The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	0	45604	5023098	capsid,lysis,plate,portal,holin,head,tail,protease,terminase	Yersinia_virus(58.82%)	51	NA	NA
WP_001540303.1|0_2286_+	replication endonuclease	NA	Q858T4	Yersinia_virus	99.9	0.0e+00
WP_032141994.1|2285_2735_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	100.0	6.4e-82
WP_001540306.1|3222_4161_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_000688782.1|4161_5154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001540309.1|5140_6259_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	100.0	2.6e-172
WP_001540313.1|6634_7669_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	100.0	1.4e-201
WP_174165809.1|7668_9441_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|9614_10469_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001540318.1|10527_11601_+|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	100.0	1.3e-202
WP_001540320.1|11604_12348_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	100.0	9.8e-128
WP_000988628.1|12447_12957_+|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
WP_000846411.1|12956_13160_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	100.0	3.0e-31
WP_000123123.1|13163_13445_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|13444_13942_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001540323.1|13956_14382_+	hypothetical protein	NA	Q858W1	Yersinia_virus	100.0	3.2e-67
WP_001540324.1|14369_14795_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	100.0	5.0e-68
WP_072174950.1|14766_14940_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917151.1|14902_15370_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001786.1|15362_15815_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001540326.1|15881_16517_+|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	100.0	1.1e-114
WP_000127163.1|16513_16861_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121478.1|16865_17774_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285334.1|17766_18297_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	100.0	1.0e-102
WP_001540327.1|18307_21049_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	99.9	0.0e+00
WP_001540328.1|21052_21580_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	100.0	2.7e-95
WP_001540329.1|21731_22511_-	hypothetical protein	NA	Q858R7	Enterobacteria_phage	100.0	3.7e-117
WP_001540330.1|22911_24102_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	100.0	1.9e-226
WP_001540332.1|24114_24633_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	100.0	1.4e-93
WP_001031303.1|24690_24966_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_032668170.1|24998_25118_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	100.0	1.8e-15
WP_001540334.1|25110_27558_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	100.0	0.0e+00
WP_001540336.1|27572_28052_+|tail	phage tail protein	tail	Q858U6	Yersinia_virus	100.0	2.3e-85
WP_021517629.1|29295_29514_+	prophage transcriptional regulator OgrK	NA	Q858U4	Yersinia_virus	100.0	2.8e-38
WP_001076748.1|29749_30652_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001318165.1|30832_31795_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758726.1|32114_33104_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001298413.1|33210_33966_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|34020_34788_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802217.1|34895_35495_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|35595_36036_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|36247_36547_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|36573_37002_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796345.1|37006_37753_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|37849_38860_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|39030_40539_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|40561_41407_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|41831_42077_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|42161_42647_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|42739_43666_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|43732_45064_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|45073_45604_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	58274	62868	5023098		Pandoravirus(100.0%)	3	NA	NA
WP_001540354.1|58274_59825_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	4.4e-05
WP_000105536.1|60057_61182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694066.1|61314_62868_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
>prophage 3
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	69681	76928	5023098		Synechococcus_phage(33.33%)	5	NA	NA
WP_001540356.1|69681_70344_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	4.2e-29
WP_001540357.1|70355_72857_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|73165_74245_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|74259_74580_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184862.1|74630_76928_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 4
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	89072	90287	5023098		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691039.1|89072_90287_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 5
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	95727	97044	5023098		Burkholderia_virus(100.0%)	1	NA	NA
WP_000125464.1|95727_97044_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
>prophage 6
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	100441	102286	5023098		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591376.1|100441_102286_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 7
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	108778	112932	5023098		Bacillus_virus(50.0%)	4	NA	NA
WP_000078342.1|108778_109537_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001539875.1|109544_110648_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001539874.1|110657_111839_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|111906_112932_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 8
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	119436	120321	5023098		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001539870.1|119436_120321_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 9
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	125658	130171	5023098		Escherichia_phage(50.0%)	4	NA	NA
WP_000843962.1|125658_126489_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_097430592.1|126830_127685_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001298583.1|127720_128611_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001539864.1|128671_130171_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
>prophage 10
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	139458	140502	5023098		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|139458_140502_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 11
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	158153	159521	5023098	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001296452.1|158153_159521_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 12
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	163487	167498	5023098	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366127.1|163487_163985_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000074795.1|164092_164884_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|165005_165899_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108474.1|166007_167498_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 13
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	176201	190996	5023098		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001296449.1|176201_177131_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809780.1|177226_179563_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_000719791.1|179792_180446_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047069.1|180442_181171_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_174165811.1|181167_181800_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|182013_182286_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|182282_183137_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183674.1|183182_183674_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|183791_184079_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|184101_185535_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|185582_186308_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|186314_186872_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_001539833.1|186840_187416_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030015.1|187412_187979_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
WP_001295557.1|187999_188986_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922880.1|188999_189977_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|190186_190996_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 14
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	195064	196547	5023098		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|195064_195343_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047338.1|195575_196547_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 15
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	203176	206049	5023098	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|203176_205111_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|205200_206049_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 16
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	210129	216768	5023098		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|210129_211473_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|212103_212556_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|212583_214071_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133040.1|214095_216768_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 17
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	222249	224139	5023098		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|222249_224139_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 18
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	229841	237637	5023098		Peridroma_alphabaculovirus(25.0%)	10	NA	NA
WP_001539814.1|229841_230144_-	DNA damage response exodeoxyribonuclease YhbQ	NA	A0A068LKN9	Peridroma_alphabaculovirus	55.4	2.3e-14
WP_000449450.1|230194_230638_+	YhbP family protein	NA	NA	NA	NA	NA
WP_001346703.1|230617_231136_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000084526.1|231263_231899_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001539812.1|231971_233012_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|233124_233700_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|233709_234300_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246829.1|234319_234715_-	YraN family protein	NA	NA	NA	NA	NA
WP_001533640.1|234672_236709_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809263.1|236773_237637_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 19
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	255257	256403	5023098		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|255257_256403_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 20
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	262548	264843	5023098		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861710.1|262548_264843_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 21
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	290795	291761	5023098		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|290795_291761_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 22
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	304215	320362	5023098	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001539761.1|304215_307308_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	1.0e-157
WP_000212447.1|307491_308475_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|308693_309026_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|309067_310447_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_174165812.1|310864_312385_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	50.7	2.0e-34
WP_000018005.1|312491_313115_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001539754.1|313402_314167_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|314420_314927_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437380.1|315004_316846_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918828.1|317040_318786_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|318895_319111_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_097430496.1|319348_320362_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 23
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	326770	328009	5023098	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708511.1|326770_328009_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 24
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	333146	334580	5023098		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|333146_334580_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 25
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	338493	339147	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|338493_339147_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 26
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	345039	353117	5023098		Ralstonia_phage(25.0%)	8	NA	NA
WP_000442880.1|345039_346200_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	1.6e-87
WP_000831543.1|346205_346877_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735289.1|347024_348506_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|348710_349340_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|349340_349763_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444751.1|349787_350615_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|350614_351196_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195274.1|351224_353117_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
>prophage 27
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	364026	365816	5023098		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000940874.1|364026_364836_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_000986428.1|364832_365816_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
>prophage 28
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	373659	378699	5023098		Stx_converting_phage(50.0%)	4	NA	NA
WP_000712658.1|373659_374052_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183491.1|374104_374587_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_045233254.1|374695_376303_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001539719.1|376440_378699_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	1.1e-84
>prophage 29
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	386157	393476	5023098		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_001539716.1|386157_387630_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.6e-47
WP_000438650.1|387952_388702_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_001539714.1|388953_391173_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	3.0e-103
WP_000848528.1|391214_391472_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001539712.1|391522_392449_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013152.1|392648_393476_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
>prophage 30
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	399319	400204	5023098		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|399319_400204_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 31
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	422379	423552	5023098		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|422379_423552_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 32
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	470328	537095	5023098	transposase,protease,integrase	Pseudomonas_phage(14.29%)	49	520367:520382	546652:546667
WP_001296394.1|470328_471312_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_000174401.1|472689_474189_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_021528665.1|475178_476072_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000208382.1|476064_476460_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001529401.1|476528_477374_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839293.1|477458_477656_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761699.1|477672_478161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854690.1|478157_478535_-	toxin	NA	NA	NA	NA	NA
WP_001305076.1|478623_478992_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000094916.1|479041_479686_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
WP_000692329.1|479704_479926_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|479988_480465_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849565.1|480480_480966_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_160521617.1|481020_481839_-	DUF932 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	5.7e-44
WP_000902034.1|481939_482173_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581502.1|482251_482707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000820373.1|484004_487127_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069668.1|487460_488333_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001305029.1|489664_491155_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001296389.1|491275_491848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309742.1|491933_492194_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071528377.1|493087_493237_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_174165814.1|493568_493757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174165815.1|495074_495191_+	malate transporter	NA	NA	NA	NA	NA
WP_000624646.1|497966_498317_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|498313_498739_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|499110_499248_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001149834.1|499399_500317_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|500350_501226_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|501274_502747_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|502750_503581_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|503626_504337_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|504349_505459_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001305022.1|505508_506444_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|506479_507214_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|507313_508300_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_103103189.1|508451_509679_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|510179_512270_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001296383.1|513131_513374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529396.1|513664_514033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|514036_514252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|519032_520184_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
520367:520382	attL	GCGGCGGTAACCCATT	NA	NA	NA	NA
WP_001034083.1|521557_525445_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_011076574.1|525694_525838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973516.1|526388_528590_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_097430647.1|528671_529949_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001774069.1|532285_532837_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000147017.1|534530_535574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174165816.1|535829_537095_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.2e-77
546652:546667	attR	GCGGCGGTAACCCATT	NA	NA	NA	NA
>prophage 33
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	559780	560935	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|559780_560935_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 34
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	568976	569885	5023098		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|568976_569885_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 35
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	574936	575614	5023098		Bacillus_virus(100.0%)	1	NA	NA
WP_000956878.1|574936_575614_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	9.9e-10
>prophage 36
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	589108	590341	5023098		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|589108_590341_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 37
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	598477	602950	5023098		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195072.1|598477_601351_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
WP_001339296.1|601516_602950_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 38
