The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	215327	248259	3984235	head,capsid,transposase,terminase,portal	Acidithiobacillus_phage(56.25%)	43	NA	NA
WP_064047878.1|215327_215804_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	53.2	2.2e-40
WP_016722451.1|215800_216175_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	65.4	3.2e-42
WP_064047877.1|216171_217560_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	81.4	8.1e-216
WP_016722453.1|217556_218006_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	8.8e-55
WP_016722454.1|218308_218716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005097.1|218803_219953_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
WP_016722457.1|219969_220722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722458.1|220881_223119_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	65.7	7.0e-286
WP_016722459.1|223168_223630_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	64.7	2.4e-47
WP_173877469.1|223858_224122_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	75.4	1.1e-20
WP_016722461.1|224132_224615_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	59.4	1.4e-45
WP_038962121.1|224611_225472_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.6	3.4e-108
WP_038962122.1|225468_226110_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	73.3	3.0e-80
WP_038962123.1|226117_226594_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	65.6	8.7e-53
WP_071893031.1|226593_227331_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	4.9e-111
WP_016725337.1|227327_227588_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	1.4e-17
WP_021154677.1|227584_229873_+	bacteriophage-related protein	NA	K4HZY1	Acidithiobacillus_phage	63.2	8.4e-287
WP_016725339.1|230003_230468_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
WP_011003115.1|230469_230679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725340.1|230671_231055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|231109_231376_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_011003112.1|231375_231675_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071893036.1|232225_233626_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	1.3e-165
WP_071893040.1|233622_234843_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.7	2.7e-191
WP_016723619.1|235022_235988_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071893043.1|236063_236429_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.8	2.9e-32
WP_016725347.1|236596_236791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725348.1|236952_237321_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	45.0	3.8e-16
WP_016726852.1|237475_237664_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_016725351.1|237785_238280_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	56.3	2.4e-21
WP_011000804.1|238369_238642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962858.1|238735_239272_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_071893046.1|239271_241239_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.6	0.0e+00
WP_071893050.1|241282_241792_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	47.1	1.3e-25
WP_071893053.1|241802_242195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725356.1|242195_242417_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016725355.1|242416_243943_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_071893056.1|243952_245203_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	44.7	2.4e-62
WP_021154688.1|245212_245590_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	6.1e-25
WP_021154689.1|245598_246603_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.2	2.5e-110
WP_021154690.1|246605_246908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727774.1|246913_247360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|247485_248259_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
>prophage 2
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	253287	335462	3984235	transposase,protease,tail	Ralstonia_phage(33.33%)	60	NA	NA
WP_071893060.1|253287_257391_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.1	1.7e-27
WP_071893063.1|257396_257792_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	2.9e-30
WP_071893067.1|257778_258351_-	rloe protein	NA	NA	NA	NA	NA
WP_071893071.1|258380_261971_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.6	0.0e+00
WP_071893075.1|261993_263160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893078.1|263163_263646_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
WP_071893082.1|263642_264041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893085.1|264045_265890_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.9	4.5e-105
WP_016724634.1|265899_266124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724633.1|266191_266482_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058908401.1|266478_266955_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.8	6.4e-72
WP_071893089.1|266951_267413_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.0	1.7e-66
WP_016723628.1|267480_267780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028852787.1|267842_268181_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_016723616.1|277467_277827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773148.1|277951_278686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893092.1|279446_281987_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	1.7e-17
WP_071893096.1|281998_283750_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071893100.1|283762_284608_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016726423.1|285108_285897_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_071893105.1|286618_287440_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016724611.1|287589_289107_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_071654022.1|289332_290157_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016725373.1|290182_290518_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_016725374.1|290548_291166_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_016725375.1|291202_291646_-	cyanase	NA	NA	NA	NA	NA
WP_016725376.1|291787_293122_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.8	6.7e-10
WP_019718995.1|293442_294807_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_020371902.1|295175_295676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021156161.1|296186_297992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011003055.1|298170_298749_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_016724441.1|298745_299648_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016724440.1|299660_300824_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_016724439.1|300820_302923_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_016727280.1|303085_306118_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016724436.1|306282_306978_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016724435.1|307043_308975_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016724434.1|309301_310432_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016724433.1|310472_311750_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011003046.1|312035_312872_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016725726.1|313364_314693_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011003045.1|314745_314949_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	2.1e-16
WP_016724432.1|315276_315483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724430.1|316070_317249_+	antibiotic hydrolase	NA	NA	NA	NA	NA
WP_016724429.1|317685_318522_+	cytochrome c	NA	NA	NA	NA	NA
WP_016721735.1|319232_320198_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|320194_320344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724428.1|320581_322072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938383.1|322068_322911_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021154949.1|323094_325218_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003039.1|325958_326390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724425.1|327434_327776_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173651675.1|327922_328366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893108.1|328365_329514_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003035.1|329641_330034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021154951.1|330364_331270_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011003033.1|331323_332703_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.8e-13
WP_016727287.1|333018_333618_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_016724421.1|333876_334431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938388.1|334502_335462_+|protease	serine protease	protease	A0A0F6R5W6	Sinorhizobium_phage	30.0	1.3e-07
>prophage 3
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	394687	474937	3984235	head,plate,capsid,integrase,tail,transposase,terminase,portal,holin	Ralstonia_virus(58.0%)	104	436755:436800	474976:475021
WP_016725726.1|394687_396016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_016721987.1|396205_397231_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011002980.1|397234_397939_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_011002979.1|398021_398333_-	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_016721986.1|398513_398711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002978.1|399103_399442_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_016721984.1|400779_401541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038961978.1|401891_403016_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_071893115.1|403012_403510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895623.1|403512_405384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173877470.1|405511_406030_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_038961929.1|406149_407289_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_071893121.1|407366_409106_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071893123.1|409092_410517_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_081369064.1|410674_411418_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	36.4	2.8e-34
