The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039707	Lactobacillus paracasei strain Lp02 chromosome, complete genome	2991176	486902	538061	2991176	holin,transposase,protease	Streptococcus_phage(33.33%)	48	NA	NA
WP_032764316.1|486902_487760_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|487839_488022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|488072_488252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572828.1|488749_489985_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003584070.1|490188_492762_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|492774_493476_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003584072.1|493755_494304_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003584074.1|494347_495154_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003584076.1|495158_495479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072671865.1|495704_496385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382153.1|496317_496821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016363468.1|496840_498991_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_016363467.1|499335_500112_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003607135.1|500328_501528_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.0	9.2e-67
WP_050569254.1|501928_502534_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003584084.1|502657_503551_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|503599_504238_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155468344.1|504772_504931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016367436.1|504985_505345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016367437.1|505363_505645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003584090.1|506127_507504_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003584092.1|507726_508071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052915992.1|508441_509362_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003584097.1|509617_510544_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003584098.1|510685_512128_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_173959091.1|512322_512955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032764510.1|513127_513727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016368245.1|515080_516130_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_003582854.1|516126_516864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562555.1|517075_517786_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003577245.1|517772_518102_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_072672128.1|518982_519180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562562.1|519542_520418_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_173959092.1|520763_521414_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003582859.1|521811_522504_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572918.1|523200_523521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016368242.1|523709_524585_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	1.0e-11
WP_016368241.1|524676_526269_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_003582874.1|526606_527980_-	MFS transporter	NA	NA	NA	NA	NA
WP_003582875.1|528157_528481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052915920.1|528661_531973_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|531969_532572_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562589.1|532821_533082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|533295_533958_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|533957_534887_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|534898_535528_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003582881.1|535530_536784_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|537407_538061_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP039707	Lactobacillus paracasei strain Lp02 chromosome, complete genome	2991176	946427	1059753	2991176	holin,integrase,transposase	Lactobacillus_phage(42.42%)	102	946408:946467	994730:995780
946408:946467	attL	CCTAGATTGCAATAATAAAGTTACCACCTAGAAAGAGGCTTGCTCACTGCTTGAACTGGG	NA	NA	NA	NA
WP_003574021.1|946427_947348_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003573651.1|948523_949108_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.9	5.9e-35
WP_003589896.1|949366_952096_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003577843.1|952088_952805_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003573655.1|952815_953820_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003577845.1|953893_954970_+	class C sortase	NA	NA	NA	NA	NA
WP_003573657.1|955160_955895_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
WP_003577847.1|955887_957504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577850.1|957798_958497_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	5.8e-29
WP_016363087.1|958484_959600_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003577855.1|959702_960584_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	5.1e-22
WP_003577858.1|960580_961729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003577860.1|961757_962297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016381912.1|969698_975227_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_016380289.1|975732_978267_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.3	1.5e-66
WP_003577866.1|978873_980316_+	amino acid permease	NA	NA	NA	NA	NA
WP_003563498.1|980425_980929_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003573683.1|981107_982001_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
WP_003577882.1|982155_983022_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003563502.1|983038_983872_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003577885.1|983968_984859_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_173959111.1|984892_986110_+	MFS transporter	NA	NA	NA	NA	NA
WP_003577889.1|986128_987028_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003573694.1|987472_988288_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003577893.1|988321_989251_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
WP_003577895.1|989440_989986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577897.1|990306_991476_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.9	4.3e-218