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	606755	622147	5023098	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|606755_607652_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715230.1|607676_608387_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813189.1|608392_610126_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_001701073.1|610216_611314_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|611324_612842_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192796.1|612884_613433_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|613487_613559_+	protein YqfH	NA	NA	NA	NA	NA
WP_001539548.1|613555_613681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539546.1|613682_615131_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	1.9e-26
WP_001363023.1|615566_617486_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001539543.1|617485_617974_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012167.1|618009_619377_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_001539542.1|619412_620729_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|620746_622147_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 39
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	646426	647182	5023098		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|646426_647182_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 40
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	651467	653962	5023098		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|651467_652229_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_001556805.1|652543_653962_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	3.0e-24
>prophage 41
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	663593	670366	5023098		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|663593_664307_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_097430515.1|664375_665065_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|665749_666280_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|666292_668539_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|668689_669565_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|669571_670366_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 42
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	675843	692458	5023098		Bacillus_phage(28.57%)	10	NA	NA
WP_001138105.1|675843_678732_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.5e-67
WP_001539517.1|678724_682267_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	2.6e-08
WP_001539515.1|682266_684093_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.3	7.8e-25
WP_174165818.1|684154_685486_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|685717_686971_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000582830.1|687228_688053_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810554.1|688084_689665_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000382417.1|689664_690840_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066226.1|690842_691439_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_001350145.1|691510_692458_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
>prophage 43
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	708535	718048	5023098		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_021522217.1|708535_711052_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-19
WP_001556812.1|711308_712148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539493.1|712159_712900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001556813.1|712892_715403_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	6.7e-19
WP_001539489.1|715414_718048_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	6.4e-97
>prophage 44
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	726878	729384	5023098	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000117711.1|726878_727685_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.4e-15
WP_000184273.1|727735_728179_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001490456.1|728178_729384_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.7e-74
>prophage 45
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	740959	741715	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|740959_741715_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 46
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	746573	747422	5023098		Vibrio_phage(100.0%)	1	NA	NA
WP_000100429.1|746573_747422_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 47
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	754954	759069	5023098		Hokovirus(50.0%)	2	NA	NA
WP_000186448.1|754954_757711_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046817.1|757767_759069_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 48
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	763102	766126	5023098		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000210878.1|763102_764740_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|764827_766126_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 49
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	769923	773122	5023098		Vibrio_phage(50.0%)	3	NA	NA
WP_001199974.1|769923_770595_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001232702.1|770679_771687_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001334220.1|771712_773122_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.7	7.3e-15
>prophage 50
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	780422	781208	5023098		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|780422_781208_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 51
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	795857	797890	5023098		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|795857_797285_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173653.1|797284_797890_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
>prophage 52
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	801001	804717	5023098		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|801001_801763_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254701.1|801756_802383_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|802522_803662_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081519.1|803724_804717_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	1.4e-31
>prophage 53
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	809090	816230	5023098		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|809090_809729_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_001539448.1|809725_810988_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|810984_811893_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001298167.1|812088_812856_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141302.1|812906_813563_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001539446.1|813668_816230_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
>prophage 54
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	835750	836761	5023098		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024186854.1|835750_836761_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	5.1e-26
>prophage 55
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	844332	845298	5023098		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|844332_845298_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 56
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	850766	856153	5023098	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132236.1|850766_851264_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	2.6e-31
WP_000963143.1|851343_852405_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|852473_852974_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047170.1|853102_855733_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|855967_856153_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 57
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	860764	861223	5023098	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000526115.1|860764_861223_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 58
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	869545	874843	5023098		Bacillus_virus(20.0%)	5	NA	NA
WP_000985490.1|869545_870748_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777941.1|871104_872064_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	9.1e-134
WP_001539410.1|872073_874218_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.6e-194
WP_000080947.1|874190_874601_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|874597_874843_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 59
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	880060	884111	5023098		Clostridium_phage(50.0%)	4	NA	NA
WP_001539402.1|880060_880510_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	2.6e-06
WP_001357560.1|880510_881173_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001298180.1|881193_882594_-	GABA permease	NA	NA	NA	NA	NA
WP_001556824.1|882830_884111_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	2.2e-34
>prophage 60
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	889119	889602	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|889119_889602_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 61
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	903235	904306	5023098		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|903235_904306_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 62
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	910211	912785	5023098		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001539382.1|910211_912785_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
>prophage 63
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	927860	933943	5023098	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|927860_928280_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997418.1|928486_929524_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262708.1|929571_930261_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	9.3e-56
WP_000627807.1|930565_930949_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189208.1|931004_931592_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001298616.1|931694_932576_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174165822.1|932608_933943_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 64
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	939714	943456	5023098		Tupanvirus(50.0%)	3	NA	NA
WP_000790169.1|939714_941514_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|941529_942504_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|942775_943456_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 65
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	946915	947176	5023098		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|946915_947176_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 66
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	951295	962604	5023098		Bacillus_phage(50.0%)	7	NA	NA
WP_001557119.1|951295_955183_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
WP_001297612.1|955758_957186_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215879.1|957350_958064_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001539367.1|958053_959388_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|959448_959787_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883120.1|959831_961022_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|961350_962604_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 67
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	968362	969874	5023098		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493464.1|968362_969874_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 68
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	979992	986330	5023098		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|979992_981207_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|981234_981621_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|981637_981961_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|982056_982572_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_113495810.1|982588_984439_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	1.4e-103
WP_001124471.1|984440_984776_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523612.1|984787_984988_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001539348.1|985046_986330_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 69
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	996216	996648	5023098		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|996216_996648_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 70
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1017128	1023617	5023098		Escherichia_phage(66.67%)	7	NA	NA
WP_001539338.1|1017128_1018505_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.0e-41
WP_001296289.1|1018666_1020133_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1020201_1021779_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|1021871_1022411_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001311989.1|1022426_1022945_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|1023255_1023447_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017558.1|1023464_1023617_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	1.9e-17
>prophage 71
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1029864	1033866	5023098		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028626.1|1029864_1030503_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296287.1|1030502_1031540_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001295473.1|1031864_1032491_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|1032576_1033866_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 72
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1041345	1042059	5023098		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1041345_1042059_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 73
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1059300	1060251	5023098		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1059300_1060251_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 74
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1079166	1100894	5023098		Streptococcus_phage(25.0%)	22	NA	NA
WP_000102910.1|1079166_1080036_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|1080249_1080675_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001539298.1|1080661_1081111_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838948.1|1081171_1081747_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|1081842_1082742_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001040459.1|1082919_1084344_-	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001539296.1|1084347_1085244_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000517443.1|1085523_1086315_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290263.1|1086472_1087489_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458408.1|1087488_1088322_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|1088321_1089197_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021034.1|1089186_1090284_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_001539293.1|1090418_1091330_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719965.1|1091332_1091701_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096640.1|1091805_1092657_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1092699_1093209_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1093249_1094977_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1095021_1095279_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1095662_1096634_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|1096818_1097580_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001539289.1|1097809_1098808_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_001539287.1|1098878_1100894_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
>prophage 75
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1126546	1127281	5023098		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1126546_1127281_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 76
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1131098	1132019	5023098		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|1131098_1132019_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 77
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1135708	1143285	5023098		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283506.1|1135708_1137403_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	8.0e-24
WP_000955028.1|1137472_1138417_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296273.1|1138490_1139636_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001305203.1|1139691_1143285_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 78
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1149925	1151359	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_000194520.1|1149925_1151359_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.4	1.5e-28
>prophage 79
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1154397	1155330	5023098		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001539260.1|1154397_1155330_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	98.7	3.9e-166
>prophage 80
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1171786	1172872	5023098		Pandoravirus(100.0%)	1	NA	NA
WP_001374741.1|1171786_1172872_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	7.7e-89
>prophage 81
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1181408	1182545	5023098		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699143.1|1181408_1182545_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.3e-22
>prophage 82
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1189294	1190812	5023098		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1189294_1190812_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 83
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1195023	1196883	5023098		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|1195023_1195797_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156131.1|1195992_1196883_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
>prophage 84
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1207442	1210670	5023098		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203415.1|1207442_1208093_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
WP_001012899.1|1208179_1210012_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813854.1|1210070_1210670_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 85
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1243985	1248989	5023098		Tupanvirus(50.0%)	4	NA	NA
WP_001539159.1|1243985_1245968_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_000461633.1|1245967_1246936_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_097430487.1|1246939_1248079_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000879110.1|1248386_1248989_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 86
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1252592	1257007	5023098	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001297916.1|1252592_1253798_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	2.5e-27
WP_097430488.1|1253854_1255000_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992976.1|1255017_1255821_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150331.1|1255861_1256083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140604.1|1256095_1257007_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	7.4e-69
>prophage 87
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1262899	1276818	5023098		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779092.1|1262899_1263976_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301034.1|1264178_1264829_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|1264882_1265137_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|1265136_1266267_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|1266456_1268742_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_024187242.1|1269423_1273182_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	4.4e-22
WP_000990769.1|1273321_1274044_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281253.1|1274190_1276818_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 88
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1291741	1296584	5023098		Bacillus_phage(50.0%)	2	NA	NA
WP_001296244.1|1291741_1293568_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
WP_000876057.1|1293734_1296584_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.9e-41
>prophage 89
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1300861	1306663	5023098		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001539019.1|1300861_1301989_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.9	3.2e-114
WP_001539017.1|1302100_1303156_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_001539016.1|1303229_1304294_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_097430490.1|1304293_1304944_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_174165824.1|1305019_1306663_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	9.5e-14