WP_016721919.1|411734_412055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895624.1|412305_412686_+	PHA-granule associated protein 4	NA	NA	NA	NA	NA
WP_155773149.1|412798_413134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173877471.1|413222_413666_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_155773150.1|413732_414308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721926.1|414339_415086_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_016721927.1|415122_415635_+	DUF2199 domain-containing protein	NA	NA	NA	NA	NA
WP_155773151.1|415669_416266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773152.1|416311_416920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038961946.1|416912_418325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773153.1|418454_419333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721930.1|419378_419708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721931.1|419704_420397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893129.1|420393_420930_-	PAAR domain-containing protein	NA	A0A0M4UVC5	Ralstonia_phage	51.7	7.5e-37
WP_016721933.1|421245_421533_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	51.2	8.2e-14
WP_155773154.1|421756_422074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721935.1|422417_422699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721936.1|422695_423181_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_016721937.1|423237_423525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721939.1|424270_424639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020371392.1|424683_425088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080606385.1|425288_425795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893132.1|425817_426096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773155.1|426143_426587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721942.1|426624_426924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721944.1|427654_427942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020371393.1|427998_428424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038961953.1|428524_428719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893137.1|428777_429281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173877472.1|429468_430011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721947.1|430777_431350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721948.1|431346_434187_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_071893140.1|434200_435244_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080606387.1|435256_436618_+	TniQ family protein	NA	NA	NA	NA	NA
436755:436800	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_016725467.1|437207_438071_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_080606484.1|438051_438360_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_038961960.1|438889_439300_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	77.5	7.0e-51
WP_071893147.1|439301_439805_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	82.0	2.5e-74
WP_038961967.1|439791_440139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038961969.1|440138_440747_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	82.2	3.5e-83
WP_016721959.1|440743_441472_+	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	97.5	2.5e-136
WP_071893150.1|441456_442563_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	97.8	9.6e-212
WP_071893154.1|442559_444341_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	97.8	0.0e+00
WP_071893157.1|444482_445322_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	98.6	1.6e-150
WP_011001874.1|445375_446392_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_016721968.1|446388_447111_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	98.3	1.3e-124
WP_011001872.1|447208_447688_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	100.0	2.3e-85
WP_011001871.1|447687_447894_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_015985092.1|447909_448314_+|holin	phage holin family protein	holin	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_016721970.1|448310_448625_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	98.1	5.0e-49
WP_016721971.1|448621_449428_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	99.6	1.1e-148
WP_071893159.1|449424_449922_+	hypothetical protein	NA	A4PE37	Ralstonia_virus	95.2	3.9e-80
WP_016721972.1|449918_450353_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	90.3	2.2e-71
WP_071893162.1|450349_450796_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	87.8	2.1e-64
WP_155773157.1|450819_451257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893168.1|451782_452400_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	96.1	4.1e-111
WP_016722200.1|452396_452744_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	99.1	1.7e-58
WP_016722201.1|452746_453655_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	97.7	2.5e-157
WP_016722202.1|453647_454265_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	97.8	1.3e-101
WP_071893171.1|454271_455936_+|tail	phage tail protein	tail	A4PE45	Ralstonia_virus	96.9	8.8e-310
WP_016722204.1|455948_456701_+|tail	tail assembly protein	tail	A0A077K9S5	Ralstonia_phage	95.6	1.3e-127
WP_038962047.1|456697_457162_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	100.0	5.3e-87
WP_069079166.1|457260_458436_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	99.0	4.7e-225
WP_011001854.1|458467_458977_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_038962052.1|459052_459379_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.1	1.8e-49
WP_011001852.1|459375_459477_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	97.0	2.1e-09
WP_071893173.1|459473_462137_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.5	0.0e+00
WP_016722210.1|462139_462562_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.1	1.9e-72
WP_081369065.1|462558_463683_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.0	3.5e-201
WP_071895454.1|463995_464205_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_016725465.1|464155_464938_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	67.8	4.1e-92
WP_015985112.1|464853_465600_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	100.0	9.6e-131
WP_038962909.1|465758_466175_-	helix-turn-helix transcriptional regulator	NA	A4PE57	Ralstonia_virus	97.8	1.8e-70
WP_071615658.1|466256_466457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727352.1|466476_466668_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
WP_016722220.1|466696_466891_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	95.3	1.3e-23
WP_016722221.1|466887_467136_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	98.8	2.3e-41
WP_015985117.1|467250_467805_+	Bro-N domain-containing protein	NA	A4PE61	Ralstonia_virus	100.0	1.2e-98
WP_016721653.1|467814_468048_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	94.8	6.4e-33
WP_071893181.1|468205_468412_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	95.6	2.1e-27
WP_016721678.1|468411_468648_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.7	3.5e-39
WP_071893185.1|468640_468853_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	95.7	2.7e-30
WP_016725459.1|468872_469181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725460.1|469182_469404_+	hypothetical protein	NA	A4PE67	Ralstonia_virus	100.0	1.3e-35
WP_016725461.1|469400_469673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725462.1|469669_469960_+	hypothetical protein	NA	A4PE68	Ralstonia_virus	95.8	1.4e-50
WP_071893188.1|469959_472764_+	toprim domain-containing protein	NA	A4PE69	Ralstonia_virus	99.4	0.0e+00
WP_155773158.1|472750_472924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015985128.1|473854_474937_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	100.0	2.7e-211
474976:475021	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
>prophage 4
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	909214	962688	3984235	transposase,coat,protease	Lactobacillus_phage(16.67%)	51	NA	NA
WP_071895425.1|909214_910543_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011002610.1|911055_911382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002609.1|911475_911760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832642.1|912843_912981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|913098_913416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002607.1|913568_913865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723697.1|913961_914822_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_016723696.1|914838_915099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002605.1|916444_916948_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002604.1|916997_917501_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723694.1|917619_918339_+	molecular chaperone	NA	NA	NA	NA	NA
WP_016723693.1|918388_920653_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016723692.1|920670_921159_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016723691.1|921228_921771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|922376_923321_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_016723689.1|923539_923788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002597.1|923846_924089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271865.1|924248_924749_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_069079120.1|924822_925698_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_011002595.1|925694_925973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002594.1|925994_926819_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011002593.1|926853_927576_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011002592.1|927700_928744_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011002591.1|928796_929936_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_016723685.1|930130_930571_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_016723684.1|930574_931063_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_011002588.1|931059_931650_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723683.1|931646_932675_+	PilW family protein	NA	NA	NA	NA	NA
