The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	18096	68659	3703014	tail,transposase,tRNA	Microbacterium_phage(22.22%)	42	NA	NA
WP_020829879.1|18096_19098_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_086004752.1|19232_20035_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_016726789.1|20112_20592_-	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	46.7	2.0e-28
WP_020830875.1|20719_21877_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_020830876.1|21873_22701_-	thiazole synthase	NA	NA	NA	NA	NA
WP_013213874.1|22710_22938_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_043897620.1|22934_24074_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172833519.1|24087_25941_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_019717362.1|26400_27585_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_020830880.1|27624_32643_-	autotransporter domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	52.9	3.9e-10
WP_016722569.1|33146_33695_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016722568.1|33704_34238_+|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	2.6e-13
WP_011000085.1|34252_34774_+|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.6e-15
WP_016722567.1|34848_35151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000087.1|35171_35666_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011000088.1|35752_37426_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016722564.1|37801_38701_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020830883.1|38718_40443_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	31.9	5.4e-60
WP_020830884.1|40900_41266_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_019719041.1|41409_42429_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020830886.1|43063_43285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144061914.1|43511_44903_-	YncE family protein	NA	NA	NA	NA	NA
WP_011000095.1|45271_45730_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830889.1|45871_46480_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011000097.1|46493_47630_-	HPP family protein	NA	NA	NA	NA	NA
WP_020830890.1|47883_49857_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_043897884.1|49877_50759_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830892.1|51067_51361_+	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_011000101.1|51433_52624_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.9	1.7e-121
WP_016726803.1|52864_53713_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_016726804.1|53730_54624_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_043885954.1|54702_55581_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011000105.1|55635_56463_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_016722549.1|56582_57263_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011000107.1|57294_58080_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_086004752.1|58495_59297_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_020829879.1|59432_60434_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011000146.1|61871_62327_+	universal stress protein	NA	NA	NA	NA	NA
WP_011000145.1|63161_65000_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	46.3	2.1e-150
WP_016722521.1|65113_66481_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.7	1.8e-34
WP_173361999.1|66652_67636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000142.1|67720_68659_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	70.1	1.5e-101
>prophage 2
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	302087	389250	3703014	tail,terminase,capsid,head,portal,transposase	Acidithiobacillus_phage(47.5%)	75	NA	NA
WP_064047877.1|302087_303476_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	81.4	8.1e-216
WP_016722453.1|303472_303922_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	8.8e-55
WP_173940729.1|304224_305403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173940730.1|305562_307800_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.2	9.7e-288
WP_064047874.1|307849_308311_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	64.1	6.9e-47
WP_089190378.1|308539_308803_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
WP_016725622.1|308813_309296_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.8	1.0e-45
WP_139233340.1|309292_309844_+	HNH endonuclease	NA	A0A172JFU7	Citrobacter_phage	39.2	2.2e-23
WP_011003123.1|309815_310721_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.2	2.4e-104
WP_016725624.1|310717_311365_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.6	7.9e-81
WP_038937632.1|311372_311885_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	66.9	4.6e-52
WP_016725626.1|311884_312433_+	HNH endonuclease	NA	A0A1B0TRC1	Escherichia_phage	39.3	3.1e-22
WP_011003119.1|312419_313178_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	62.1	1.3e-82
WP_016725627.1|313174_313435_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	8.4e-18
WP_173940731.1|313431_315720_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.6	1.1e-286
WP_118940519.1|315850_316315_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	66.9	1.7e-53
WP_011003115.1|316316_316526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021154679.1|316518_316902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|316956_317223_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_118940520.1|317222_317522_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064047870.1|318171_319572_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	8.5e-165
WP_020833017.1|319568_320789_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.5	1.4e-192
WP_020371857.1|320831_321197_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	8.5e-32
WP_016726852.1|321421_321610_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_020833014.1|321731_322247_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	68.7	2.3e-22
WP_107523986.1|322352_322691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833012.1|322710_323247_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	81.5	5.5e-72
WP_020833011.1|323246_325229_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.1	0.0e+00
WP_016727881.1|325272_325782_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	2.8e-25
WP_020833053.1|325792_326185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|326185_326407_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_058908381.1|326406_327954_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_058908382.1|327963_329214_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.1	1.0e-60
WP_071508058.1|329223_329601_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.8	2.3e-24
WP_021154689.1|329607_330612_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.2	2.5e-110