>prophage 90
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1315421	1316039	5023098		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|1315421_1316039_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 91
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1325942	1333591	5023098		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|1325942_1326950_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|1327088_1327373_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_001539001.1|1327497_1329258_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	2.2e-101
WP_001234850.1|1329407_1330103_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213379.1|1330130_1331321_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_000188242.1|1331653_1331998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194894.1|1332001_1333591_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
>prophage 92
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1339345	1343646	5023098		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|1339345_1339912_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_097430491.1|1340323_1341037_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198798.1|1341075_1342062_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_097430492.1|1342179_1343646_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
>prophage 93
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1357034	1357892	5023098		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1357034_1357892_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 94
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1361960	1365746	5023098		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489277.1|1361960_1363952_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
WP_000425463.1|1363983_1364820_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|1365077_1365746_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 95
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1369440	1370961	5023098		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|1369440_1370961_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 96
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1391311	1400756	5023098		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001538980.1|1391311_1392238_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_001538978.1|1392242_1392974_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1392954_1393062_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|1393121_1393853_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|1394074_1395760_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1395756_1396476_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1396522_1396993_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1397033_1397495_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001538974.1|1397619_1399623_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001538973.1|1399619_1400756_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 97
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1413539	1415573	5023098	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001538964.1|1413539_1415573_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 98
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1426222	1429779	5023098		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001538956.1|1426222_1427041_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	7.2e-23
WP_000434049.1|1427092_1427839_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011944.1|1427812_1428778_-	sugar kinase	NA	NA	NA	NA	NA
WP_001538954.1|1428774_1429779_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.4e-14
>prophage 99
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1438918	1445021	5023098	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_001538947.1|1438918_1439818_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.7	7.5e-13
WP_001361579.1|1440232_1440550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476012.1|1440878_1442240_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_001300972.1|1442386_1442719_-	YegP family protein	NA	NA	NA	NA	NA
WP_001538945.1|1442898_1443621_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.4e-30
WP_000675178.1|1443617_1445021_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 100
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1458128	1459481	5023098		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001538937.1|1458128_1459481_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	9.2e-07
>prophage 101
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1464207	1474428	5023098		Catovirus(40.0%)	9	NA	NA
WP_001295424.1|1464207_1464849_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|1464940_1465522_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001538933.1|1465543_1467397_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454700.1|1467464_1469048_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|1469248_1469398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978098.1|1469706_1470846_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|1470851_1471295_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_001538931.1|1471297_1473460_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_001538930.1|1473588_1474428_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
>prophage 102
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1478672	1483903	5023098		Synechococcus_phage(33.33%)	5	NA	NA
WP_000048190.1|1478672_1479794_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043612.1|1479796_1480762_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	1.3e-87
WP_024186851.1|1480764_1481244_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001538926.1|1481240_1482464_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001538925.1|1482466_1483903_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	2.8e-46
>prophage 103
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1487206	1490028	5023098		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_001538922.1|1487206_1488613_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000704862.1|1488861_1490028_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
>prophage 104
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1497470	1498370	5023098		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131779.1|1497470_1498370_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 105
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1504567	1505734	5023098		Stx2-converting_phage(100.0%)	1	NA	NA
WP_115766480.1|1504567_1505734_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.7e-227
>prophage 106
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1521644	1522454	5023098		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000049.1|1521644_1522454_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.0	5.9e-09
>prophage 107
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1532217	1532973	5023098		Escherichia_phage(100.0%)	1	NA	NA
WP_000281586.1|1532217_1532973_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.9	1.3e-18
>prophage 108
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1538904	1539123	5023098		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_000250490.1|1538904_1539123_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	1.9e-07
>prophage 109
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1558086	1564484	5023098	integrase	Erysipelothrix_phage(66.67%)	3	1553971:1553984	1570283:1570296
1553971:1553984	attL	ATTATTTTTTATAA	NA	NA	NA	NA
WP_000766113.1|1558086_1561047_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	38.4	1.5e-163
WP_000724528.1|1561056_1563033_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	38.4	5.5e-109
WP_000059629.1|1563212_1564484_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.7	2.2e-71
1570283:1570296	attR	TTATAAAAAATAAT	NA	NA	NA	NA
>prophage 110
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1583979	1593471	5023098		Paenibacillus_phage(100.0%)	1	NA	NA
WP_174165831.1|1583979_1593471_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	4.7e-49
>prophage 111
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1601072	1611503	5023098	integrase	Bacillus_phage(50.0%)	8	1588618:1588632	1615039:1615053
1588618:1588632	attL	CAGTTGCCCGGCATC	NA	NA	NA	NA
WP_001313954.1|1601072_1602785_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.8	1.8e-31
WP_001304269.1|1602771_1604574_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286281.1|1604566_1605847_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703047.1|1605874_1607179_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_024186847.1|1607372_1608635_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	1.5e-72
WP_001325918.1|1608972_1609770_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001773978.1|1610231_1611068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001773977.1|1611284_1611503_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
1615039:1615053	attR	GATGCCGGGCAACTG	NA	NA	NA	NA
>prophage 112
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1615553	1616381	5023098		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_174165832.1|1615553_1616381_-	restriction endonuclease	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	28.7	6.6e-16
>prophage 113
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1635252	1639155	5023098	transposase,integrase	Shigella_phage(50.0%)	3	1637366:1637379	1640390:1640403
WP_085949154.1|1635252_1636400_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_174165833.1|1637343_1637790_-	VOC family protein	NA	NA	NA	NA	NA
1637366:1637379	attL	CAGATAAAACCAAA	NA	NA	NA	NA
WP_001773946.1|1637934_1639155_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	7.4e-80
WP_001773946.1|1637934_1639155_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	7.4e-80
1640390:1640403	attR	TTTGGTTTTATCTG	NA	NA	NA	NA
>prophage 114
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1643205	1655574	5023098		Bacillus_phage(33.33%)	12	NA	NA
WP_001347103.1|1643205_1643877_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826707.1|1643876_1645235_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_174165834.1|1645342_1646194_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824392.1|1646789_1647848_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.5e-92
WP_001330593.1|1648412_1648778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298512.1|1648817_1649513_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_174165835.1|1649579_1650998_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|1650978_1651449_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212226.1|1651437_1652358_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_001773945.1|1652530_1653448_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|1653526_1653709_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_097430582.1|1653879_1655574_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
>prophage 115
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1671901	1674166	5023098		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000737290.1|1671901_1672984_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
WP_001538888.1|1673497_1674166_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.4e-80
>prophage 116
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1685967	1686720	5023098		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|1685967_1686720_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 117
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1698713	1700228	5023098		Cedratvirus(100.0%)	1	NA	NA
WP_001538880.1|1698713_1700228_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	7.4e-13
>prophage 118
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1710315	1714584	5023098		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001313042.1|1710315_1711977_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_001533408.1|1712267_1713128_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036385.1|1713130_1714180_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763860.1|1714194_1714584_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
>prophage 119
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1719111	1720845	5023098	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|1719111_1720845_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 120
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1727460	1729511	5023098		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|1727460_1728204_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1728244_1728640_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639272.1|1728692_1729511_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 121
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1733404	1740465	5023098		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|1733404_1733926_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024913.1|1733927_1734530_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|1734599_1734665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1734803_1735415_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1735423_1736434_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|1736578_1737364_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1737360_1738116_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001347089.1|1738194_1739127_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1739142_1740465_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 122
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1744463	1745939	5023098		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1744463_1745939_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 123
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1753995	1758464	5023098		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|1753995_1754658_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011664.1|1754681_1755338_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1755439_1755670_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|1755808_1756183_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879311.1|1756186_1757059_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000984819.1|1757071_1757413_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812744.1|1757807_1758464_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	6.8e-56
>prophage 124
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1765961	1768010	5023098		Moraxella_phage(100.0%)	1	NA	NA
WP_115766462.1|1765961_1768010_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 125
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1773342	1773552	5023098		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1773342_1773552_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 126
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1779192	1780749	5023098		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1779192_1780749_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 127
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1784611	1792717	5023098	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000855012.1|1784611_1785973_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.5e-41
WP_000457334.1|1786046_1786226_+	YoaH family protein	NA	NA	NA	NA	NA
WP_097430523.1|1786345_1786705_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1787066_1787411_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128855.1|1787542_1789453_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	3.8e-91
WP_001220981.1|1789510_1790206_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_097430522.1|1790245_1790827_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_077572252.1|1791031_1792717_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 128
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1801684	1806261	5023098		Bacillus_phage(100.0%)	3	NA	NA
WP_001298230.1|1801684_1803175_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621384.1|1803355_1804831_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001538829.1|1804977_1806261_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 129
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1809579	1810434	5023098		Indivirus(100.0%)	1	NA	NA
WP_001296125.1|1809579_1810434_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 130
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1819247	1823333	5023098		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723717.1|1819247_1820228_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
WP_000719088.1|1820364_1821123_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001357805.1|1821240_1822599_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135068.1|1822691_1823333_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 131
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1828259	1832273	5023098		Streptococcus_phage(50.0%)	2	NA	NA
WP_001538825.1|1828259_1830206_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
WP_001538824.1|1830572_1832273_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	38.8	6.2e-93
>prophage 132
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1838582	1839236	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_001538821.1|1838582_1839236_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	1.5e-10
>prophage 133
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1845999	1847220	5023098		Klosneuvirus(100.0%)	1	NA	NA
WP_001538818.1|1845999_1847220_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 134
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1854696	1855524	5023098		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|1854696_1855524_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 135
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1861650	1863912	5023098		Tupanvirus(100.0%)	1	NA	NA
WP_001538813.1|1861650_1863912_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 136
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1873288	1928072	5023098	capsid,plate,portal,holin,integrase,head,tail,tRNA,terminase	Enterobacteria_phage(74.47%)	64	1880624:1880648	1915869:1915893
WP_001144202.1|1873288_1875217_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|1875220_1875763_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1875859_1876057_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1876109_1876466_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1876588_1876633_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_001538809.1|1876916_1877900_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672319.1|1877914_1880302_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|1880306_1880606_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1880624:1880648	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|1880907_1881048_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|1881238_1881499_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000965749.1|1881818_1882901_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_174165839.1|1882992_1884102_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	3.4e-193
WP_115766467.1|1884258_1885443_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.2	4.2e-221
WP_000290450.1|1885442_1885955_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1886009_1886375_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|1886383_1886539_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_115766468.1|1886525_1889330_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.2	0.0e+00
WP_001546053.1|1889342_1889801_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	77.3	3.3e-65
WP_001546052.1|1890620_1890905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117004424.1|1890907_1893754_-|tail	phage tail protein	tail	A0A0A0YPY9	Escherichia_phage	76.6	0.0e+00
WP_174165840.1|1893756_1894296_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	64.4	2.1e-63
WP_094322978.1|1894288_1895185_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	71.8	1.2e-111
WP_024176116.1|1895171_1895537_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	67.5	2.5e-39
WP_153782158.1|1895533_1896100_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	86.2	3.6e-90
WP_000356348.1|1896111_1896747_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920594.1|1896739_1897207_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_057728660.1|1897344_1897752_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	2.5e-64
WP_001532941.1|1897748_1898294_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.2	8.3e-92
WP_000104344.1|1898348_1898672_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	4.8e-47
WP_000864901.1|1898674_1898875_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_174165841.1|1898874_1899369_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_094322980.1|1899470_1900271_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.9	4.2e-132