WP_011002586.1|932678_933215_+	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016723682.1|933246_936459_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_016723681.1|936554_937052_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	3.3e-26
WP_016723680.1|937068_937767_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723679.1|937809_938289_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_016723678.1|938339_938735_-	VOC family protein	NA	NA	NA	NA	NA
WP_020832616.1|938893_939616_-	LrgB family protein	NA	NA	NA	NA	NA
WP_016723676.1|939612_939990_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_069079119.1|940041_941289_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_069079118.1|941298_942417_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_028853584.1|942427_943921_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016723672.1|944091_944982_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002574.1|944992_946411_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_020832612.1|946531_947089_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_016723670.1|947161_948058_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016723669.1|948342_948678_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011002570.1|948801_949881_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
WP_020832609.1|950273_951734_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_028860942.1|951761_952631_-	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	6.3e-09
WP_071895426.1|952636_956917_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_071895427.1|957096_959964_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011002565.1|959960_960581_+	rhombosortase	NA	NA	NA	NA	NA
WP_020832604.1|960636_962688_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.1e-10
>prophage 5
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	979694	989833	3984235		Hokovirus(14.29%)	9	NA	NA
WP_021155204.1|979694_981656_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_011002544.1|981790_982933_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_019718314.1|982968_984849_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.3	6.1e-57
WP_011002542.1|984804_985491_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_016724068.1|985498_986206_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016724069.1|986217_987042_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
WP_016724070.1|987098_987743_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.3	8.3e-06
WP_003271964.1|987776_988286_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_021155205.1|988285_989833_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 6
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	1600393	1678198	3984235	head,plate,capsid,integrase,tail,tRNA,transposase,terminase,portal,holin	Ralstonia_phage(42.31%)	83	1606136:1606155	1690356:1690375
WP_011001921.1|1600393_1601218_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016722989.1|1601214_1601919_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016722990.1|1602014_1603208_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011001918.1|1603212_1604025_+	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	37.4	1.3e-32
WP_011001917.1|1604039_1604837_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011001916.1|1604874_1605747_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011001915.1|1605828_1607127_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
1606136:1606155	attL	AGGCGGTCGAGCGCGCCCGC	NA	NA	NA	NA
WP_021155237.1|1607213_1608035_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011001913.1|1608107_1608605_+	CvpA family protein	NA	NA	NA	NA	NA
WP_011001912.1|1608699_1610235_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.0e-86
WP_020832236.1|1610361_1611183_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011001910.1|1611206_1612172_-	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.6e-24
WP_003264057.1|1612327_1612528_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011001909.1|1612950_1613442_+	phasin family protein	NA	NA	NA	NA	NA
WP_011001907.1|1613718_1613958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001906.1|1614101_1614422_+	membrane protein	NA	NA	NA	NA	NA
WP_021155235.1|1614631_1615429_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011001904.1|1615456_1615870_+	heme-binding protein	NA	NA	NA	NA	NA
WP_011001903.1|1616063_1616342_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_011001902.1|1616537_1616951_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011001901.1|1616960_1617692_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_019718620.1|1617728_1618388_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016725286.1|1618898_1621214_+	ATP-binding protein	NA	A0A0K1Y7P8	Apis_mellifera_filamentous_virus	30.7	5.2e-10
WP_011001897.1|1621341_1621698_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016725285.1|1621681_1622641_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_016725284.1|1622686_1623028_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_011001894.1|1623490_1624777_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011001893.1|1624897_1625731_-	glutamate racemase	NA	NA	NA	NA	NA
WP_016725283.1|1625751_1627275_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011001891.1|1627454_1627994_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_021155233.1|1628077_1629088_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016725281.1|1629252_1631235_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	1.3e-78
WP_021155232.1|1631256_1633323_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_016721870.1|1634851_1635838_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_058907201.1|1637754_1640415_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	100.0	0.0e+00
WP_016721870.1|1641057_1642044_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_081049899.1|1642581_1643343_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	100.0	1.9e-142
WP_058907204.1|1643348_1645589_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	100.0	0.0e+00
WP_071895446.1|1645655_1646741_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	99.4	1.4e-210
WP_071895447.1|1646737_1648519_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	98.5	0.0e+00
WP_016721963.1|1648662_1649502_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	95.0	5.9e-145
WP_011001874.1|1649555_1650572_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_016721968.1|1650568_1651291_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	98.3	1.3e-124
WP_011001872.1|1651388_1651868_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	100.0	2.3e-85
WP_011001871.1|1651867_1652074_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_015985092.1|1652089_1652494_+|holin	phage holin family protein	holin	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_071895448.1|1652490_1652802_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	100.0	1.7e-49
WP_016727332.1|1652798_1653605_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	99.6	4.2e-148
WP_058907209.1|1653601_1654102_+	hypothetical protein	NA	A4PE37	Ralstonia_virus	98.2	6.1e-81
WP_071895449.1|1654098_1654545_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	98.6	3.6e-77
WP_058907236.1|1654538_1654946_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	85.8	1.2e-55
WP_080606388.1|1655117_1656353_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.5	2.5e-11
WP_016721978.1|1656345_1657122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895450.1|1657238_1657856_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	96.1	2.4e-111
WP_058907212.1|1657852_1658200_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	93.9	3.0e-55
WP_069079171.1|1658202_1659111_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	97.4	5.0e-158
WP_071895451.1|1659103_1659721_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	98.9	3.1e-103
WP_071895452.1|1659725_1661390_+|tail	phage tail protein	tail	A4PE45	Ralstonia_virus	95.8	6.3e-308
WP_058907215.1|1661402_1662155_+	hypothetical protein	NA	A4PE47	Ralstonia_virus	94.4	6.7e-124
WP_058907216.1|1662151_1662616_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	99.4	1.5e-86
WP_058907217.1|1662714_1663890_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	98.7	1.4e-224
WP_011001854.1|1663921_1664431_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_058907237.1|1664506_1664833_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.1	2.3e-49
WP_003267618.1|1664829_1664931_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_071895453.1|1664927_1667591_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.4	0.0e+00
WP_058907219.1|1667593_1668016_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.9	8.8e-73
WP_058907220.1|1668012_1669137_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	97.1	7.5e-204
WP_071895454.1|1669449_1669659_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_016722215.1|1669609_1670359_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	67.2	7.9e-93
WP_071895455.1|1671071_1671422_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_051048313.1|1671484_1671943_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	52.3	5.8e-22
WP_157798370.1|1672001_1672199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722219.1|1672225_1672417_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	2.6e-08