WP_003573997.1|991588_991849_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_016368286.1|991938_992559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572177.1|992542_992779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016380288.1|992971_993679_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003574021.1|993848_994769_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_032786488.1|994777_995110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|995624_996068_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
994730:995780	attR	CCCAGTTCAAGCAGTGAGCAAGCCTCTTTCTAGGTGGTAACTTTATTATTGCAATCTAGGTTAATAAAGCTACTTATTTGCGCGGTTATTACTGTAGTCATATGTGCATACTTCTTTTGGCTGCTTTTTGATCATTTTGTTAGCAATAGGCGCAGCAAGACGGTTCAAATTGGCAGCACGGTCTTCATCGTCAGAATTGGCAAAAAGCAATATGTATCTTACTTCAGCAAATGTAGCAAGGAATTTAATACATCAAGCGAAATTGATTCATCTAAACTATTTGTGCTAAGGCATGACGCTGAAGCTGCTGCAGAAGTTTCTGGCGGGATTGTATTAACCTTGCCAATCAACATTGACGATCCAAACGAACTTAAATATTAGCAGGAATAATCCTGATTCAATGTAAATAAAAAGCGCGCCTGATGAGGGACGCGCTGGAGGCCAGACGTACGATTGAGAGTAAATGAAATCAAAGATTAGGAGTTGGCCTCCAATGACAGTATAGCAAACGCACATGTTGAAAGTACATTTAAAAGCATCAAAAAAGCGCGCCGGGTGTTGACGCGCTCTGGAGGCCAAACGTACACGTGATTGATAGCAAATGGAATCATTTAAAAGGAGTTGGCCTCCGTATGCAGTATACCAAAAAGCGCGTCACATAAGCAACGCGCGGGAGGTGCTTGAATCAGATTGTTCCCCCAACTTATAAGGTTAACACGCATAAGAAAGCATCTCCAAAGGTAGTATAGCAAAAGTCGCCCTGGATTAACAGGACGACTCAGTCTAACAAATCGAATTATTTGAACAGCAGGTATATCACAAAAAACAAAAGCGCACCACGAAGGCACGCTTATCCTACAAACCCAACCAAATCATACCATAAGGAGTGGACGCAGTGGTGCGAGCAACGAGATATTTTAGCCCAATTGATCATGATAAAACAATTGAAAACGCCAAAGAGGTCTTGGGGAACTACTGGCATCACAAGCGGCTCGCTCAACGCACCAAAATAGCGCTCAGAAGTCCCGTGATGGACGGCATGCCTAAGTCA	NA	NA	NA	NA
WP_003574021.1|996975_997896_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003583407.1|998540_999539_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	2.0e-54
WP_003573729.1|999734_999953_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|1001485_1001821_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|1001940_1002273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|1002302_1003031_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_173959329.1|1002964_1003906_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.5	3.1e-17
WP_016383324.1|1003951_1004815_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
WP_003582220.1|1005496_1005775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|1005786_1006053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|1006071_1006248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|1006249_1006477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582223.1|1006519_1007761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019891186.1|1007738_1009289_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_016368618.1|1009298_1009718_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_016381672.1|1009726_1010305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959112.1|1010331_1012788_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_103220153.1|1012784_1014842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582234.1|1014847_1015183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583424.1|1015166_1015763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016385212.1|1017673_1018684_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.6	9.0e-15
WP_016385211.1|1018699_1019344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019891178.1|1019340_1019748_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_173959113.1|1019737_1020559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049172368.1|1021152_1021332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049172366.1|1021372_1021618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528687.1|1021647_1022082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959114.1|1022074_1023319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959330.1|1023360_1023606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959115.1|1023592_1026136_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_011674169.1|1026475_1026580_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_049172356.1|1026735_1027125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587058.1|1027127_1027271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080978156.1|1027263_1027521_-	nitroreductase	NA	NA	NA	NA	NA
WP_152902784.1|1027598_1028760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	3.3e-29
WP_080978155.1|1028757_1028973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049172352.1|1028986_1029277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049172350.1|1029286_1029733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033573997.1|1031134_1031503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003581702.1|1032065_1033337_-	oxidoreductase	NA	NA	NA	NA	NA
WP_049171174.1|1033333_1034092_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_016511778.1|1034088_1034553_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_016511777.1|1034898_1035396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049169917.1|1035881_1037816_-	membrane protein	NA	NA	NA	NA	NA
WP_003600582.1|1037825_1038773_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	37.5	3.2e-46
WP_033573999.1|1038754_1039426_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_033574000.1|1039415_1040066_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_033574001.1|1040282_1041641_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003572018.1|1041650_1042346_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.2e-36
WP_100216635.1|1042596_1043384_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075760724.1|1043848_1045675_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	4.4e-60
WP_173959116.1|1045740_1046424_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	50.4	4.4e-58
WP_003572054.1|1046628_1046871_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	36.1	4.0e-06
WP_003572052.1|1046916_1047567_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.0	1.5e-23
WP_003572050.1|1047563_1048319_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_173959117.1|1049183_1049971_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033574005.1|1050601_1051021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582572.1|1051127_1051496_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003582569.1|1051790_1052141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582565.1|1052435_1052903_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