WP_094322981.1|1900316_1901369_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.9	1.5e-193
WP_033550443.1|1901392_1902229_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	1.1e-148
WP_115766470.1|1902383_1904135_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|1904134_1905181_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000711112.1|1905710_1906241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115766458.1|1906331_1906715_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	61.1	3.4e-31
WP_000211245.1|1906778_1907090_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	2.2e-49
WP_115766457.1|1907094_1908054_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	3.4e-181
WP_162828176.1|1908130_1910953_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.6	0.0e+00
WP_024230413.1|1910959_1911325_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	4.3e-60
WP_024230414.1|1911466_1911712_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	87.7	5.5e-35
WP_000985159.1|1911708_1911912_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021664.1|1911999_1912113_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	3.1e-09
WP_000514277.1|1912109_1912352_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|1912363_1912642_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000917790.1|1912652_1912991_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	4.9e-50
WP_174165842.1|1913005_1913284_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000021113.1|1913379_1913691_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	1.2e-18
WP_001247210.1|1913779_1914718_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000403443.1|1914720_1915221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032172242.1|1915321_1915759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956502.1|1915951_1916932_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1915869:1915893	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154199.1|1916993_1917545_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029464.1|1917544_1918294_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|1918371_1918836_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001298229.1|1919082_1919796_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001538808.1|1919858_1921295_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001313872.1|1921298_1921490_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|1921621_1922668_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|1922824_1923658_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_097430511.1|1923990_1926369_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	3.2e-172
WP_001538806.1|1926425_1928072_-	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.9	2.6e-19
>prophage 137
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1946545	1951629	5023098		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367169.1|1946545_1946914_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
WP_001304330.1|1946922_1948410_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948882.1|1948419_1949166_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000907966.1|1949140_1950412_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001538803.1|1950408_1951629_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	7.6e-93
>prophage 138
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1959919	1962186	5023098		Escherichia_phage(50.0%)	3	NA	NA
WP_001362847.1|1959919_1960588_+	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
WP_001538799.1|1960584_1961370_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587583.1|1961373_1962186_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 139
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1967692	1976484	5023098		Orpheovirus(20.0%)	9	NA	NA
WP_000493948.1|1967692_1968334_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|1968373_1969522_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182336.1|1969812_1971024_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_001538795.1|1971136_1972069_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|1972065_1973091_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|1973389_1973479_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701050.1|1973644_1974814_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|1974959_1975541_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101199.1|1975668_1976484_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 140
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1980899	1982398	5023098		Indivirus(50.0%)	2	NA	NA
WP_174165844.1|1980899_1981796_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	31.3	2.1e-07
WP_001298528.1|1981876_1982398_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 141
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	1989309	1990584	5023098	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1989309_1990584_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 142
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2010376	2012188	5023098		Vaccinia_virus(100.0%)	1	NA	NA
WP_001538788.1|2010376_2012188_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 143
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2022083	2023385	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_001538783.1|2022083_2023385_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.9	5.0e-18
>prophage 144
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2041147	2056584	5023098		Escherichia_phage(44.44%)	14	NA	NA
WP_000148695.1|2041147_2041762_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_000526500.1|2041804_2042659_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001538777.1|2042660_2043278_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_097430512.1|2043288_2045712_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	8.3e-208
WP_001538775.1|2045772_2048199_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.3e-213
WP_000778146.1|2048397_2048703_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001350228.1|2048810_2049521_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2049523_2050084_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705201.1|2050118_2050460_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2050594_2050921_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_079399061.1|2051126_2052341_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	3.1e-46
WP_000836075.1|2052352_2053372_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001538772.1|2054884_2056345_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.1e-42
WP_115210544.1|2056380_2056584_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	4.6e-11
>prophage 145
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2060971	2061862	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_000592831.1|2060971_2061862_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 146
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2069254	2071384	5023098		Pandoravirus(50.0%)	3	NA	NA
WP_001538766.1|2069254_2070694_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
WP_000803536.1|2070750_2070969_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091198.1|2071000_2071384_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 147
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2078127	2079546	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_000558456.1|2078127_2079546_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 148
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2104774	2107174	5023098		Klosneuvirus(100.0%)	1	NA	NA
WP_001538754.1|2104774_2107174_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	20.9	4.6e-09
>prophage 149
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2110581	2112340	5023098		Escherichia_phage(66.67%)	3	NA	NA
WP_000642412.1|2110581_2111592_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
WP_000605675.1|2111777_2112056_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000781370.1|2112055_2112340_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 150
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2123764	2125309	5023098		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|2123764_2125309_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 151
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2130482	2132813	5023098		Ralstonia_phage(100.0%)	1	NA	NA
WP_174165848.1|2130482_2132813_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.1e-23
>prophage 152
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2137980	2139945	5023098		Ralstonia_phage(100.0%)	1	NA	NA
WP_124072105.1|2137980_2139945_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	1.9e-24
>prophage 153
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2144600	2146673	5023098		Salmonella_phage(100.0%)	1	NA	NA
WP_171274529.1|2144600_2146673_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	1.8e-134
>prophage 154
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2152169	2153183	5023098		Mycoplasma_phage(100.0%)	1	NA	NA
WP_174165850.1|2152169_2153183_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	6.0e-27
>prophage 155
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2156812	2158774	5023098		Phage_TP(100.0%)	1	NA	NA
WP_001350247.1|2156812_2158774_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 156
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2171946	2172895	5023098		Moraxella_phage(50.0%)	2	NA	NA
WP_000731859.1|2171946_2172120_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001350640.1|2172364_2172895_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 157
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2176835	2180738	5023098		Klosneuvirus(100.0%)	1	NA	NA
WP_000139619.1|2176835_2180738_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 158
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2198807	2199797	5023098		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2198807_2199797_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 159
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2204756	2214177	5023098	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_001538721.1|2204756_2205890_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	53.8	4.4e-103
WP_001295593.1|2206030_2206465_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157412.1|2208791_2209727_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_097430586.1|2209855_2211229_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	3.3e-52
WP_000387388.1|2211706_2212690_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_097430585.1|2212944_2214177_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	1.8e-17
>prophage 160
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2219492	2220008	5023098		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945019.1|2219492_2220008_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 161
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2237233	2238316	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|2237233_2238316_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 162
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2257616	2259634	5023098		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|2257616_2258423_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135019.1|2258470_2259634_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	2.8e-28
>prophage 163
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2268574	2270509	5023098		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|2268574_2270509_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 164
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2278322	2278913	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|2278322_2278913_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 165
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2283823	2289115	5023098	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001304419.1|2283823_2286421_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|2286800_2287052_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422063.1|2287087_2288137_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_174165854.1|2288356_2289115_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
>prophage 166
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2296080	2299038	5023098		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763537.1|2296080_2297676_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001538690.1|2297679_2299038_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
>prophage 167
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2309001	2311016	5023098		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|2309001_2310006_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110950.1|2310002_2311016_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 168
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2320582	2331912	5023098	transposase	Citrobacter_phage(20.0%)	11	NA	NA
WP_000068076.1|2320582_2321200_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|2321803_2322217_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718993.1|2322360_2323269_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.1e-59
WP_001538656.1|2323470_2324484_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_024186830.1|2324575_2325481_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001538653.1|2325593_2326052_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|2326101_2326944_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001111618.1|2327737_2328937_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.5	1.2e-138
WP_001160110.1|2328989_2329667_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571681.1|2329666_2330377_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702647.1|2330373_2331912_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 169
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2343031	2349300	5023098		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|2343031_2343262_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063608.1|2343531_2344632_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170954.1|2345037_2345145_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|2345292_2346147_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257054.1|2346182_2346992_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|2346995_2347388_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456474.1|2347384_2348218_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|2348217_2349300_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 170
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2352436	2355188	5023098		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|2352436_2353384_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033350.1|2353508_2355188_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
>prophage 171
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2367634	2368393	5023098		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001538640.1|2367634_2368393_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.6e-14
>prophage 172
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2384421	2386109	5023098		Salmonella_phage(50.0%)	2	NA	NA
WP_000457596.1|2384421_2385690_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
WP_000897376.1|2385689_2386109_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
>prophage 173
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2399142	2491628	5023098	lysis,transposase,capsid,portal,holin,integrase,head,tail,tRNA,terminase	Enterobacteria_phage(42.65%)	97	2418672:2418687	2494580:2494595
WP_000332315.1|2399142_2399874_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	1.6e-53
WP_000373104.1|2400094_2400499_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_001445545.1|2400551_2400677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|2400760_2400913_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001256622.1|2401840_2402755_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983702.1|2402754_2403582_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
WP_001101732.1|2403578_2404436_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968127.1|2404432_2405290_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000654168.1|2405687_2405966_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001538630.1|2405962_2408023_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_050575893.1|2408081_2411492_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000839596.1|2411671_2411887_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2412476_2413559_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2413747_2414131_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2414216_2414357_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001538628.1|2414353_2414716_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000774478.1|2414712_2415003_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_000224907.1|2414995_2415166_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053004.1|2415165_2415621_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|2415617_2415719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2416068_2417112_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_174165856.1|2417148_2421057_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
2418672:2418687	attL	CAGCCAATGCATTATT	NA	NA	NA	NA
WP_001538625.1|2421305_2422007_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_001538622.1|2423260_2424337_-|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001556896.1|2427060_2427918_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_174165857.1|2427917_2429435_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	52.8	2.4e-144
WP_000526115.1|2429927_2430386_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000444487.1|2430582_2431833_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248679.1|2432004_2432658_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2432667_2433129_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2433182_2434289_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|2434324_2434966_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2434969_2436340_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2436509_2437181_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2437180_2438641_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_097430646.1|2438716_2439838_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2439886_2441113_-	peptidase T	NA	NA	NA	NA	NA
WP_000531578.1|2441362_2442499_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001538615.1|2442482_2443346_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
WP_000937496.1|2443578_2443845_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000240999.1|2443901_2444570_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|2444624_2445209_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_174165858.1|2445208_2448238_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.5	1.2e-54
WP_174165859.1|2448302_2448902_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_174165860.1|2448969_2452662_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_032300536.1|2452912_2453545_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_097430666.1|2453490_2454234_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_174165861.1|2454244_2454943_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	2.1e-127
WP_000847298.1|2454942_2455272_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_174165862.1|2455268_2457830_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.9	0.0e+00
WP_000533402.1|2457810_2458224_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|2458250_2458682_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_016234254.1|2458700_2459447_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_000683079.1|2459454_2459850_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|2459846_2460422_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_001204571.1|2460437_2460791_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201498.1|2460783_2461167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522592.1|2461218_2462247_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256835.1|2462304_2462652_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001253953.1|2462688_2464194_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_001537684.1|2464183_2465776_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_000258993.1|2465772_2465979_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001537733.1|2465962_2467891_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	9.4e-263
WP_000235436.1|2467862_2468372_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000881609.1|2468986_2469124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2469330_2469657_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_064773083.1|2469967_2470435_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	85.1	3.0e-66