WP_016722220.1|1672445_1672640_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	95.3	1.3e-23
WP_028853260.1|1672636_1672885_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	98.8	3.0e-41
WP_038961828.1|1672999_1673233_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	54.8	9.5e-13
WP_016721654.1|1673229_1673394_+	hypothetical protein	NA	A4PE63	Ralstonia_virus	81.5	1.1e-15
WP_058907222.1|1673390_1673597_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	92.6	4.3e-25
WP_016721678.1|1673596_1673833_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.7	3.5e-39
WP_015985122.1|1673825_1674038_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	100.0	6.4e-32
WP_058907223.1|1674070_1676776_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	99.8	0.0e+00
WP_016721680.1|1676772_1676988_+	AlpA family phage regulatory protein	NA	A0A077K9Z8	Ralstonia_phage	100.0	2.4e-34
WP_038961838.1|1676962_1678198_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	99.3	8.1e-236
1690356:1690375	attR	GCGGGCGCGCTCGACCGCCT	NA	NA	NA	NA
>prophage 7
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	1870487	2010047	3984235	head,plate,capsid,protease,integrase,tail,tRNA,transposase,terminase,portal	Pseudomonas_phage(12.96%)	150	1880328:1880344	1941946:1943161
WP_011001577.1|1870487_1871468_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_011001578.1|1871534_1872896_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011001579.1|1872991_1874176_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_021154999.1|1874180_1874888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721794.1|1874930_1876145_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_016721795.1|1876172_1877030_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_016721796.1|1877141_1878335_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_023470185.1|1878369_1881801_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
1880328:1880344	attL	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_043885765.1|1881972_1882734_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
1880328:1880344	attL	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_011001586.1|1882730_1883237_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011001587.1|1883316_1883844_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016721800.1|1883902_1884451_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_016721801.1|1884627_1885989_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003267785.1|1886026_1886749_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.8	1.4e-33
WP_021154996.1|1887028_1887379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895468.1|1887450_1889067_+	DUF1800 family protein	NA	NA	NA	NA	NA
WP_016721804.1|1889094_1890279_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_011001593.1|1890279_1891152_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_016721806.1|1891288_1892497_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016721807.1|1892563_1895683_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_071895469.1|1895922_1897149_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	55.0	5.1e-113
WP_016721809.1|1897306_1897501_-	hypothetical protein	NA	W6MWX6	Pseudomonas_phage	74.1	8.0e-05
WP_016721810.1|1897493_1897856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895470.1|1897852_1899661_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	47.4	1.2e-163
WP_016721813.1|1899657_1899897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721814.1|1899893_1900418_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	55.5	4.8e-44
WP_071895471.1|1900414_1900891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721816.1|1900887_1901442_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	48.3	2.8e-34
1901004:1901020	attR	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_071895472.1|1901494_1902346_-	DUF2303 family protein	NA	I6WAZ8	Burkholderia_virus	36.3	1.6e-28
1901004:1901020	attR	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_071091286.1|1902378_1902723_-	hypothetical protein	NA	C5IHK2	Burkholderia_virus	36.5	8.6e-10
WP_016721820.1|1902773_1902980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773164.1|1902976_1903603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721822.1|1903599_1903980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773165.1|1903988_1904144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081369067.1|1904306_1904795_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_016721824.1|1904763_1905006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721825.1|1905107_1905980_-	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	35.6	2.6e-18
WP_016721826.1|1906062_1906287_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721827.1|1906513_1907023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721828.1|1907015_1907240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043945175.1|1907236_1907521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895474.1|1907517_1909944_+	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	39.9	1.3e-75
WP_155773166.1|1910534_1910942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773167.1|1910988_1911633_+	hypothetical protein	NA	A0A0K1Y721	Rhodobacter_phage	38.7	2.0e-31
WP_016721870.1|1911908_1912895_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_069079018.1|1913009_1913516_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_071895476.1|1913538_1915497_+|terminase	phage terminase large subunit family protein	terminase	R9TMM4	Vibrio_phage	42.6	3.4e-127
WP_064048049.1|1915509_1915731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079016.1|1915732_1917178_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	41.2	3.9e-80
WP_069079015.1|1917252_1919325_+|head	Mu-like prophage major head subunit gpT family protein	head	B7SYD7	Stenotrophomonas_phage	32.3	2.2e-68
WP_071895477.1|1919408_1919741_+	DUF2190 family protein	NA	A0A2I7QRW1	Vibrio_phage	38.7	1.5e-06
WP_016721840.1|1919740_1920049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079013.1|1920045_1920624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721841.1|1920644_1920875_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_069079012.1|1920874_1922356_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	45.3	2.0e-103
WP_020371381.1|1922404_1922767_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_016721844.1|1922766_1923096_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069079011.1|1923175_1924903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895631.1|1925011_1925251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895478.1|1925508_1926465_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	37.3	2.4e-25
WP_016721735.1|1926469_1927435_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155773168.1|1927646_1927865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895480.1|1927861_1929046_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.6	1.1e-43
WP_081365199.1|1929099_1929618_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	48.8	5.8e-34
WP_069079008.1|1929617_1930076_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	47.4	6.0e-27
WP_071895481.1|1930077_1931130_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	45.7	1.5e-65
WP_071895482.1|1931120_1931717_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_071895483.1|1931713_1932913_+	hypothetical protein	NA	O22004	Shigella_phage	49.3	8.4e-12
WP_016721856.1|1932916_1933402_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_016721857.1|1933525_1934017_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	66.0	3.0e-56
WP_071895484.1|1934017_1934326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079003.1|1934328_1934595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079002.1|1934591_1934951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721915.1|1935074_1935401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895485.1|1936570_1937608_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071895486.1|1938044_1939049_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	50.5	1.7e-66
WP_016721863.1|1939049_1939358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721865.1|1939869_1940424_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	46.4	1.1e-33
WP_016721866.1|1940443_1940659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721867.1|1940664_1940817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721868.1|1940813_1941254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721869.1|1941250_1941625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1942083_1943070_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_080606383.1|1943737_1944598_-	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	30.4	3.1e-16
WP_016721872.1|1944877_1945573_-	hypothetical protein	NA	A0A2H4J0J9	uncultured_Caudovirales_phage	39.5	6.8e-22
WP_071895489.1|1945647_1945923_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721873.1|1946192_1946429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721874.1|1946640_1947156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721875.1|1947152_1947563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721876.1|1947571_1947769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895490.1|1947765_1948800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895491.1|1948796_1949093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895492.1|1949116_1949716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721879.1|1949899_1950274_+	HNH endonuclease	NA	Q38456	Bacillus_phage	52.9	3.1e-29
WP_049832880.1|1950665_1951007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721881.1|1951051_1952722_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	61.3	6.5e-204
WP_020371382.1|1952723_1952882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721883.1|1952878_1954102_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	68.8	3.6e-159