WP_021154690.1|330614_330917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727774.1|330922_331369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|331495_332269_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_016723647.1|332277_332673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938671.1|332669_332891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832998.1|332865_333510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723655.1|333552_333843_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_020832996.1|334028_335495_-	type III secretion system YopJ family effector PopP2	NA	NA	NA	NA	NA
WP_071895622.1|336104_337232_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.6	9.1e-101
WP_173940732.1|337297_341401_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	27.8	3.5e-25
WP_020832994.1|341406_341802_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	1.6e-31
WP_173940733.1|341802_345393_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.2	0.0e+00
WP_173940734.1|345404_346571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940735.1|346574_347057_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	32.4	9.8e-12
WP_173940736.1|347053_347452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940737.1|347456_349301_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.4	1.3e-107
WP_058907698.1|349310_349535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003270772.1|349602_349893_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_020832987.1|349889_350366_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_058907697.1|350362_350824_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.0	4.3e-65
WP_020832985.1|350891_351191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885536.1|351253_351592_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_143012824.1|361043_361763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075463064.1|362524_365065_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.2	7.5e-18
WP_075463066.1|365076_366828_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071893100.1|366840_367686_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016726423.1|368186_368975_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_043897847.1|369723_370224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043876768.1|371739_372540_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011003055.1|372718_373297_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_020832973.1|373293_374196_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081049985.1|374208_375372_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_043897846.1|375368_377471_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_043897845.1|377633_380672_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016724436.1|380836_381532_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043897844.1|381597_383529_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_020832966.1|383855_384986_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020832965.1|385027_386308_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011003046.1|386593_387430_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831502.1|387921_389250_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	921246	963626	3703014	transposase,tRNA,coat	uncultured_Mediterranean_phage(42.86%)	42	NA	NA
WP_011002630.1|921246_922359_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_028853617.1|922447_924046_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016723723.1|924071_924680_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011002627.1|924913_926287_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.0	3.8e-109
WP_020832660.1|926533_927118_+	cytochrome b	NA	NA	NA	NA	NA
WP_016723720.1|927218_927785_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_019718267.1|927842_928439_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_016725726.1|928572_929901_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_016723719.1|929960_930929_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	8.8e-44
WP_011002622.1|931006_932887_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_063612207.1|933008_933341_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.0e-12
WP_016723717.1|933449_934601_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	9.4e-77
WP_020832657.1|934594_935683_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_020832656.1|935759_937952_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016723714.1|937970_938174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002617.1|938185_938626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081263796.1|938849_939029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832653.1|939172_940303_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_043897937.1|940445_941387_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020832651.1|941577_942801_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_020832650.1|942845_944132_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_020832649.1|944497_944959_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020832648.1|945169_946366_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016721870.1|946836_947823_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_043897800.1|948928_949471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172833515.1|949540_950029_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_020832638.1|950046_952311_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_020832639.1|952360_953080_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011002604.1|953198_953702_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002605.1|953751_954255_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723696.1|955600_955861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853597.1|955877_956738_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_011002607.1|956834_957131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|957281_957599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832642.1|957717_957855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832643.1|958938_959223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002610.1|959316_959643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081263795.1|960085_960250_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	3.2e-07
WP_028853600.1|961019_961274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940760.1|961805_962015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723702.1|962065_962383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|962639_963626_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
>prophage 4
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	1033992	1044131	3703014		Hokovirus(14.29%)	9	NA	NA
WP_021155204.1|1033992_1035954_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_011002544.1|1036088_1037231_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_020832589.1|1037266_1039147_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	2.7e-57
WP_011002542.1|1039102_1039789_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_016724068.1|1039796_1040504_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016724069.1|1040515_1041340_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