WP_001280932.1|2470437_2470569_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_074161156.1|2470583_2470766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|2470922_2471456_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_063267343.1|2471492_2472383_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.3	2.3e-107
WP_000284506.1|2472387_2472603_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|2472679_2472925_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|2472962_2473145_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538589.1|2473281_2475243_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	4.3e-239
WP_001336019.1|2475503_2475839_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_000562553.1|2476119_2476251_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_097430665.1|2477923_2478745_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	9.3e-79
WP_000140012.1|2478741_2479122_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.5e-34
WP_115766526.1|2479122_2480178_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	8.9e-90
WP_023141427.1|2480179_2480452_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2480619_2480775_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000403785.1|2482139_2482496_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2482553_2482976_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2483016_2484087_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693949.1|2484158_2484584_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2484580_2484796_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103685.1|2484845_2485562_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.0e-52
WP_000379589.1|2485834_2485990_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_097430659.1|2486149_2486368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097430660.1|2486390_2486765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148810.1|2486750_2486897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2487305_2487494_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2487490_2487679_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097430596.1|2487771_2490210_+	exonuclease	NA	V5UQJ3	Shigella_phage	45.0	2.3e-112
WP_000003742.1|2490271_2490541_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2490509_2491628_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2494580:2494595	attR	AATAATGCATTGGCTG	NA	NA	NA	NA
>prophage 174
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2495073	2498796	5023098		Vibrio_phage(50.0%)	4	NA	NA
WP_001538573.1|2495073_2495895_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	3.3e-23
WP_000291301.1|2495910_2496822_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251368.1|2496850_2498095_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001538569.1|2498094_2498796_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	2.4e-35
>prophage 175
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2506082	2506340	5023098		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2506082_2506340_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 176
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2518664	2520307	5023098		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267913.1|2518664_2519669_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	40.0	6.4e-05
WP_001257002.1|2519665_2520307_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 177
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2523579	2524761	5023098		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2523579_2523816_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|2524026_2524761_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 178
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2537117	2538059	5023098		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001305885.1|2537117_2538059_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 179
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2553939	2554185	5023098		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2553939_2554185_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 180
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2558847	2562502	5023098	transposase	Morganella_phage(50.0%)	5	NA	NA
WP_001295958.1|2558847_2559768_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
WP_000074171.1|2559939_2561166_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_001295957.1|2561248_2561623_+	SecY/SecA suppressor protein	NA	NA	NA	NA	NA
WP_001237186.1|2561623_2561851_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_000526115.1|2562043_2562502_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 181
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2569787	2570321	5023098		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_001556884.1|2569787_2570321_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 182
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2574457	2575291	5023098		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2574457_2575291_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 183
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2578681	2580049	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_001556883.1|2578681_2580049_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 184
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2586868	2587657	5023098		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|2586868_2587657_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 185
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2602254	2604354	5023098		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028102.1|2602254_2602749_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	5.5e-50
WP_001298362.1|2602769_2604098_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
WP_001273658.1|2604180_2604354_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 186
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2607384	2619903	5023098		Klosneuvirus(20.0%)	13	NA	NA
WP_000420625.1|2607384_2608305_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024569.1|2608304_2608610_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_001538537.1|2608966_2609566_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001538536.1|2609562_2612109_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230247.1|2612108_2613281_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2613410_2614103_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_097430606.1|2614075_2615104_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_100228301.1|2615186_2617919_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	5.4e-38
WP_000818456.1|2618001_2619075_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2619123_2619297_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_012896763.1|2619286_2619517_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2619491_2619680_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2619690_2619903_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 187
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2631674	2632334	5023098	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001538531.1|2631674_2632334_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 188
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2636567	2638622	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_001538528.1|2636567_2638622_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 189
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2651222	2653130	5023098		Tupanvirus(100.0%)	1	NA	NA
WP_000053130.1|2651222_2653130_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.6e-52
>prophage 190
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2661885	2672834	5023098	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090487.1|2661885_2662653_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_001556879.1|2662847_2665460_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001538521.1|2665725_2666928_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|2667096_2668497_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977927.1|2669098_2670187_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000462681.1|2670371_2671562_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|2671611_2672259_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2672285_2672834_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 191
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2687539	2692079	5023098		Bacillus_phage(100.0%)	3	NA	NA
WP_000551259.1|2687539_2689288_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_001538517.1|2689324_2691589_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2691794_2692079_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 192
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2697166	2698255	5023098		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057159.1|2697166_2698255_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 193
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2702353	2705568	5023098		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|2702353_2704636_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|2704827_2705568_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 194
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2708653	2800407	5023098	lysis,capsid,plate,portal,integrase,head,tail,protease,tRNA,terminase	Salmonella_phage(59.65%)	90	2764344:2764369	2800482:2800507
WP_000213098.1|2708653_2709271_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_001556877.1|2709281_2711726_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	1.7e-221
WP_000886683.1|2711964_2713257_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_001556876.1|2713347_2714691_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	5.6e-81
WP_001295343.1|2714701_2715313_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001675097.1|2715471_2719461_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2719595_2720090_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|2720633_2721599_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_097430469.1|2721721_2723488_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	1.4e-23
WP_001202199.1|2723488_2725210_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241673.1|2725251_2725956_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2726240_2726459_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_174165866.1|2727202_2729479_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	9.6e-166
WP_001538508.1|2729509_2729830_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.6e-13
WP_000410785.1|2730152_2730377_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_097430470.1|2730449_2732396_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	9.4e-37
WP_000746478.1|2732392_2733508_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|2733658_2734615_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599809.1|2734611_2736270_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|2736695_2737391_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491135.1|2737711_2738611_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458842.1|2738754_2740407_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178690.1|2740418_2741387_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815372.1|2741519_2743238_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_001556872.1|2743274_2744276_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001538505.1|2744286_2745717_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001538504.1|2745815_2746829_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255186.1|2746825_2747656_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|2747652_2747976_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001538503.1|2748101_2748617_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2748834_2749563_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|2749580_2750312_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|2750318_2751035_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|2751034_2751703_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_097430471.1|2751928_2752660_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001538502.1|2752688_2753816_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	6.7e-27
WP_000389260.1|2753856_2754345_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|2754404_2755250_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105434.1|2755246_2756200_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|2756209_2757343_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001538501.1|2757437_2758550_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|2758899_2759376_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001538500.1|2759463_2760366_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|2760426_2761149_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201570.1|2761132_2761420_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|2761579_2761837_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681104.1|2761866_2762244_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|2762513_2764199_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2764344:2764369	attL	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
WP_000972391.1|2764434_2764653_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_097430473.1|2764743_2765844_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.2e-174
WP_021522016.1|2765840_2766326_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_021554116.1|2766322_2769400_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
WP_000763311.1|2769392_2769512_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2769526_2769829_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|2769883_2770399_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_021522014.1|2770408_2771581_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.5	6.6e-203
WP_021522013.1|2771723_2772290_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_021522011.1|2775267_2775873_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	8.9e-111
WP_021522010.1|2775865_2776774_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_021522009.1|2776760_2777120_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	6.1e-51
WP_021522008.1|2777116_2777695_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.5e-94
WP_021522007.1|2777798_2778605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522006.1|2778546_2778993_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_021522005.1|2778985_2779417_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	4.9e-71
WP_001368405.1|2779512_2779941_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	4.9e-47
WP_021522004.1|2779937_2780315_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	3.3e-15
WP_021522003.1|2780316_2780829_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	2.0e-87
WP_000171568.1|2780809_2781025_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2781028_2781232_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|2781231_2781696_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_097430475.1|2781791_2782442_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	3.6e-110
WP_000742510.1|2782445_2783504_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_097430476.1|2783520_2784354_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	3.4e-121
WP_021522000.1|2784496_2786263_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_021554115.1|2786262_2787291_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.0	3.9e-175
WP_077758113.1|2787343_2788498_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_164965840.1|2788517_2788682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217580.1|2792359_2792593_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|2792603_2792792_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_021521996.1|2792944_2795359_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_001513126.1|2795355_2796213_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	2.7e-161
WP_000752613.1|2796209_2796437_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244213.1|2796436_2796670_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_000996717.1|2796737_2797079_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_097430478.1|2797301_2797493_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	2.1e-21
WP_000460891.1|2797500_2798010_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|2798042_2798264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047328.1|2798389_2798959_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_000900884.1|2798974_2799166_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	70.5	2.4e-09
WP_000290937.1|2799354_2800407_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
2800482:2800507	attR	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
>prophage 195
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2806541	2807744	5023098		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2806541_2807744_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 196
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2819078	2820950	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_001538498.1|2819078_2820950_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 197
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2824165	2831049	5023098		Synechococcus_phage(33.33%)	5	NA	NA
WP_001298570.1|2824165_2824828_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	3.7e-25
WP_001298571.1|2824958_2825858_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209310.1|2825863_2828296_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114251.1|2828441_2829257_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000961458.1|2829456_2831049_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 198
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2836045	2841271	5023098		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|2836045_2836561_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2836613_2836679_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|2836913_2837801_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2838100_2838604_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2839007_2839754_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|2839892_2840552_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2840548_2841271_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 199
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2847834	2859497	5023098		Synechococcus_phage(20.0%)	10	NA	NA
WP_000990159.1|2847834_2848512_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	1.5e-18
WP_000146357.1|2848585_2848852_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_001538491.1|2849116_2849377_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443514.1|2849605_2850691_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386549.1|2850831_2851794_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218658.1|2851821_2853972_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_097430483.1|2854508_2855870_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	5.6e-52
WP_001295890.1|2856098_2856770_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001334148.1|2856772_2857768_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001538488.1|2857760_2859497_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-18
>prophage 200
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2870094	2871003	5023098		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|2870094_2871003_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 201
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2877329	2879860	5023098	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_001350189.1|2877329_2878619_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000817269.1|2878729_2879860_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
>prophage 202
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2890172	2896747	5023098		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891664.1|2890172_2891231_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
WP_000604037.1|2891233_2891923_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|2891922_2892696_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|2892862_2893012_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_097430485.1|2893140_2893929_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_174165868.1|2893996_2895469_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	30.6	3.2e-13
WP_001265443.1|2895730_2896747_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 203
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2901110	2904630	5023098		Klebsiella_phage(33.33%)	4	NA	NA
WP_001538477.1|2901110_2902163_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	48.8	2.2e-80
WP_001538476.1|2902478_2902859_+	homeobox protein	NA	NA	NA	NA	NA
WP_001538475.1|2902972_2903914_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000345406.1|2903910_2904630_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 204