WP_016721884.1|1954109_1954721_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	63.5	2.1e-59
WP_071895493.1|1954731_1955979_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	56.6	2.4e-126
WP_016721886.1|1956012_1956336_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016721887.1|1956343_1956670_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_038961918.1|1956672_1957176_+	hypothetical protein	NA	I7GSL4	Xanthomonas_virus	32.7	2.4e-08
WP_016721889.1|1957165_1957519_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016721890.1|1957582_1958236_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	50.7	1.4e-53
WP_016721891.1|1958242_1958563_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	41.9	1.9e-11
WP_016721892.1|1958610_1958871_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_071895495.1|1958872_1961734_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.7	8.6e-87
WP_016721894.1|1961736_1962075_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	47.7	2.1e-21
WP_016721895.1|1962071_1962749_+|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	50.6	1.0e-30
WP_016721896.1|1962754_1963351_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_071895496.1|1963347_1964049_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	62.4	1.0e-78
WP_071895497.1|1964050_1964761_+	C40 family peptidase	NA	D6PG99	uncultured_phage	55.8	2.1e-71
WP_016721899.1|1964764_1965358_+|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	60.4	2.3e-55
WP_038961924.1|1965354_1965693_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016721901.1|1965685_1965949_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016721902.1|1966001_1969157_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	55.9	0.0e+00
WP_038961925.1|1969493_1970150_+	hypothetical protein	NA	Q7Y5J3	Xanthomonas_virus	28.0	3.1e-08
WP_038961926.1|1970218_1970710_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	67.1	5.1e-56
WP_016721906.1|1970710_1971019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895498.1|1971021_1971291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895499.1|1971287_1971647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895500.1|1971774_1972101_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_071895501.1|1972904_1973174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895502.1|1973238_1974276_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155773169.1|1974476_1974710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1975435_1976422_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_071895503.1|1977663_1979397_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011001649.1|1979938_1980133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832095.1|1980204_1982178_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_016721979.1|1982432_1983782_+	trigger factor	NA	NA	NA	NA	NA
WP_003267806.1|1983811_1984465_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	1.8e-53
WP_011001652.1|1984630_1985905_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	4.9e-135
WP_011001653.1|1986075_1988496_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	4.8e-224
WP_003267811.1|1988669_1988942_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	57.3	1.6e-19
WP_011001654.1|1989364_1991311_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011001655.1|1992814_1993507_-	signal peptidase I	NA	NA	NA	NA	NA
WP_020832084.1|1993583_1994204_-	arylesterase	NA	NA	NA	NA	NA
WP_011001657.1|1994277_1994988_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.8	7.4e-40
WP_021156048.1|1995000_1996620_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_069078999.1|1996678_1998274_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_011001660.1|1998349_1998916_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_016724550.1|1999053_2003163_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	72.9	4.4e-177
WP_139233351.1|2003432_2003876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001663.1|2004045_2004237_+	DUF1843 domain-containing protein	NA	NA	NA	NA	NA
WP_016724551.1|2004303_2004930_+	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_011001665.1|2004981_2005563_+	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_016724552.1|2005659_2007135_+	GDL motif peptide-associated radical SAM/SPASM maturase	NA	NA	NA	NA	NA
WP_069079317.1|2007688_2008822_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_071895632.1|2009222_2010047_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	2193244	2200551	3984235	coat	Ralstonia_phage(100.0%)	12	NA	NA
WP_021155768.1|2193244_2193676_-	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	100.0	1.2e-77
WP_074960868.1|2193719_2194433_-	hypothetical protein	NA	A0A097ZIG8	Ralstonia_phage	61.8	2.4e-62
WP_016723073.1|2194566_2195712_-	zonular occludens toxin	NA	E5F074	Ralstonia_phage	99.7	2.9e-219
WP_038962261.1|2195722_2196043_-	DUF2523 domain-containing protein	NA	E5F073	Ralstonia_phage	99.0	2.2e-44
WP_016038713.1|2196039_2197437_-	hypothetical protein	NA	E5F072	Ralstonia_phage	100.0	2.3e-210
WP_016038712.1|2197581_2197791_-|coat	major coat protein	coat	E5F071	Ralstonia_phage	100.0	1.9e-20
WP_016038711.1|2197787_2198027_-	hypothetical protein	NA	E5F070	Ralstonia_phage	100.0	2.0e-37
WP_016038710.1|2198026_2198299_-	hypothetical protein	NA	E5F069	Ralstonia_phage	100.0	7.7e-46
WP_016038709.1|2198298_2198616_-	hypothetical protein	NA	E5F068	Ralstonia_phage	100.0	7.5e-53
WP_038938340.1|2198619_2199753_-	replication initiation factor domain-containing protein	NA	E5F076	Ralstonia_phage	97.4	2.8e-214
WP_043885700.1|2199850_2200057_-	hypothetical protein	NA	S6B968	Ralstonia_phage	97.1	5.6e-33
WP_071895513.1|2200170_2200551_+	Cro/Cl family transcriptional regulator	NA	S6B268	Ralstonia_phage	66.9	4.1e-37
>prophage 9
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	2576817	2662626	3984235	head,plate,capsid,protease,integrase,tail,tRNA,terminase,portal,holin	Ralstonia_phage(36.96%)	88	2608479:2608503	2650970:2650994
WP_016722163.1|2576817_2578215_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016722164.1|2578388_2579348_+	patatin-like phospholipase family protein	NA	H8ZJB8	Ostreococcus_tauri_virus	28.3	5.0e-07
WP_011001127.1|2579421_2580090_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_021154880.1|2580379_2582044_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	3.2e-17
WP_016722166.1|2582040_2583165_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011001124.1|2583171_2584227_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_016722167.1|2584245_2586123_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011001122.1|2586388_2587183_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011001121.1|2587584_2588835_-	aspartate kinase	NA	NA	NA	NA	NA
WP_173940880.1|2588963_2590352_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011001119.1|2590359_2591328_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_043885999.1|2591414_2592290_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_020831689.1|2592274_2593672_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.3	8.0e-38
WP_016722170.1|2593914_2594574_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016722171.1|2594627_2595200_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_019718005.1|2595238_2595745_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016722173.1|2595741_2596548_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016725822.1|2596569_2597316_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_021154887.1|2597452_2598316_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011001110.1|2598429_2599242_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011001109.1|2599287_2599836_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071508223.1|2599928_2600657_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_028860446.1|2600653_2601379_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011001106.1|2601387_2603190_-	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_021154889.1|2603265_2605137_-	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	6.1e-09
WP_016722180.1|2605270_2606086_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	31.7	2.7e-30
WP_011001103.1|2606118_2607321_-	MFS transporter	NA	NA	NA	NA	NA
WP_016725817.1|2607433_2608327_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2608479:2608503	attL	CAAGCACACGCCGATGATGCAGCAG	NA	NA	NA	NA
WP_071895526.1|2610390_2613252_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.2	2.7e-40
WP_071895527.1|2613262_2615269_+	phospholipase	NA	NA	NA	NA	NA
WP_016723932.1|2615272_2616580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907760.1|2616601_2616892_+	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	35.6	4.1e-05
WP_071653990.1|2616928_2617576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722186.1|2618021_2618360_+	DUF1484 family protein	NA	NA	NA	NA	NA
WP_071895528.1|2618381_2619461_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	92.0	1.8e-194
WP_071895529.1|2619457_2621239_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	91.2	0.0e+00
WP_071895530.1|2621375_2622218_+|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	77.9	7.0e-122
WP_016722191.1|2622256_2623309_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	74.0	4.0e-143
WP_016722192.1|2623305_2624028_+|terminase	terminase endonuclease subunit	terminase	A4PE31	Ralstonia_virus	77.5	8.7e-97
WP_038962045.1|2624125_2624605_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	84.3	9.6e-68
WP_058907767.1|2624604_2624808_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	86.8	7.2e-25
WP_071895531.1|2624823_2625231_+	hypothetical protein	NA	A0A077K9X1	Ralstonia_phage	91.1	3.4e-21
WP_071895532.1|2625227_2625545_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	94.1	5.2e-46
WP_071895533.1|2625541_2626345_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	84.2	3.2e-124