WP_108315962.1|1053116_1053395_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	94.3	3.9e-29
WP_080988776.1|1053448_1054291_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.1	7.7e-153
WP_016374492.1|1054518_1055079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016374491.1|1055342_1055468_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.7	1.4e-15
WP_052915964.1|1055647_1056490_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	4.3e-156
WP_003582354.1|1056801_1057719_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003582352.1|1057865_1058474_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.4e-50
WP_003582350.1|1058484_1059753_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	48.2	2.2e-50
>prophage 3
NZ_CP039707	Lactobacillus paracasei strain Lp02 chromosome, complete genome	2991176	1347858	1389117	2991176	head,portal,tail,integrase,holin,tRNA,protease,terminase	Lactobacillus_phage(95.24%)	48	1333777:1333791	1382452:1382466
1333777:1333791	attL	AACCGGCTTTAAAGT	NA	NA	NA	NA
WP_003578174.1|1347858_1350270_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003564130.1|1350535_1352179_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003587481.1|1352183_1352894_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003569458.1|1353036_1353252_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003569460.1|1353367_1354189_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003564134.1|1354185_1354689_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_173959132.1|1355012_1356152_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.9	1.3e-216
WP_173959133.1|1356259_1357423_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_173959134.1|1357422_1358778_-	adenine-specific methyltransferase EcoRI family protein	NA	A0A1B0XVT8	Campylobacter_phage	36.8	1.1e-23
WP_173959135.1|1358899_1359766_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	95.1	9.7e-151
WP_016371933.1|1359752_1360112_-	helix-turn-helix transcriptional regulator	NA	A0A0P0I3L3	Lactobacillus_phage	63.9	1.8e-34
WP_003578190.1|1360381_1360579_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_173959136.1|1360575_1361298_+	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	99.2	5.8e-125
WP_003657835.1|1361494_1361719_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_173959137.1|1361807_1362020_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	97.1	8.1e-35
WP_173959138.1|1362029_1362905_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	98.3	2.3e-168
WP_173959139.1|1362907_1363102_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	95.3	7.9e-29
WP_173959140.1|1363101_1363956_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	72.2	1.1e-114
WP_173959141.1|1363964_1364210_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	96.3	1.4e-35
WP_173959142.1|1364214_1365048_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	89.7	6.5e-120
WP_020751505.1|1365085_1365907_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.6	3.0e-154
WP_173959143.1|1365903_1366203_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	87.9	6.7e-43
WP_128518393.1|1366165_1366450_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	96.8	2.8e-43
WP_173959144.1|1366758_1367337_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	96.9	1.9e-102
WP_173959145.1|1367353_1367773_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	97.1	1.8e-73
WP_173959146.1|1367835_1368054_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	83.3	1.4e-26
WP_173959147.1|1368394_1368832_+	transcriptional regulator	NA	A0A0P0IDA8	Lactobacillus_phage	48.6	7.8e-32
WP_019884709.1|1369675_1370056_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	97.6	4.8e-70
WP_003582259.1|1370125_1370500_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_173959148.1|1370502_1372233_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	99.1	0.0e+00
WP_173959149.1|1372251_1373487_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	98.8	7.1e-232
WP_136868186.1|1373464_1374172_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	98.3	8.8e-126
WP_173959150.1|1375481_1375748_+	hypothetical protein	NA	A0A1B0Y2R9	Lactobacillus_phage	100.0	6.6e-26
WP_003582271.1|1375761_1376088_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|1376026_1376365_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491256.1|1376348_1376678_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	100.0	3.1e-57
WP_136868189.1|1376667_1377051_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	97.6	8.5e-67
WP_003657874.1|1377062_1377710_+	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	95.8	4.1e-114
WP_003595114.1|1377786_1378152_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_003582283.1|1378231_1378393_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	100.0	7.5e-25
WP_173959151.1|1378412_1381385_+	tape measure protein	NA	A0A0P0IZN3	Lactobacillus_phage	95.5	3.6e-282
WP_173959152.1|1381391_1382087_+|tail	phage tail protein	tail	A0A1B0Y2S2	Lactobacillus_phage	95.7	1.5e-125
WP_173959153.1|1382083_1386490_+|tail	phage tail protein	tail	A0A0N7IRA4	Lactobacillus_phage	97.4	0.0e+00
1382452:1382466	attR	AACCGGCTTTAAAGT	NA	NA	NA	NA
WP_173959154.1|1386518_1386944_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	98.6	1.3e-71
WP_003578211.1|1386946_1387216_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	96.6	1.3e-37
WP_003578213.1|1387261_1387555_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	86.5	3.0e-40
WP_003578216.1|1387544_1387961_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	93.6	1.8e-41
WP_173959155.1|1387971_1389117_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	52.8	6.9e-88
>prophage 4
NZ_CP039707	Lactobacillus paracasei strain Lp02 chromosome, complete genome	2991176	1502601	1556994	2991176	head,portal,capsid,integrase,tRNA,terminase	Staphylococcus_phage(25.0%)	57	1515204:1515220	1560156:1560172
WP_003569677.1|1502601_1503063_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003569679.1|1503512_1504409_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	7.9e-23
WP_173959162.1|1504401_1505661_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569683.1|1505794_1506337_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	4.8e-23