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2931990	2932782	5023098		Kaumoebavirus(100.0%)	1	NA	NA
WP_001538470.1|2931990_2932782_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.0e-09
>prophage 205
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2936160	2947993	5023098		Hokovirus(40.0%)	10	NA	NA
WP_001032722.1|2936160_2937642_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
WP_000207172.1|2937683_2939102_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	8.1e-62
WP_001075778.1|2939098_2939608_-	YbgA family protein	NA	NA	NA	NA	NA
WP_001538467.1|2939708_2939915_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|2940227_2940317_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_001538466.1|2940316_2941990_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087998.1|2942012_2944061_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	3.5e-26
WP_001538465.1|2944069_2944642_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001538464.1|2944634_2947319_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_000186082.1|2947315_2947993_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 206
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2954648	2955413	5023098		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|2954648_2955413_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 207
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2959557	2962203	5023098	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_001287134.1|2959557_2961222_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_000679501.1|2961441_2962203_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 208
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2966696	2967455	5023098		Moraxella_phage(100.0%)	1	NA	NA
WP_000480546.1|2966696_2967455_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.8	1.1e-44
>prophage 209
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2970509	2972456	5023098		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|2970509_2972456_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 210
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2977081	2978746	5023098		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|2977081_2978746_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 211
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2982884	2983925	5023098		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|2982884_2983925_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 212
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	2991869	2996992	5023098	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_000631389.1|2991869_2992595_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207539.1|2992712_2993648_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001044880.1|2993692_2994175_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001538450.1|2994409_2996992_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 213
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3004002	3006442	5023098		Synechococcus_phage(50.0%)	2	NA	NA
WP_001538448.1|3004002_3005091_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|3005230_3006442_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 214
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3010657	3011304	5023098		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|3010657_3011041_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3011094_3011304_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 215
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3025392	3027507	5023098		Morganella_phage(50.0%)	2	NA	NA
WP_001295855.1|3025392_3025821_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
WP_032141769.1|3025941_3027507_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 216
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3030612	3032435	5023098		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029771.1|3030612_3031833_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
WP_000502940.1|3031805_3032435_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 217
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3046726	3052769	5023098		Klosneuvirus(50.0%)	3	NA	NA
WP_000140646.1|3046726_3047542_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_001538440.1|3047538_3048672_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001556853.1|3048887_3052769_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.8e-61
>prophage 218
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3064157	3065702	5023098		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_001556852.1|3064157_3065702_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-14
>prophage 219
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3075193	3078337	5023098		Leptospira_phage(100.0%)	1	NA	NA
WP_001538423.1|3075193_3078337_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	7.5e-60
>prophage 220
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3081482	3082166	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_174165870.1|3081482_3082166_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.3e-30
>prophage 221
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3093166	3097642	5023098	tail,tRNA	Enterobacteria_phage(33.33%)	5	NA	NA
WP_001111235.1|3093166_3093523_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.9	4.2e-52
WP_000729154.1|3094511_3095378_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3095379_3095592_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143516.1|3095699_3096221_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3096256_3097642_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 222
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3109676	3110822	5023098		Streptococcus_phage(100.0%)	1	NA	NA
WP_001556850.1|3109676_3110822_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	4.8e-49
>prophage 223
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3117020	3118802	5023098		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001524200.1|3117020_3118802_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 224
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3125237	3125924	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110575.1|3125237_3125924_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 225
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3129060	3129738	5023098		Bacillus_virus(100.0%)	1	NA	NA
WP_001298568.1|3129060_3129738_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.2e-26
>prophage 226
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3137235	3140477	5023098		Escherichia_phage(66.67%)	3	NA	NA
WP_000083948.1|3137235_3139740_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
WP_000806442.1|3139797_3140139_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057523.1|3140174_3140477_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 227
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3148713	3157158	5023098		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801820.1|3148713_3149682_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	6.0e-16
WP_001250114.1|3149656_3150619_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001313630.1|3150750_3151395_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678189.1|3151575_3153450_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001195025.1|3153559_3154165_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3154164_3154494_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122015.1|3154546_3156478_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|3156606_3157158_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 228
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3164166	3167316	5023098		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|3164166_3167316_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 229
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3176154	3179701	5023098		Bacillus_phage(100.0%)	2	NA	NA
WP_001538391.1|3176154_3177936_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
WP_097430528.1|3177928_3179701_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
>prophage 230
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3183023	3183719	5023098		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|3183023_3183719_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 231
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3186859	3191906	5023098	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|3186859_3187132_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_174165872.1|3187340_3189695_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	3.6e-224
WP_000130305.1|3189882_3191157_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|3191282_3191906_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 232
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3217366	3226209	5023098	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|3217366_3217837_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150440.1|3217925_3219029_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_000543535.1|3219032_3219482_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001538377.1|3219632_3220172_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295827.1|3220470_3221355_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|3221392_3221740_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|3221869_3222841_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934823.1|3222851_3224699_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|3224726_3225059_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|3225081_3226209_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 233
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3233160	3243258	5023098		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|3233160_3234456_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|3234513_3235203_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221287.1|3235392_3236595_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_001538373.1|3236591_3239735_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001331503.1|3239860_3241045_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219315.1|3241313_3242222_-	fructokinase	NA	NA	NA	NA	NA
WP_001366457.1|3242346_3243258_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 234
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3247544	3248660	5023098		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|3247544_3248660_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 235
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3256075	3257233	5023098		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001538363.1|3256075_3257233_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	6.7e-06
>prophage 236
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3264141	3264909	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|3264141_3264909_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 237
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3270201	3277483	5023098		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000842109.1|3270201_3271311_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
WP_000419066.1|3271403_3272237_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001538358.1|3272462_3273002_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_024186801.1|3273203_3274286_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	5.4e-191
WP_001556840.1|3274408_3277483_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.0	0.0e+00
>prophage 238
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3282442	3284329	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_097430629.1|3282442_3284329_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 239
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3291976	3293026	5023098		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001538349.1|3291976_3293026_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.4e-71
>prophage 240
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3304149	3311719	5023098	integrase,holin	Vibrio_phage(33.33%)	5	3297661:3297674	3312746:3312759
3297661:3297674	attL	TTGCCGTTGGTGAA	NA	NA	NA	NA
WP_000131041.1|3304149_3306183_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001375032.1|3306311_3306899_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001538343.1|3306912_3308385_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159135.1|3308398_3310087_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
WP_001295805.1|3311155_3311719_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
3312746:3312759	attR	TTGCCGTTGGTGAA	NA	NA	NA	NA
>prophage 241
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3316978	3318207	5023098	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_103103190.1|3316978_3318207_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
>prophage 242
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3322967	3326272	5023098		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046332.1|3322967_3324293_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
WP_000474088.1|3324401_3324638_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|3324649_3325243_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001538339.1|3325402_3326272_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.4e-53
>prophage 243
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3332317	3333169	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001538337.1|3332317_3333169_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	8.8e-48
>prophage 244
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3351459	3361069	5023098		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001556836.1|3351459_3355590_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.7	3.3e-281
WP_001059463.1|3355745_3356240_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|3356674_3357013_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001538333.1|3357356_3358610_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	6.4e-95
WP_001285288.1|3358621_3359725_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749900.1|3360013_3361069_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
>prophage 245
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3365746	3366898	5023098		Mycobacterium_phage(100.0%)	1	NA	NA
WP_097430544.1|3365746_3366898_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.1	1.6e-31
>prophage 246
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3391403	3395928	5023098		Catovirus(50.0%)	4	NA	NA
WP_001538317.1|3391403_3393842_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.4	1.6e-33
WP_000220508.1|3394167_3394989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000623467.1|3394981_3395521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001538316.1|3395532_3395928_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	49.3	5.6e-29
>prophage 247
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3410102	3413425	5023098		Clostridioides_phage(50.0%)	4	NA	NA
WP_000093934.1|3410102_3410852_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|3411163_3411904_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001538302.1|3411874_3412642_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3412846_3413425_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 248
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3423006	3424989	5023098		Ralstonia_phage(100.0%)	1	NA	NA
WP_174165875.1|3423006_3424989_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.4	4.9e-25
>prophage 249
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3439444	3442207	5023098		Cronobacter_phage(100.0%)	1	NA	NA
WP_001538292.1|3439444_3442207_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	6.1e-82
>prophage 250
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3451468	3459320	5023098		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001308374.1|3451468_3452200_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|3452264_3452732_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|3452728_3453451_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052743.1|3453484_3454240_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3454311_3455670_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211705.1|3455716_3456487_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3456564_3457365_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648548.1|3457605_3458520_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997016.1|3458516_3459320_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
>prophage 251
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3465840	3466872	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3465840_3466872_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 252
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3479830	3483946	5023098		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294747.1|3479830_3483313_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000569423.1|3483349_3483946_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 253
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3492774	3493533	5023098		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3492774_3493533_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 254
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3505830	3507255	5023098	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753942.1|3505830_3507255_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 255
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3511184	3511529	5023098		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3511184_3511529_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 256
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3517440	3518238	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3517440_3518238_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 257
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3523388	3530194	5023098	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001540734.1|3523388_3525818_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
WP_174165879.1|3525891_3526422_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396047.1|3526436_3527141_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|3527318_3527774_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937411.1|3527810_3528737_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|3528775_3530194_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 258
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3540091	3540976	5023098		Sodalis_phage(100.0%)	1	NA	NA
WP_000339934.1|3540091_3540976_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.8	4.7e-60
>prophage 259
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3544238	3550706	5023098		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150638.1|3544238_3545165_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|3545273_3545936_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|3545976_3546513_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001556761.1|3546718_3549109_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001540713.1|3549155_3550706_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
>prophage 260
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3558526	3559951	5023098		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3558526_3559951_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 261
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3572492	3573044	5023098		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|3572492_3573044_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 262
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3577290	3578334	5023098		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3577290_3578334_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 263
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3604304	3606029	5023098		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001774153.1|3604304_3606029_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 264
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3612951	3613410	5023098	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000526115.1|3612951_3613410_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 265
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3618218	3618917	5023098		Planktothrix_phage(100.0%)	1	NA	NA
WP_001540674.1|3618218_3618917_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.1e-22
>prophage 266
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3627192	3632615	5023098		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001556757.1|3627192_3629544_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
WP_001117001.1|3629708_3632615_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 267
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3640360	3642321	5023098		Microcystis_phage(50.0%)	4	NA	NA