WP_038961971.1|2626341_2626776_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	86.8	1.2e-69
WP_071895534.1|2626772_2627243_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	81.6	6.1e-59
WP_135005999.1|2627222_2627636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773170.1|2627969_2628617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127591872.1|2628715_2629738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895535.1|2630038_2630656_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	94.6	1.4e-108
WP_071895536.1|2630652_2631000_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	98.3	1.9e-57
WP_071895537.1|2631002_2631911_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	98.7	4.1e-160
WP_071895538.1|2631903_2632521_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	95.7	7.2e-100
WP_071895539.1|2632525_2634190_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	97.1	8.0e-311
WP_021155104.1|2634202_2634955_+	hypothetical protein	NA	A4PE47	Ralstonia_virus	90.8	4.1e-121
WP_043885739.1|2634951_2635416_+	hypothetical protein	NA	A4PE48	Ralstonia_virus	98.1	1.1e-84
WP_021155106.1|2635509_2636685_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	98.2	5.8e-223
WP_016722208.1|2636716_2637226_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	79.3	9.2e-77
WP_021155107.1|2637301_2637628_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	99.1	8.0e-50
WP_003267618.1|2637624_2637726_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_173877476.1|2637722_2640386_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.1	0.0e+00
WP_071895541.1|2640388_2640811_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	98.6	3.0e-73
WP_071895542.1|2640807_2641935_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.0	4.6e-201
WP_071654013.1|2642045_2642240_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	69.2	1.6e-13
WP_071895543.1|2642202_2643069_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	59.2	5.6e-50
WP_127591879.1|2643217_2643586_-	hypothetical protein	NA	A0A077K8S5	Ralstonia_phage	85.1	2.7e-54
WP_080606373.1|2643709_2644180_-	helix-turn-helix transcriptional regulator	NA	A0A077K9Z1	Ralstonia_phage	60.4	9.8e-41
WP_127591882.1|2644253_2644463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721650.1|2644524_2644773_+	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	82.9	4.7e-34
WP_071895544.1|2644890_2645445_+	Bro-N domain-containing protein	NA	A0A077K9T3	Ralstonia_phage	85.2	8.5e-84
WP_155773171.1|2645455_2645632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907787.1|2645631_2645868_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	80.8	5.1e-30
WP_071895545.1|2645860_2646070_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	72.9	5.5e-20
WP_071895546.1|2646484_2649169_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	92.8	0.0e+00
WP_016721659.1|2649228_2649456_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	73.1	7.6e-23
WP_071895636.1|2649456_2650740_-|integrase	tyrosine-type recombinase/integrase	integrase	C7BGE7	Burkholderia_phage	55.9	4.0e-137
WP_152532532.1|2651495_2651741_-	hypothetical protein	NA	NA	NA	NA	NA
2650970:2650994	attR	CAAGCACACGCCGATGATGCAGCAG	NA	NA	NA	NA
WP_155772886.1|2652194_2653553_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	30.1	9.8e-25
WP_021154891.1|2653552_2654617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001099.1|2654672_2655197_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011001098.1|2655208_2656438_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_127591883.1|2656612_2656996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721663.1|2657080_2657866_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.5	6.1e-27
WP_016721664.1|2657900_2659097_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_011001095.1|2659137_2660022_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016721665.1|2660140_2660713_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831674.1|2660732_2661935_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016721667.1|2661948_2662626_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 10
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	2727126	2799589	3984235	head,capsid,protease,integrase,tail,transposase,terminase,portal	Ralstonia_phage(30.3%)	74	2735540:2735588	2784352:2784400
WP_071895547.1|2727126_2728455_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011001027.1|2728603_2728852_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_016725123.1|2728882_2729608_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071012560.1|2730025_2732380_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_021154980.1|2732348_2734055_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_011001023.1|2734038_2734752_-	response regulator transcription factor	NA	NA	NA	NA	NA
2735540:2735588	attL	TGGAGGCGGGGGTCGGAATCGAACCGGCGTACACGGCTTTGCAGGCCGC	NA	NA	NA	NA
WP_086005111.1|2736402_2736867_+	lysozyme	NA	A0A1S5R1I9	Pseudomonas_phage	39.6	2.5e-20
WP_016724969.1|2737335_2737533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724968.1|2737625_2737964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962738.1|2738019_2740398_-	DNA-dependent RNA polymerase	NA	A0A2R2ZGE5	Ralstonia_phage	31.1	3.3e-84
WP_016724966.1|2740407_2740593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724965.1|2740615_2740960_-	hypothetical protein	NA	A0A127KNZ2	Pseudomonas_phage	51.3	1.4e-20
WP_016724964.1|2740952_2741177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724963.1|2741180_2742008_-	ribonuclease H-like domain-containing protein	NA	A0A2P0VPF6	Ralstonia_phage	61.2	3.9e-93
WP_016724962.1|2742004_2742406_-	DNA endonuclease VII	NA	A0A1L7DQG2	Ralstonia_phage	52.7	7.4e-21
WP_051048331.1|2742377_2743094_-	phosphodiesterase	NA	A0A077KVP0	Ralstonia_phage	51.5	7.9e-66
WP_016724960.1|2743578_2744418_-	hypothetical protein	NA	A0A068Q6Y4	Ralstonia_phage	51.0	1.6e-62
WP_080606461.1|2744440_2746816_-	DNA polymerase A family protein	NA	A0A068Q7T8	Ralstonia_phage	62.8	5.0e-290
WP_038962739.1|2746868_2747414_-	metal-dependent phosphohydrolase	NA	A0A1W6JP41	Morganella_phage	50.3	1.1e-32
WP_016724957.1|2747413_2747599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080606460.1|2747945_2748926_-	ATP-dependent DNA ligase	NA	A0A2H4GY71	Pseudomonas_phage	50.2	3.0e-68
WP_016724955.1|2749963_2751259_-	AAA family ATPase	NA	A0A068Q6G7	Ralstonia_phage	63.1	5.3e-153
WP_081369073.1|2751248_2751800_-	toprim domain-containing protein	NA	A0A077KVN4	Ralstonia_phage	58.1	2.9e-52
WP_016724953.1|2752067_2752349_-	hypothetical protein	NA	Q9ZX17	Mycobacterium_phage	46.9	2.6e-12
WP_016724952.1|2752345_2752654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020371639.1|2752662_2752839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724951.1|2752845_2753211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962733.1|2753413_2753647_-	hypothetical protein	NA	B5BTU9	Ralstonia_phage	67.9	1.6e-23
WP_016724949.1|2753654_2754053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724948.1|2754052_2754238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155738951.1|2754450_2754600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|2754596_2755562_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_016724947.1|2756532_2757225_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155773172.1|2757328_2758621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773173.1|2758587_2759043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080606458.1|2759289_2759559_+	HNH endonuclease	NA	A0A0U2C119	Paracoccus_phage	48.1	4.6e-11
WP_016721870.1|2759985_2760972_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016724943.1|2761710_2763300_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	64.3	1.4e-179
WP_080606456.1|2763308_2763941_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	42.7	6.4e-35
WP_016724941.1|2763950_2765270_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	41.8	1.4e-76
WP_038962726.1|2765517_2766855_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	42.0	2.5e-81
WP_016724939.1|2766851_2767151_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_071895552.1|2767381_2767750_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016724937.1|2767749_2768100_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016724936.1|2768112_2768544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724934.1|2768683_2769019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895553.1|2769039_2769426_+	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	34.1	2.5e-05
WP_016724932.1|2769346_2769781_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	33.8	3.2e-09
WP_071895554.1|2769770_2772581_+	hypothetical protein	NA	C7BGC8	Burkholderia_phage	39.1	1.0e-12
WP_016724929.1|2772585_2772930_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	41.8	1.4e-20
WP_016724984.1|2774155_2774836_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	58.5	1.8e-72
WP_016724983.1|2774832_2775606_+	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	54.9	2.4e-68
WP_071895555.1|2775566_2776178_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	50.5	5.9e-46
WP_071895556.1|2776200_2779905_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	49.7	8.9e-254
WP_038962744.1|2779901_2780261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773174.1|2780630_2780906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895557.1|2781487_2781763_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721870.1|2782187_2783174_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_081369070.1|2783297_2784197_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016724974.1|2784859_2785435_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2784352:2784400	attR	TGGAGGCGGGGGTCGGAATCGAACCGGCGTACACGGCTTTGCAGGCCGC	NA	NA	NA	NA
WP_016725737.1|2785503_2787513_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_023470298.1|2787595_2788786_+	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_028852870.1|2788908_2789469_+	elongation factor P	NA	NA	NA	NA	NA