WP_003569685.1|1506348_1507107_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	6.9e-60
WP_016365007.1|1507290_1508160_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003569689.1|1508181_1510290_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003564356.1|1510595_1511135_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003564358.1|1511148_1512237_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.6	9.9e-36
WP_003564360.1|1512336_1513161_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.9	1.3e-11
WP_003569692.1|1513150_1513990_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569694.1|1513973_1515047_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1515204:1515220	attL	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
WP_003564368.1|1515387_1515582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569696.1|1515651_1515846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569698.1|1516064_1518857_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	1.6e-74
WP_003569700.1|1518960_1519605_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003590309.1|1519642_1520782_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569702.1|1520771_1521506_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	2.5e-27
WP_003564381.1|1521769_1522627_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_003569703.1|1522623_1523709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564385.1|1523730_1525095_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016381157.1|1525410_1527222_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	37.5	5.8e-89
WP_016383098.1|1527199_1527340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569705.1|1527429_1529235_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_003587541.1|1529309_1529801_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003564397.1|1529871_1530603_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003569709.1|1530728_1531595_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_003564402.1|1532548_1532872_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003569714.1|1532868_1533309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569715.1|1533353_1533590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569716.1|1533549_1534011_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003569717.1|1533994_1534327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569719.1|1534429_1535440_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003564414.1|1535658_1536117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959163.1|1536255_1537644_+	amino acid permease	NA	NA	NA	NA	NA
WP_003564418.1|1537843_1538608_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003564420.1|1538604_1539444_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_173959164.1|1539444_1540401_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003569724.1|1540397_1541267_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016381731.1|1541544_1543836_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_003569727.1|1544106_1544415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016380956.1|1544686_1545835_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	28.9	1.0e-30
WP_016380957.1|1545933_1546635_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQE6	Staphylococcus_phage	38.0	4.0e-06
WP_016380958.1|1546782_1547061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016380959.1|1547128_1547350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016380962.1|1547700_1547991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571964.1|1547987_1548176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382146.1|1548159_1548972_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
WP_016380374.1|1548975_1550568_+	phage/plasmid primase P4 family protein	NA	A0A1B1P7L5	Bacillus_phage	27.6	1.0e-25
WP_016380373.1|1550888_1551224_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016380372.1|1551228_1551414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016380371.1|1551410_1551833_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.7	8.3e-23
WP_003574359.1|1551949_1552420_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_016380370.1|1552416_1554120_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.3	1.2e-117
WP_003574365.1|1554085_1554265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382144.1|1554269_1555448_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.3	2.2e-60
WP_016382143.1|1555437_1556994_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.5	2.8e-39
1560156:1560172	attR	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
>prophage 5
NZ_CP039707	Lactobacillus paracasei strain Lp02 chromosome, complete genome	2991176	2825041	2904735	2991176	bacteriocin,transposase,tRNA,protease	Bacillus_phage(26.67%)	76	NA	NA
WP_016366615.1|2825041_2826448_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.6	2.0e-52
WP_003580769.1|2826835_2828230_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003580771.1|2828355_2828943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580773.1|2828942_2829134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|2829609_2831103_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003580775.1|2831250_2832231_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_016380703.1|2832346_2833018_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003567235.1|2833201_2834032_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003577825.1|2834177_2835017_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567242.1|2836051_2836426_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003577830.1|2836590_2837862_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_052916105.1|2838027_2840193_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	1.1e-38
WP_003577835.1|2840293_2840407_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_080596037.1|2840450_2840561_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003577837.1|2840598_2841375_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016366635.1|2841378_2842284_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	1.6e-34