WP_000257181.1|3640360_3641209_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160966.1|3641205_3641520_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125568.1|3641522_3641756_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|3641841_3642321_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 268
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3650215	3655864	5023098		Vibrio_phage(50.0%)	4	NA	NA
WP_097430600.1|3650215_3651730_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	4.6e-07
WP_000347117.1|3651760_3652903_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349942.1|3653020_3654238_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001298634.1|3654310_3655864_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.7e-34
>prophage 269
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3661364	3662513	5023098		Halovirus(100.0%)	1	NA	NA
WP_001540660.1|3661364_3662513_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	2.8e-49
>prophage 270
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3666939	3681463	5023098	tRNA	Tupanvirus(16.67%)	12	NA	NA
WP_001286825.1|3666939_3669756_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
WP_000767329.1|3669798_3670740_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001337277.1|3670747_3670966_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_001274021.1|3671068_3671332_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000062878.1|3671427_3672333_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681384.1|3672392_3673559_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
WP_000494929.1|3673793_3675053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443162.1|3675181_3676675_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	3.6e-28
WP_001274832.1|3676694_3677456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001181672.1|3678013_3678223_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|3678327_3679458_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|3679546_3681463_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 271
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3684599	3685553	5023098		Cyanophage(100.0%)	1	NA	NA
WP_001540649.1|3684599_3685553_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 272
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3694065	3695212	5023098	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949154.1|3694065_3695212_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 273
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3698573	3700687	5023098		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_115766517.1|3698573_3699998_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	7.2e-10
WP_001188687.1|3699997_3700687_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 274
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3703964	3709774	5023098		Bacillus_phage(33.33%)	5	NA	NA
WP_000409429.1|3703964_3705902_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|3706108_3707776_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000007436.1|3707831_3708116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001298496.1|3708117_3708450_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093832.1|3708541_3709774_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	2.7e-82
>prophage 275
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3716494	3717817	5023098		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3716494_3717817_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 276
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3723504	3726380	5023098		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|3723504_3723666_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3723792_3724398_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|3724790_3726380_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 277
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3731865	3736743	5023098	transposase	Shigella_phage(66.67%)	5	NA	NA
WP_085949154.1|3731865_3733013_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001314410.1|3734121_3734892_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000538188.1|3734882_3735356_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001535806.1|3735463_3736003_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000799911.1|3736005_3736743_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 278
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3747369	3749034	5023098		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919584.1|3747369_3749034_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.3e-12
>prophage 279
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3754817	3764637	5023098	transposase	Bodo_saltans_virus(25.0%)	7	NA	NA
WP_001029745.1|3754817_3756437_+	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.8	1.1e-06
WP_000535012.1|3756426_3757731_+	restriction endonuclease subunit S	NA	B3GAM1	uncultured_virus	24.7	8.3e-05
WP_000058884.1|3757825_3761089_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	2.8e-49
WP_000132599.1|3761303_3761642_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000397910.1|3761684_3761849_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000199304.1|3762025_3763438_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000181180.1|3763680_3764637_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
>prophage 280
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3772138	3772693	5023098		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3772138_3772693_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 281
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3779216	3780677	5023098		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3779216_3780677_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 282
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3790872	3847942	5023098	transposase,holin	Stx2-converting_phage(17.65%)	49	NA	NA
WP_000044711.1|3790872_3791469_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000115885.1|3792453_3792972_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|3792990_3794211_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001295734.1|3795895_3796612_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001295733.1|3796631_3797738_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991462.1|3797801_3798782_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
WP_001363826.1|3799364_3800408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|3800533_3801680_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000366620.1|3802569_3804645_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
WP_000504875.1|3804637_3805924_+	McrC family protein	NA	NA	NA	NA	NA
WP_097430644.1|3806033_3807773_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_001295727.1|3807785_3808976_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
WP_001332039.1|3808968_3810609_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001016257.1|3811004_3811751_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3811765_3813307_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001467148.1|3814440_3814599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|3814698_3814875_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761690.1|3814891_3815380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854759.1|3815376_3815754_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|3815843_3816212_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|3816374_3816596_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|3816658_3817135_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|3817150_3817624_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234738.1|3817965_3818784_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001323397.1|3818938_3819097_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_174165886.1|3819167_3822014_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069743.1|3822385_3823258_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250228.1|3823342_3824260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813435.1|3825460_3826063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211308.1|3826158_3826365_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|3827138_3827288_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001547002.1|3827620_3827818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|3828017_3828587_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|3828846_3829248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|3829235_3829670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282144.1|3830015_3830405_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000612591.1|3830401_3830749_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|3830798_3832184_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3832422_3833781_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|3835341_3835863_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|3835859_3836813_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|3836899_3839224_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|3839268_3840171_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|3840167_3841166_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3841162_3842119_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3842119_3842887_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3843443_3843701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947616.1|3844634_3845790_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001545177.1|3845944_3847942_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
>prophage 283
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3856556	3856793	5023098		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000239754.1|3856556_3856793_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
>prophage 284
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3867811	3878238	5023098	tRNA	Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_001296699.1|3867811_3868831_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001296698.1|3868960_3870463_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296697.1|3870623_3871706_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|3871705_3872806_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|3873072_3874584_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|3874939_3875383_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|3875382_3878238_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 285
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3886505	3891276	5023098		Paramecium_bursaria_Chlorella_virus(100.0%)	4	NA	NA
WP_000013046.1|3886505_3887441_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|3887453_3887915_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|3887987_3888374_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|3888579_3891276_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
>prophage 286
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3896240	3899002	5023098		Vibrio_phage(50.0%)	2	NA	NA
WP_000187776.1|3896240_3898379_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106233.1|3898537_3899002_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 287
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3903184	3909672	5023098		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|3903184_3904183_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|3904215_3905211_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001361374.1|3905197_3906220_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|3906233_3907736_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|3907875_3908832_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|3909141_3909672_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 288
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3930305	3930920	5023098	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_001540545.1|3930305_3930920_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	3.1e-42
>prophage 289
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3944584	3945748	5023098		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943981.1|3944584_3945748_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	6.4e-81
>prophage 290
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3953288	3966310	5023098	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_097430625.1|3953288_3955727_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.2e-66
WP_001177639.1|3955765_3956191_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3956395_3957694_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089288.1|3957797_3957995_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3958076_3959081_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|3959083_3960343_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|3960428_3961709_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3961784_3962093_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280357.1|3962178_3963129_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001298688.1|3963121_3964969_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001540520.1|3964978_3966310_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
>prophage 291
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3970225	3970771	5023098		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3970225_3970771_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 292
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3978491	3979469	5023098		Tupanvirus(100.0%)	1	NA	NA
WP_001540513.1|3978491_3979469_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.1	5.2e-28
>prophage 293
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3984389	3984923	5023098		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3984389_3984923_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 294
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	3989127	3991111	5023098		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|3989127_3990774_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3990817_3991111_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 295
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4016052	4020275	5023098		Sodalis_phage(50.0%)	5	NA	NA
WP_097330429.1|4016052_4016532_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	43.8	4.1e-10
WP_157917110.1|4016856_4017180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174165905.1|4017197_4017815_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_029402536.1|4017911_4018145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097330431.1|4018508_4020275_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	3.5e-22
>prophage 296
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4038018	4040192	5023098		Serratia_phage(33.33%)	4	NA	NA
WP_097330433.1|4038018_4038855_+	DUF932 domain-containing protein	NA	A0A1S6UA20	Serratia_phage	32.5	2.1e-33
WP_000860081.1|4038936_4039416_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	6.8e-13
WP_001186773.1|4039431_4039908_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|4039970_4040192_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 297
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4048994	4052206	5023098	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856826.1|4048994_4050452_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_000003806.1|4050688_4052206_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 298
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4071770	4073273	5023098		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|4071770_4073273_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 299
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4078112	4078901	5023098		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|4078112_4078901_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 300
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4084505	4086055	5023098		Bacillus_virus(50.0%)	2	NA	NA
WP_001075532.1|4084505_4085264_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	6.1e-16
WP_000611411.1|4085374_4086055_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 301
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4092177	4098546	5023098		Bacillus_virus(50.0%)	5	NA	NA
WP_000235240.1|4092177_4093710_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
WP_000507111.1|4093688_4094669_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001314355.1|4094679_4095375_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171678.1|4095358_4096288_+	allose kinase	NA	NA	NA	NA	NA
WP_001540450.1|4096560_4098546_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.9e-150
>prophage 302
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4103791	4105939	5023098		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|4103791_4105939_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 303
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4109856	4111384	5023098		Planktothrix_phage(50.0%)	2	NA	NA
WP_000132446.1|4109856_4110693_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156927.1|4110679_4111384_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	7.1e-19
>prophage 304
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4121320	4123279	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_097430608.1|4121320_4123279_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	4.8e-89
>prophage 305
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4129576	4130926	5023098		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|4129576_4130926_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 306
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4134743	4138357	5023098		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|4134743_4135280_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357768.1|4135534_4138357_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 307
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4148474	4149893	5023098		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103920.1|4148474_4149893_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	9.6e-39
>prophage 308
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4155463	4158011	5023098		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|4155463_4156543_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|4156595_4158011_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 309
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4163049	4163658	5023098		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4163049_4163658_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 310
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4171191	4172307	5023098		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4171191_4172307_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 311
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4196647	4200331	5023098		Dickeya_phage(100.0%)	1	NA	NA
WP_001540407.1|4196647_4200331_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 312
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4214120	4215710	5023098		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187554.1|4214120_4215710_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	3.2e-67
>prophage 313
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4221072	4222836	5023098		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|4221072_4221345_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941119.1|4221531_4222122_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|4222164_4222836_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 314
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4231131	4239460	5023098		Vibrio_phage(50.0%)	2	NA	NA
WP_174165893.1|4231131_4235355_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
WP_000263098.1|4235431_4239460_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 315
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4243455	4246508	5023098		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|4243455_4244640_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|4245557_4246508_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 316
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4258692	4260164	5023098	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4258692_4259202_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|4259216_4260164_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 317
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4281388	4283341	5023098		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|4281388_4283341_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 318
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4290260	4301993	5023098	transposase	uncultured_Caudovirales_phage(33.33%)	12	NA	NA
WP_085949154.1|4290260_4291407_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000178175.1|4291809_4292487_+	prepilin peptidase GspO	NA	NA	NA	NA	NA
WP_000675504.1|4292515_4292992_-	bacterioferritin	NA	NA	NA	NA	NA
WP_000289085.1|4293063_4293258_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_000773146.1|4293426_4296129_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