WP_016723241.1|2789583_2790636_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_016723242.1|2790632_2791076_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011001016.1|2791072_2791864_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_011001015.1|2791860_2792679_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_023470297.1|2792699_2793647_-	GTPase Era	NA	NA	NA	NA	NA
WP_011001013.1|2793643_2794414_-	ribonuclease III	NA	M1H375	Paramecium_bursaria_Chlorella_virus	32.8	1.8e-15
WP_016723244.1|2794416_2794788_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011001011.1|2794853_2795771_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016723245.1|2795804_2797601_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.7	7.1e-23
WP_016723246.1|2797799_2798075_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_016723247.1|2798071_2799589_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	4.8e-20
>prophage 11
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	2923052	2931288	3984235		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|2923052_2924105_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|2924261_2925185_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_028852812.1|2925302_2926415_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|2926495_2927398_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_016723340.1|2927501_2927819_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016723341.1|2927948_2928944_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_016723342.1|2928940_2929888_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2929914_2931288_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 12
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	2974168	2988274	3984235	tail	Ralstonia_phage(55.56%)	12	NA	NA
WP_058907694.1|2974168_2974630_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
WP_028860336.1|2974626_2975103_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
WP_016724633.1|2975099_2975390_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058907695.1|2975457_2975682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508023.1|2975691_2977527_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.1	1.1e-103
WP_071508022.1|2977531_2977930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727799.1|2977926_2978409_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
WP_071653957.1|2978412_2979579_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.3	7.9e-47
WP_071895561.1|2979590_2983181_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_016727790.1|2983210_2983783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727789.1|2983769_2984165_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.6e-31
WP_071653956.1|2984170_2988274_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.8	1.4e-26
>prophage 13
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	2996091	3047799	3984235	head,capsid,transposase,terminase,portal	Acidithiobacillus_phage(45.45%)	58	NA	NA
WP_071653954.1|2996091_2996865_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_071508048.1|2996987_2997434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833003.1|2997439_2997742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653953.1|2997744_2998749_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	1.9e-110
WP_071653952.1|2998755_2999133_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_071653951.1|2999142_3000402_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.4	4.6e-61
WP_016725355.1|3000411_3001938_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_016725356.1|3001937_3002159_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016727772.1|3002159_3002552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653949.1|3002562_3003072_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
WP_172833506.1|3003115_3005098_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_038962858.1|3005097_3005634_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_038938655.1|3005653_3005992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624100.1|3006098_3006605_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.3	4.0e-24
WP_016727890.1|3006734_3007241_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	32.9	2.9e-14
WP_038938808.1|3007368_3007719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162904291.1|3007816_3007981_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	56.1	1.1e-07
WP_143102330.1|3008029_3008359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725010.1|3008355_3008736_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_071653948.1|3008718_3009993_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.1	6.3e-199
WP_071508043.1|3009989_3011393_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.5	8.3e-160
WP_058908853.1|3011790_3012198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725004.1|3012187_3012397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895562.1|3012631_3014929_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
WP_021156153.1|3014912_3015302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938742.1|3015307_3015775_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	53.5	5.9e-38
WP_016727900.1|3015784_3016417_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	61.0	3.8e-64
WP_016727901.1|3016435_3017308_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	2.9e-102
WP_071653946.1|3017304_3017802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653945.1|3017798_3018089_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071615617.1|3018836_3020501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139274347.1|3020518_3021334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653944.1|3021502_3022477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071654078.1|3022473_3023697_-	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_016722471.1|3024442_3024736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722470.1|3024747_3025089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722469.1|3025098_3025350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102314.1|3025956_3026436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722467.1|3026490_3027069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102315.1|3027092_3027302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102316.1|3027427_3027748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653943.1|3027831_3028362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507981.1|3028407_3029232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102317.1|3029672_3029993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102318.1|3029989_3030619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615194.1|3032474_3032789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081369074.1|3033254_3033695_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_021154705.1|3033727_3035110_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.9	4.5e-134
WP_038938302.1|3035106_3035604_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	9.2e-21
WP_071615642.1|3036617_3037709_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_071895565.1|3037906_3038743_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_173941111.1|3038760_3040512_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071895567.1|3040523_3043064_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	1.8e-16
WP_071895641.1|3043116_3043485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723621.1|3043547_3043835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508020.1|3044128_3045454_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_074960860.1|3045794_3046286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|3046833_3047799_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
>prophage 14
NZ_CP052114	Ralstonia solanacearum strain FJAT1463.F50 chromosome, complete genome	3984235	3834311	3897798	3984235	transposase,protease,tail,holin	Klosneuvirus(22.22%)	48	NA	NA
WP_071895614.1|3834311_3835331_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016722562.1|3835503_3835839_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_043885957.1|3836297_3838022_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	31.9	1.8e-60
WP_016722564.1|3838039_3838939_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016722565.1|3839314_3840988_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016722566.1|3841074_3841569_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016722567.1|3841589_3841892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000085.1|3841966_3842488_-|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.6e-15
WP_016722568.1|3842502_3843036_-|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	2.6e-13
WP_016722569.1|3843045_3843594_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071895615.1|3844097_3849116_+	autotransporter domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	52.9	3.9e-10
WP_016722571.1|3849155_3850352_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_173877489.1|3850811_3852665_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_071895616.1|3852678_3853818_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013213874.1|3853814_3854042_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011000076.1|3854051_3854879_+	thiazole synthase	NA	NA	NA	NA	NA
WP_028852448.1|3854875_3856027_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016722575.1|3856153_3856633_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	47.8	5.7e-28
