_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 361
NZ_CP054363	Escherichia coli strain SCU-171 chromosome, complete genome	5200581	5167448	5199732	5200581	holin,integrase,lysis,transposase	Escherichia_phage(41.03%)	52	5161114:5161130	5196420:5196436
5161114:5161130	attL	GCGTCTCGATGCGGAAG	NA	NA	NA	NA
WP_101774106.1|5167448_5168703_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	3.1e-17
WP_042106136.1|5168684_5169104_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|5169208_5169748_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|5169777_5170521_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_042106135.1|5170877_5171531_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_042106134.1|5171576_5172707_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	5.2e-104
WP_042106132.1|5172684_5172933_-	excisionase	NA	NA	NA	NA	NA
WP_174144563.1|5172997_5175490_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	3.6e-57
WP_042103277.1|5175585_5175774_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032210920.1|5175770_5175959_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_174144319.1|5176260_5176434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106863.1|5176649_5177096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106861.1|5177194_5177347_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_042106859.1|5177622_5177925_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.2	4.9e-17
WP_001022416.1|5177927_5178287_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	94.1	7.2e-60
WP_042106857.1|5178333_5178726_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.3e-14
WP_042106866.1|5178851_5179124_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.4	4.2e-20
WP_042106855.1|5179107_5179629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174144565.1|5179609_5180587_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.4	2.1e-53
WP_174144567.1|5180593_5181334_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	87.2	3.4e-120
WP_174144568.1|5181363_5182080_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	60.7	3.4e-69
WP_174144570.1|5182112_5182394_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.4	8.8e-29
WP_077775875.1|5182390_5182696_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	9.8e-50
WP_032210929.1|5182843_5183026_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.5e-26
WP_106376306.1|5183085_5183313_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.3	1.0e-11
WP_042104970.1|5183309_5183657_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_072018695.1|5183659_5184151_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	9.8e-84
WP_042104972.1|5184299_5184731_+	hypothetical protein	NA	Q08J60	Stx2-converting_phage	40.2	9.7e-19
WP_052431191.1|5184727_5184916_+	hypothetical protein	NA	A0A0N7KZ94	Stx2-converting_phage	92.2	2.2e-20
WP_042104975.1|5184944_5185151_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	50.0	4.1e-07
WP_085948812.1|5185239_5186446_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
WP_042103068.1|5187163_5187517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042103066.1|5187576_5187876_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	90.9	2.6e-47
WP_042103064.1|5187881_5188139_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	3.3e-30
WP_042103070.1|5188274_5188553_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
WP_174144572.1|5188554_5189613_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	1.4e-90
WP_174144574.1|5189613_5189994_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	7.0e-37
WP_042102143.1|5189990_5190812_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.5	2.8e-83
WP_000917768.1|5191039_5191237_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_042105379.1|5191387_5192446_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.9	4.9e-189
WP_028985991.1|5192906_5193338_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	1.3e-66
WP_000216624.1|5193334_5193499_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_174144576.1|5193995_5195963_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	68.5	4.0e-253
WP_106894358.1|5196092_5196287_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	80.0	8.2e-18
WP_174144578.1|5196312_5196585_+	DUF826 domain-containing protein	NA	A0A0N7KZI7	Stx2-converting_phage	86.7	1.7e-16
5196420:5196436	attR	GCGTCTCGATGCGGAAG	NA	NA	NA	NA
WP_000284506.1|5196662_5196878_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_174144580.1|5196882_5197416_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	91.0	1.6e-92
WP_042106139.1|5197578_5197776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174144582.1|5197860_5198328_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	3.8e-69
WP_042106362.1|5198666_5198993_+	TonB family protein	NA	H6WZK5	Escherichia_phage	96.3	2.0e-53
WP_000095744.1|5199124_5199325_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_042106363.1|5199366_5199732_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	94.2	1.5e-60