WP_000031783.1|4296420_4297605_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4297675_4299790_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4299886_4300357_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4300453_4300828_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903382.1|4300953_4301241_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820731.1|4301247_4301607_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209693.1|4301606_4301993_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
>prophage 319
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4307563	4317115	5023098		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4307563_4309477_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057389.1|4309476_4310499_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4310492_4310711_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274684.1|4310764_4311634_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4311688_4312093_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4312394_4313027_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_123004009.1|4313077_4315168_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963803.1|4315245_4316466_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|4316551_4317115_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 320
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4336026	4336863	5023098		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4336026_4336863_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 321
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4353768	4357536	5023098		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|4353768_4355391_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253707.1|4355467_4356820_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|4356816_4357536_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 322
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4364117	4365011	5023098		Sodalis_phage(100.0%)	1	NA	NA
WP_000039098.1|4364117_4365011_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 323
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4371240	4373634	5023098		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081882.1|4371240_4373634_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 324
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4378024	4379251	5023098		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|4378024_4379251_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 325
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4394655	4397103	5023098		Dickeya_phage(100.0%)	1	NA	NA
WP_001539973.1|4394655_4397103_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 326
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4407432	4409529	5023098		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001539976.1|4407432_4409529_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 327
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4420404	4422215	5023098		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|4420404_4421148_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|4421144_4422215_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 328
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4425756	4427239	5023098		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4425756_4426470_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4426471_4427239_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 329
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4432962	4435781	5023098		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4432962_4433817_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4434061_4435120_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_001539990.1|4435112_4435781_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	2.3e-14
>prophage 330
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4438787	4443086	5023098		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4438787_4439414_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106596.1|4439487_4441686_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	1.3e-119
WP_000130621.1|4441954_4442200_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|4442420_4443086_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 331
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4450979	4456061	5023098		Bacillus_virus(50.0%)	4	NA	NA
WP_000173679.1|4450979_4451786_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
WP_001190062.1|4451791_4452193_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_001314210.1|4452201_4453326_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149094.1|4453325_4456061_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 332
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4465747	4471156	5023098		Indivirus(50.0%)	5	NA	NA
WP_001312164.1|4465747_4467790_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
WP_000954225.1|4467992_4468835_+	23S rRNA (adenine(2030)-N(6))-methyltransferase	NA	NA	NA	NA	NA
WP_000160795.1|4468906_4470259_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001295215.1|4470312_4470396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539997.1|4470730_4471156_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	4.7e-50
>prophage 333
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4481827	4483297	5023098		Pithovirus(50.0%)	2	NA	NA
WP_000622316.1|4481827_4482598_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_000123131.1|4482649_4483297_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 334
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4529128	4531113	5023098		Bacillus_virus(50.0%)	2	NA	NA
WP_000103577.1|4529128_4530133_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-17
WP_001196477.1|4530129_4531113_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 335
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4546899	4549239	5023098		Escherichia_phage(100.0%)	1	NA	NA
WP_097430617.1|4546899_4549239_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	9.2e-71
>prophage 336
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4552893	4553106	5023098		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4552893_4553106_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 337
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4557327	4558323	5023098		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182634.1|4557327_4558323_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 338
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4563640	4565182	5023098		Staphylococcus_phage(100.0%)	1	NA	NA
WP_174165896.1|4563640_4565182_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	6.6e-17
>prophage 339
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4584756	4595299	5023098	tRNA	Clostridioides_phage(33.33%)	6	NA	NA
WP_000985736.1|4584756_4586052_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741493.1|4586181_4587333_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_097430621.1|4587523_4589368_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	3.9e-16
WP_000206248.1|4589364_4590756_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|4590853_4591462_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001540057.1|4591618_4595299_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	46.0	4.3e-309
>prophage 340
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4621800	4631306	5023098		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|4621800_4622052_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4622192_4622624_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|4622868_4624413_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214152.1|4624422_4625706_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483831.1|4625709_4626669_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_097430578.1|4626655_4627690_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646014.1|4627928_4628954_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213845.1|4628963_4630160_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000587750.1|4630373_4631306_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 341
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4634714	4636808	5023098		Catovirus(50.0%)	2	NA	NA
WP_001540080.1|4634714_4635698_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|4635779_4636808_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 342
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4644246	4648809	5023098		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|4644246_4644726_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114542.1|4644764_4645574_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|4645671_4645839_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4645859_4646096_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001540088.1|4646312_4646981_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050148.1|4647152_4648373_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	3.2e-43
WP_000976070.1|4648350_4648809_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 343
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4652183	4658934	5023098		Morganella_phage(25.0%)	6	NA	NA
WP_001297973.1|4652183_4653008_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|4653299_4653917_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001525900.1|4653913_4655596_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.2	2.5e-22
WP_001295237.1|4655853_4656477_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4656531_4656807_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|4656825_4658934_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 344
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4663235	4664627	5023098		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4663235_4664627_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 345
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4678135	4679320	5023098	integrase	Enterobacteria_phage(100.0%)	1	4678102:4678116	4688164:4688178
4678102:4678116	attL	AGGAACATGAATTCA	NA	NA	NA	NA
WP_001218900.1|4678135_4679320_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218900.1|4678135_4679320_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
4688164:4688178	attR	AGGAACATGAATTCA	NA	NA	NA	NA
>prophage 346
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4686082	4687012	5023098		Virus_Rctr41k(100.0%)	1	NA	NA
WP_001328257.1|4686082_4687012_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	38.1	1.4e-51
>prophage 347
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4691569	4693652	5023098	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_164906825.1|4691569_4692782_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	95.9	1.7e-161
WP_000926369.1|4693073_4693652_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.1	3.4e-11
>prophage 348
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4699523	4702910	5023098	holin	Serratia_phage(100.0%)	1	NA	NA
WP_000035053.1|4699523_4702910_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 349
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4725798	4727993	5023098		Yersinia_phage(33.33%)	4	NA	NA
WP_174165900.1|4725798_4726617_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	3.6e-46
WP_021524627.1|4726708_4727194_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	1.5e-12
WP_001186724.1|4727209_4727686_+	RadC family protein	NA	NA	NA	NA	NA
WP_001521666.1|4727771_4727993_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
>prophage 350
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4735626	4736961	5023098		Moraxella_phage(100.0%)	1	NA	NA
WP_001557145.1|4735626_4736961_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 351
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4744265	4756143	5023098		Micromonas_sp._RCC1109_virus(16.67%)	12	NA	NA
WP_000168476.1|4744265_4745954_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001312198.1|4746059_4746158_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_097430553.1|4746558_4747743_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148045.1|4747750_4748248_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4748244_4748607_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4748596_4748944_-	YidH family protein	NA	NA	NA	NA	NA
WP_001540116.1|4749003_4750497_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	6.6e-30
WP_097430554.1|4750493_4752209_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	28.8	2.1e-40
WP_001540119.1|4752375_4753242_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|4753331_4754993_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|4755189_4755618_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4755729_4756143_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 352
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4760570	4761719	5023098		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|4760570_4761719_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 353
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4766424	4773793	5023098		Bacillus_virus(33.33%)	8	NA	NA
WP_000072072.1|4766424_4768839_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4768867_4769941_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4769940_4771041_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4771045_4772449_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|4772745_4772826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|4773055_4773196_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4773212_4773572_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4773535_4773793_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 354
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4783991	4785329	5023098		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4783991_4785329_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 355
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4795700	4803215	5023098		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4795700_4796474_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001540141.1|4796564_4797455_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4797454_4798414_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4798500_4799541_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|4799854_4801684_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933736.1|4801844_4803215_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 356
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4815169	4816162	5023098		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_001540168.1|4815169_4816162_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 357
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4819330	4825183	5023098		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102331.1|4819330_4821199_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.0e-64
WP_001346607.1|4821365_4821785_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|4821792_4823298_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_000211858.1|4823302_4824268_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4824292_4825183_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 358
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4838572	4840219	5023098		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001540188.1|4838572_4840219_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.7e-66
>prophage 359
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4847813	4853227	5023098		Bacillus_phage(33.33%)	4	NA	NA
WP_001238868.1|4847813_4849835_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001314257.1|4849881_4851366_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4851501_4852767_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4852897_4853227_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 360
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4857269	4863413	5023098		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|4857269_4858400_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006615.1|4858396_4859659_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	1.0e-23
WP_001540196.1|4859658_4860726_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.0e-101
WP_000676056.1|4860744_4861626_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001540197.1|4861603_4862278_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612054.1|4862282_4863413_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 361
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4871420	4873076	5023098		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395835.1|4871420_4873076_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 362
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4881205	4889812	5023098		Salmonella_phage(50.0%)	8	NA	NA
WP_001014271.1|4881205_4882534_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	47.4	8.8e-10
WP_001540206.1|4882530_4884000_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	55.4	1.3e-43
WP_000799889.1|4884188_4884392_+	lipoprotein	NA	NA	NA	NA	NA
WP_001160645.1|4884428_4885253_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000812795.1|4885249_4885957_+	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_000130676.1|4885953_4886850_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4886849_4887566_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|4887649_4889812_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 363
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4897171	4899001	5023098		Catovirus(100.0%)	1	NA	NA
WP_001442069.1|4897171_4899001_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 364
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4909461	4910970	5023098		Vibrio_phage(100.0%)	1	NA	NA
WP_000037970.1|4909461_4910970_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 365
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4932965	4936252	5023098		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|4932965_4934606_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|4934684_4934954_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|4934957_4935473_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|4935475_4936252_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 366
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4945122	4945737	5023098		Streptococcus_phage(100.0%)	1	NA	NA
WP_001335246.1|4945122_4945737_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.8	1.3e-19
>prophage 367
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4959334	4962121	5023098		uncultured_virus(100.0%)	1	NA	NA
WP_000249991.1|4959334_4962121_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 368
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4966242	4968713	5023098		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|4966242_4967652_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_001540261.1|4967663_4968713_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	9.3e-07
>prophage 369
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4988126	4990906	5023098		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718898.1|4988126_4989023_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621622.1|4989190_4990087_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_097430631.1|4990120_4990906_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.2	1.4e-23
>prophage 370
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	4999632	5002683	5023098		Escherichia_phage(100.0%)	1	NA	NA
WP_012602895.1|4999632_5002683_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 371
NZ_CP054345	Escherichia coli strain SCU-176 chromosome, complete genome	5023098	5013837	5022837	5023098	integrase	Yersinia_virus(30.0%)	13	5005697:5005709	5022829:5022841
5005697:5005709	attL	ATGGCATGAGTAT	NA	NA	NA	NA
WP_001298417.1|5013837_5014458_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
WP_001166064.1|5014717_5015701_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001540294.1|5015849_5016524_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|5016695_5018069_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033719.1|5018065_5018764_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_097430540.1|5018913_5019414_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985242.1|5019600_5020581_-|integrase	site-specific integrase	integrase	Q858U3	Yersinia_virus	100.0	4.7e-186
WP_000777029.1|5020650_5020944_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001540298.1|5021080_5021353_+	hypothetical protein	NA	Q1JS42	Enterobacteria_phage	100.0	3.1e-47
WP_000217670.1|5021522_5022023_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001540300.1|5022086_5022311_+	DUF2732 family protein	NA	Q858T8	Yersinia_virus	100.0	6.1e-33
WP_001277891.1|5022310_5022610_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001113261.1|5022612_5022837_+	TraR/DksA family transcriptional regulator	NA	Q858T6	Yersinia_virus	98.6	1.7e-35
5022829:5022841	attR	ATGGCATGAGTAT	NA	NA	NA	NA