WP_038962152.1|3856804_3858241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722578.1|3859134_3859959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773177.1|3860220_3867909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722585.1|3868110_3868473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000067.1|3868507_3869413_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_016722587.1|3869483_3870182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722588.1|3870263_3871667_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_069079282.1|3871686_3873138_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_038938143.1|3873504_3873936_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011000061.1|3873932_3874484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000060.1|3874732_3876157_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.0	3.2e-42
WP_011000059.1|3876223_3876565_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011000058.1|3876578_3877409_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_016722592.1|3877417_3877876_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011000056.1|3877967_3878573_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_028852442.1|3878611_3880564_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	32.9	6.2e-12
WP_016722594.1|3880725_3881730_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_011000053.1|3881921_3882611_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_020830861.1|3882607_3883897_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.0	1.6e-80
WP_011000051.1|3883900_3884806_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021155371.1|3884881_3885727_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_020830859.1|3885723_3887076_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.0	2.6e-17
WP_016722598.1|3887106_3888009_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000047.1|3888212_3888518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023469999.1|3888755_3891143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000045.1|3891519_3892239_-	response regulator	NA	NA	NA	NA	NA
WP_019717341.1|3892275_3894711_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_071895617.1|3894707_3895508_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_011000042.1|3895521_3896847_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011000041.1|3896937_3897798_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 1
NZ_CP052115	Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence	2075660	29663	41755	2075660		Ralstonia_phage(42.86%)	11	NA	NA
WP_071895885.1|29663_32321_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	85.3	0.0e+00
WP_038962083.1|32323_33139_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	68.7	7.8e-94
WP_071895835.1|33135_35367_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	84.6	0.0e+00
WP_016722308.1|35363_35684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829481.1|35692_35959_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	56.5	3.1e-07
WP_020829482.1|36582_36849_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	51.9	1.7e-13
WP_016722315.1|36866_37586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829484.1|37609_37828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722316.1|37875_38103_+	ogr/Delta-like zinc finger family protein	NA	E5E3P1	Burkholderia_phage	51.7	6.7e-11
WP_016722318.1|38619_38943_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_020829487.1|38953_41755_+	toprim domain-containing protein	NA	A0A1S5NPU9	Burkholderia_phage	50.6	7.0e-251
>prophage 2
NZ_CP052115	Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence	2075660	699681	731205	2075660	transposase	Ralstonia_phage(27.27%)	31	NA	NA
WP_016721735.1|699681_700647_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|700643_700793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081326716.1|702716_703088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003870.1|703435_704008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895711.1|704398_705061_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	60.5	4.3e-66
WP_155773180.1|705193_705442_+	hypothetical protein	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	86.1	8.5e-36
WP_016725469.1|705438_705714_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	78.5	1.2e-27
WP_071895715.1|705720_706272_-	type III effector HopH1	NA	NA	NA	NA	NA
WP_016721735.1|706347_707313_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|707309_707459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723834.1|708301_708511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723835.1|708812_710258_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_118888231.1|710674_712300_-	caspase family protein	NA	NA	NA	NA	NA
WP_071895717.1|712309_712624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|713471_714458_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016721735.1|714615_715581_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|715577_715727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895718.1|716683_716872_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_016723839.1|716987_717677_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014631877.1|717715_718078_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_011004587.1|718207_718924_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_021156145.1|718962_720585_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016723841.1|720598_722176_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.0	5.5e-11
WP_020830396.1|722306_723017_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	5.0e-12
WP_019719996.1|723013_723763_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-16
WP_019719997.1|723759_724728_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014631870.1|724724_725594_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016726288.1|725642_726902_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074960931.1|727854_729153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139180419.1|729316_729703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005097.1|730055_731205_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
>prophage 3
NZ_CP052115	Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence	2075660	1095194	1105210	2075660	transposase	Bacillus_phage(33.33%)	10	NA	NA
WP_023470149.1|1095194_1096670_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_019719026.1|1096812_1097028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043885730.1|1096924_1097704_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	4.9e-29
WP_074960884.1|1098051_1098942_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_155773181.1|1099187_1100279_+	type III effector protein	NA	NA	NA	NA	NA
WP_016721870.1|1100355_1101342_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_155773182.1|1102789_1103407_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	49.2	2.9e-48
WP_071895761.1|1103657_1104671_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071508531.1|1104701_1104911_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010112046.1|1104949_1105210_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP052115	Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence	2075660	1271072	1321775	2075660	transposase,tRNA,plate	uncultured_Caudovirales_phage(28.57%)	35	NA	NA
WP_016723213.1|1271072_1273025_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.7	5.2e-43
WP_016723214.1|1273011_1274553_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_016723215.1|1274777_1276787_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020371709.1|1276928_1277483_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1277694_1278411_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_139233336.1|1279756_1280041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723220.1|1280177_1280459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331358.1|1280576_1281533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161632306.1|1281731_1282700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508464.1|1283871_1285536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895776.1|1285551_1288572_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.0	4.9e-16
WP_011004065.1|1288709_1289456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155949.1|1289742_1290591_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011004063.1|1290630_1290900_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	1.8e-10
WP_071508536.1|1290910_1292398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895778.1|1292435_1296377_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_016723230.1|1296373_1297360_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011004059.1|1297362_1298196_+	OmpA family protein	NA	NA	NA	NA	NA
WP_038962315.1|1298294_1299263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038962316.1|1299335_1300415_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_016723233.1|1300548_1301892_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_016723234.1|1301888_1302647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962317.1|1302651_1303035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773183.1|1303272_1303599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|1304352_1305318_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071895632.1|1305540_1306365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_144061949.1|1306427_1306877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038962318.1|1306886_1308005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005103.1|1308023_1308826_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016723619.1|1308951_1309917_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_043885652.1|1312191_1313325_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_020830185.1|1313342_1316099_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.6	2.1e-37
WP_071895780.1|1316119_1318837_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.4	4.9e-84
WP_020371627.1|1318869_1319961_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_016724833.1|1319924_1321775_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