WP_016724070.1|1041396_1042041_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.3	8.3e-06
WP_003271964.1|1042074_1042584_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_021155205.1|1042583_1044131_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 5
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	1134301	1143585	3703014	protease	Phage_21(16.67%)	9	NA	NA
WP_016725925.1|1134301_1135552_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	7.4e-11
WP_016724132.1|1135778_1135991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002384.1|1136179_1136800_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_011002383.1|1137449_1137653_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.8	1.7e-21
WP_011002382.1|1138206_1138533_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	37.4	7.9e-13
WP_011002381.1|1138529_1140818_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	7.1e-169
WP_011002380.1|1140887_1141334_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.7	5.1e-47
WP_020832525.1|1141330_1142383_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020832524.1|1142379_1143585_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	3.4e-37
>prophage 6
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	1709184	1716323	3703014	transposase,integrase	Synechococcus_phage(16.67%)	8	1711054:1711073	1725850:1725869
WP_020832213.1|1709184_1710051_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.4	2.0e-10
WP_016727001.1|1710068_1710797_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.9	2.8e-34
1711054:1711073	attL	TGGGGGTATTTTTGGGGGTA	NA	NA	NA	NA
WP_173940768.1|1711105_1712323_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	53.8	1.2e-119
WP_016721735.1|1712536_1713502_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|1713498_1713648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940769.1|1713962_1714157_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	48.0	2.9e-07
WP_173940770.1|1714156_1714531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940771.1|1714517_1716323_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	3.5e-70
1725850:1725869	attR	TGGGGGTATTTTTGGGGGTA	NA	NA	NA	NA
>prophage 7
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	1789343	1816429	3703014	transposase,integrase	Leptospira_phage(33.33%)	24	1801557:1801604	1816708:1816755
WP_020830182.1|1789343_1790168_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_173940775.1|1790248_1791217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832175.1|1791213_1792218_+	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_064047844.1|1793475_1794534_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081282089.1|1795212_1796304_+	DUF262 domain-containing protein	NA	A0A1V0SDN5	Indivirus	30.4	2.0e-07
WP_052328807.1|1796306_1796813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043897749.1|1797121_1797355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832173.1|1797632_1799189_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.6	7.0e-75
WP_020829705.1|1799221_1799575_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	1.2e-19
WP_043885814.1|1799571_1800054_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_144061896.1|1800091_1800988_-	hypothetical protein	NA	NA	NA	NA	NA
1801557:1801604	attL	TTGGCCTGCCCAGAGGGATTCGAACCCCCGACCGTCGGCTTAGAAGGC	NA	NA	NA	NA
WP_020832172.1|1801716_1802736_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	36.0	2.7e-51
WP_144061895.1|1802769_1803816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043897746.1|1804228_1804690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043897652.1|1804927_1806133_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_173940776.1|1806503_1807364_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_043897745.1|1807478_1808087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052328806.1|1808179_1808836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043897744.1|1809615_1810194_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	42.6	3.4e-27
WP_043897743.1|1810904_1811711_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_043897741.1|1811809_1812115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144061894.1|1812143_1812824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144061893.1|1812859_1815163_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_043897920.1|1815373_1816429_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	56.9	3.8e-101
1816708:1816755	attR	TTGGCCTGCCCAGAGGGATTCGAACCCCCGACCGTCGGCTTAGAAGGC	NA	NA	NA	NA
>prophage 8
NZ_CP052124	Ralstonia solanacearum strain FJAT1452.F1 chromosome, complete genome	3703014	2767240	2827929	3703014	transposase	Acidithiobacillus_phage(26.32%)	47	NA	NA
WP_020831502.1|2767240_2768569_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011000869.1|2768703_2769606_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|2769709_2770027_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_020831501.1|2770156_2771152_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	7.0e-28
WP_019717811.1|2771148_2772096_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2772122_2773496_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
WP_011000864.1|2773555_2774833_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_043897668.1|2774836_2775166_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_016723345.1|2775351_2775774_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_011000861.1|2775810_2777499_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_011000860.1|2777638_2778331_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_020831497.1|2778354_2779665_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_029240256.1|2779686_2780583_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_016723348.1|2780679_2781804_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	27.7	1.2e-15
WP_011000856.1|2781862_2782978_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_064047660.1|2783066_2784203_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.6	4.4e-87
WP_016723349.1|2784317_2784878_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_064047659.1|2785004_2787662_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.0e-102
WP_011000852.1|2788070_2788727_+	OmpA family protein	NA	NA	NA	NA	NA
WP_020831496.1|2788884_2789376_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019717804.1|2789537_2790254_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011000849.1|2790250_2790940_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_020831495.1|2791048_2794834_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_058908849.1|2795736_2796636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|2797819_2798806_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016721735.1|2798962_2799928_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|2799924_2800074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081282099.1|2800827_2801268_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_064820716.1|2801300_2802683_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.9	1.5e-134