WP_003580795.1|2842564_2843461_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567252.1|2843564_2844680_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003580798.1|2844701_2846066_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2846082_2846625_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2846846_2847137_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_016383326.1|2847524_2848445_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.0	1.5e-21
WP_003571381.1|2848927_2850247_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_003576225.1|2850479_2851826_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003580801.1|2852053_2853154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959321.1|2853150_2854347_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003576231.1|2854409_2855288_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2855449_2857504_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_016381637.1|2857661_2860292_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	8.4e-89
WP_003576237.1|2860453_2861077_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016381826.1|2861576_2862248_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003580809.1|2862760_2863882_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2863895_2864180_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003585543.1|2864370_2865486_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2865673_2865880_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2866011_2866269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2866339_2866546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2866770_2867022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2867349_2868582_+	MFS transporter	NA	NA	NA	NA	NA
WP_003580815.1|2868660_2869917_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	54.0	6.2e-106
WP_003585549.1|2870005_2870839_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	5.6e-47
WP_003567298.1|2871155_2871350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580821.1|2871603_2872140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580823.1|2872328_2873552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580824.1|2874140_2874968_-	class C sortase	NA	NA	NA	NA	NA
WP_003580826.1|2874974_2876534_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_173959322.1|2876530_2877853_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_003585557.1|2877854_2880860_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003580832.1|2881137_2881695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580834.1|2881789_2882986_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003585559.1|2883194_2884250_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003580838.1|2884520_2885168_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.7e-06
WP_003567322.1|2885303_2885633_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003580841.1|2885629_2886418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580842.1|2886470_2887259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2887303_2887582_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2887605_2887890_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580847.1|2888082_2888379_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2888480_2889836_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2890140_2890452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2890524_2890875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003585563.1|2891048_2892428_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003585566.1|2892438_2894631_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	1.1e-36
WP_003571414.1|2895096_2895234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580853.1|2895423_2896722_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2896726_2897533_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016383118.1|2897894_2898092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580868.1|2898638_2898878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675994.1|2899137_2899311_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567358.1|2899345_2899534_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567359.1|2899855_2900080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245353.1|2900364_2901285_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003580872.1|2901935_2902748_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003580874.1|2903305_2903638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576306.1|2903889_2904081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580886.1|2904399_2904735_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP039709	Lactobacillus paracasei strain Lp02 plasmid pLp02-2, complete sequence	47041	0	8565	47041	transposase	Shigella_phage(20.0%)	8	NA	NA
WP_072672326.1|552_1380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072672328.1|1608_2691_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_080596909.1|2908_3238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173959349.1|3247_4189_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	29.3	4.3e-19
WP_003582147.1|4122_4851_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_143145457.1|4919_5783_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	2.6e-23
WP_112199679.1|6640_7322_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.8e-60
WP_011668826.1|7425_8565_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	2.4e-24
>prophage 2
NZ_CP039709	Lactobacillus paracasei strain Lp02 plasmid pLp02-2, complete sequence	47041	11773	14549	47041	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_013245703.1|11773_13018_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	4.9e-47
WP_072672273.1|13898_14549_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	2.5e-18
>prophage 3
NZ_CP039709	Lactobacillus paracasei strain Lp02 plasmid pLp02-2, complete sequence	47041	34616	35779	47041	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_128538915.1|34616_35779_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.6e-28
>prophage 4
NZ_CP039709	Lactobacillus paracasei strain Lp02 plasmid pLp02-2, complete sequence	47041	43046	46052	47041	transposase	Enterococcus_phage(50.0%)	4	NA	NA
WP_003582592.1|43046_43928_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.6	5.0e-38
WP_003582590.1|43920_44307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173959348.1|44442_45354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002816607.1|45368_46052_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