WP_038938302.1|2802679_2803177_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	9.2e-21
WP_071895564.1|2803177_2803417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069078908.1|2805233_2807000_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_118872359.1|2807078_2807897_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_016725636.1|2818969_2819920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079307.1|2820374_2820713_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_064048075.1|2820775_2821075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003080.1|2821142_2821604_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	1.1e-65
WP_071895569.1|2821600_2822083_-	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	48.3	4.7e-22
WP_011003082.1|2822069_2822552_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.6	4.8e-59
WP_064047856.1|2822548_2822839_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	47.6	7.0e-13
WP_011003084.1|2822905_2823130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830964.1|2823364_2824384_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	2.1e-43
WP_155738951.1|2824409_2824559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|2824555_2825521_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738996.1|2825719_2826352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003086.1|2826510_2827047_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
WP_173940790.1|2827104_2827929_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP052125	Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence	1981451	538954	605073	1981451	transposase	uncultured_Caudovirales_phage(16.67%)	49	NA	NA
WP_019719041.1|538954_539974_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020829739.1|540218_540389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173940845.1|540397_543136_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.4	7.7e-85
WP_144061944.1|543138_543462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019719248.1|543577_544621_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	8.4e-16
WP_020829737.1|544894_546223_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_020829735.1|546388_548173_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.6	3.8e-85
WP_043898039.1|548183_550073_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011003826.1|550207_550873_+	response regulator	NA	NA	NA	NA	NA
WP_011003827.1|550869_552348_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	3.3e-18
WP_016724461.1|552477_553089_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003829.1|553191_553623_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016724459.1|553793_554303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043898037.1|554411_555767_+	TolC family protein	NA	NA	NA	NA	NA
WP_016724457.1|556976_560126_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.9	1.8e-66
WP_011003834.1|560122_560446_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_020829729.1|560537_562784_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	2.6e-54
WP_020829727.1|563445_563886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898035.1|564389_565169_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_020829725.1|565321_566233_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	47.3	5.3e-75
WP_028854170.1|566397_567720_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	50.0	4.6e-104
WP_086004752.1|567933_568735_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_043898033.1|568918_569320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003842.1|569584_570727_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173940846.1|570907_581566_+	hemagglutinin repeat-containing protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	36.8	4.1e-09
WP_081263828.1|581565_582066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043898032.1|582096_582597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081263829.1|582600_583020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940847.1|583757_584129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100243798.1|584348_584534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144061942.1|584530_585052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047948.1|585094_586864_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_052328822.1|587536_588904_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016725378.1|589196_590324_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_011003854.1|590425_590698_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011003855.1|590830_591802_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_011003856.1|591820_593026_+	chromate transporter	NA	NA	NA	NA	NA
WP_016725380.1|593079_593586_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_173877492.1|593803_594028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003864.1|595202_595760_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_020371953.1|595749_596793_-	transporter	NA	NA	NA	NA	NA
WP_038938585.1|596883_597261_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_086004752.1|597651_598453_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_019719041.1|598826_599846_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043898030.1|601068_601509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064820709.1|601852_602167_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020831836.1|602215_603343_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081263830.1|603363_603936_-	mannose-binding lectin protein	NA	NA	NA	NA	NA
WP_016721870.1|604086_605073_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
>prophage 2
NZ_CP052125	Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence	1981451	807755	829116	1981451	transposase,plate	Vibrio_phage(33.33%)	15	NA	NA
WP_019719429.1|807755_809102_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_043898101.1|809145_809820_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011004040.1|810094_810742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724835.1|810778_811291_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011004042.1|811283_812774_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011004043.1|812862_813366_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_016724834.1|813426_813900_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016726997.1|813962_815813_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_020371627.1|815776_816868_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020830186.1|816900_819618_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_020830185.1|819638_822395_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.6	2.1e-37
WP_043898209.1|822412_823546_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_020830182.1|825830_826655_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_144061949.1|826717_827167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940856.1|828313_829116_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.2	3.1e-26
>prophage 3
NZ_CP052125	Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence	1981451	1022171	1056092	1981451	transposase,integrase	Salmonella_phage(20.0%)	24	1014298:1014314	1047625:1047641
1014298:1014314	attL	GCATCGCGGTCCGGCGC	NA	NA	NA	NA
WP_086706442.1|1022171_1023881_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058908723.1|1023886_1026871_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.5	2.8e-80
WP_165591970.1|1026931_1029154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633711.1|1029384_1029570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719551.1|1029568_1031269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	25.2	2.6e-06
WP_029240537.1|1031488_1031983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719553.1|1032088_1034032_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_020425328.1|1034051_1034843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898203.1|1034905_1035919_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011004204.1|1036327_1036711_-	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
WP_080511113.1|1036814_1037729_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_016723110.1|1037805_1038474_-	DsbA family protein	NA	NA	NA	NA	NA
WP_011004207.1|1038576_1039506_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830058.1|1039645_1040839_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011004209.1|1040920_1041862_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_016727628.1|1042158_1043265_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_043898082.1|1045641_1046211_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723104.1|1046262_1046925_+	membrane protein	NA	NA	NA	NA	NA
WP_043885814.1|1047396_1047879_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1047625:1047641	attR	GCGCCGGACCGCGATGC	NA	NA	NA	NA
WP_020829705.1|1047875_1048229_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_020832173.1|1048261_1049818_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.6	7.0e-75
WP_043898081.1|1050648_1051608_-	type III effector protein	NA	NA	NA	NA	NA
WP_086004752.1|1054227_1055030_-|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_020829649.1|1055075_1056092_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	2.1e-43
>prophage 4
NZ_CP052125	Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence	1981451	1767211	1837640	1981451	protease,coat,transposase	Bacillus_phage(27.27%)	53	NA	NA
WP_011004747.1|1767211_1767733_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723579.1|1768235_1768820_-	SCO family protein	NA	NA	NA	NA	NA
WP_020830504.1|1768816_1769608_-	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_020830505.1|1769627_1771121_-	nitrite reductase, copper-containing	NA	NA	NA	NA	NA
WP_011004751.1|1771398_1771701_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_011004752.1|1771744_1774015_+	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_016723583.1|1774273_1774996_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004754.1|1775054_1775840_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	3.0e-34
WP_011004755.1|1775829_1776726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020830507.1|1776773_1777814_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011004757.1|1777847_1778246_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_019719870.1|1778744_1780148_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.6	2.3e-21
WP_011004758.1|1780333_1780552_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_020830508.1|1780659_1781358_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011004760.1|1781439_1781877_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_020830509.1|1781990_1782875_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004762.1|1782951_1783344_-	RidA family protein	NA	NA	NA	NA	NA
WP_020830510.1|1783340_1784312_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_020830511.1|1784308_1784953_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020371801.1|1786086_1787997_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_028854659.1|1788439_1788976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020830514.1|1789083_1790787_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	4.9e-13
WP_064048019.1|1790795_1791494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155598.1|1791608_1793432_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_064048021.1|1793428_1796080_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_014632055.1|1796412_1796601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898155.1|1796946_1798464_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_043898156.1|1798663_1800373_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_019719859.1|1800947_1802273_+	DUF3500 domain-containing protein	NA	A0A0H3UCT5	Escherichia_phage	51.3	7.4e-09
WP_020830519.1|1802298_1803549_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_020830520.1|1803711_1804209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830521.1|1804582_1805620_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_043885670.1|1805734_1807882_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_016725441.1|1808496_1808964_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_016725440.1|1808963_1809350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064048022.1|1809589_1810429_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_064048023.1|1810446_1812198_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_173940869.1|1812209_1814750_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.0	4.6e-15
WP_016721870.1|1815258_1816245_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_038937983.1|1816539_1817112_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_071653919.1|1817144_1817621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725060.1|1826272_1826488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011004794.1|1826714_1827227_+	DUF1993 family protein	NA	NA	NA	NA	NA
WP_011004795.1|1827384_1827714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725058.1|1827877_1828399_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011004797.1|1828495_1828858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725057.1|1829047_1830520_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	1.6e-25
WP_019719841.1|1830682_1831999_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	3.6e-16
WP_016725055.1|1832005_1832737_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	1.3e-28
WP_043898158.1|1832875_1835056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155738951.1|1835311_1835461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|1835457_1836423_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_086005097.1|1836489_1837640_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
