The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	196663	232639	3788096	portal,head,capsid,terminase,transposase	Acidithiobacillus_phage(55.88%)	46	NA	NA
WP_016721735.1|196663_197629_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|197625_197775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100226526.1|198165_199221_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_165858334.1|199198_199714_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_069078857.1|199753_200710_-|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
WP_118940513.1|202043_202532_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	52.9	7.3e-39
WP_118940514.1|202528_202903_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	65.4	1.6e-41
WP_165858335.1|202899_204288_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.3	2.7e-219
WP_165858336.1|204284_204734_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	70.9	1.1e-54
WP_173940977.1|204733_204952_-	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	60.3	1.7e-11
WP_165858338.1|205091_205886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858339.1|205964_208196_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.0	7.4e-288
WP_165858340.1|208245_208707_-	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	64.7	6.2e-48
WP_089190378.1|208936_209200_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
WP_075463038.1|209210_209693_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.2	3.4e-44
WP_165858341.1|209689_210241_+	HNH endonuclease	NA	A0A172JFU7	Citrobacter_phage	39.2	3.7e-23
WP_011003123.1|210212_211118_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.2	2.4e-104
WP_016725624.1|211114_211762_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.6	7.9e-81
WP_165858342.1|211769_212282_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	67.5	9.4e-53
WP_165858343.1|212281_212830_+	HNH endonuclease	NA	A0A1B0TRC1	Escherichia_phage	39.3	4.1e-22
WP_011003119.1|212816_213575_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	62.1	1.3e-82
WP_016725627.1|213571_213832_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	8.4e-18
WP_165858344.1|213828_216117_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.4	7.1e-286
WP_016725339.1|216247_216712_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
WP_016725629.1|216713_216923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725340.1|216915_217299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|217353_217620_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_165858345.1|217864_218080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023470374.1|218561_219962_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	5.0e-165
WP_020833017.1|219958_221179_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.5	1.4e-192
WP_020371857.1|221221_221587_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	8.5e-32
WP_016726852.1|221811_222000_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_020833014.1|222121_222637_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	68.7	2.3e-22
WP_107523986.1|222742_223081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833012.1|223100_223637_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	81.5	5.5e-72
WP_173940978.1|223636_225619_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.4	0.0e+00
WP_016727881.1|225661_226171_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	2.8e-25
WP_058908380.1|226181_226574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|226574_226796_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_165858346.1|226795_228343_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_165858347.1|228352_229612_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	42.3	3.9e-60
WP_165592049.1|229621_229999_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	1.0e-24
WP_165858348.1|230005_231010_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.6	6.2e-109
WP_020833003.1|231012_231315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071508505.1|231320_231767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858349.1|231865_232639_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	42.9	1.3e-45
>prophage 2
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	242166	301841	3788096	transposase	Ralstonia_phage(40.0%)	40	NA	NA
WP_064048073.1|242166_245757_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.7	0.0e+00
WP_064048074.1|245779_246946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885695.1|246949_247432_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
WP_064820726.1|247428_247827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858354.1|247831_249676_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.9	4.1e-106
WP_064820724.1|249685_249910_+	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	45.5	8.3e-06
WP_064820723.1|249978_250269_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	46.4	4.1e-13
WP_165858355.1|250265_250742_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.3	4.1e-71
WP_058907697.1|250738_251200_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.0	4.3e-65
WP_020832985.1|251267_251567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885536.1|251629_251968_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_071624213.1|252346_253918_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|253949_254300_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|254299_254764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173940980.1|263976_264696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075463064.1|265457_267998_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.2	7.5e-18
WP_173940981.1|268009_269761_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071893100.1|269773_270619_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016726423.1|271119_271908_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_016723619.1|273221_274187_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_011003046.1|274808_275645_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058908709.1|275930_277208_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058908710.1|277248_278379_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_119889770.1|278706_280638_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_119889769.1|280703_281399_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_119889768.1|281563_284602_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_119889767.1|284762_286865_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_081350287.1|286861_288025_+	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_011003054.1|288037_288940_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_028861115.1|288936_289515_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_071507955.1|289693_291499_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_087451503.1|292031_292837_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016723619.1|293025_293991_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_020831502.1|294074_295403_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011003045.1|295456_295660_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	2.1e-16
WP_019718985.1|295987_296194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507821.1|296781_297960_+	antibiotic hydrolase	NA	NA	NA	NA	NA
WP_011003043.1|298396_299233_+	cytochrome c	NA	NA	NA	NA	NA
WP_147495255.1|299462_299669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|300875_301841_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
>prophage 3
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	383311	418111	3788096	integrase,holin,head,capsid,plate,tail,terminase	Ralstonia_virus(54.35%)	49	379612:379657	418150:418195
379612:379657	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_021155085.1|383311_383815_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	98.8	1.0e-91
WP_103025853.1|383824_384757_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	98.7	3.3e-165
WP_052331361.1|384666_385482_+	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	97.4	1.3e-152
WP_021155088.1|386569_388351_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	97.5	0.0e+00
WP_023470163.1|388494_389334_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	98.9	9.4e-151
WP_021155090.1|389387_390404_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	99.7	8.0e-189
WP_021155091.1|390400_391123_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	98.8	6.9e-126
WP_043885746.1|391219_391699_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	95.6	1.4e-82
WP_021155093.1|391698_391902_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	98.5	1.7e-29
WP_021155094.1|391917_392322_+	phage-related protein	NA	A0A077K9X1	Ralstonia_phage	98.6	7.7e-26
WP_021155095.1|392318_392633_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	95.1	5.5e-48
WP_021155096.1|392629_393436_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	97.0	9.0e-143
WP_021155097.1|393432_393933_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	95.2	6.3e-78
WP_015985096.1|393929_394364_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	100.0	2.9e-79
WP_021155098.1|394360_394807_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	99.3	2.2e-74
WP_173940983.1|394829_395168_-	hypothetical protein	NA	A0A077KER3	Ralstonia_phage	99.1	8.3e-58
WP_021155099.1|395521_396139_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	100.0	2.7e-115
WP_021155100.1|396135_396483_+	GPW/gp25 family protein	NA	A0A077K8R5	Ralstonia_phage	100.0	1.9e-57
WP_118891077.1|396485_397394_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	99.7	4.4e-162
WP_023470164.1|397386_398004_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	96.2	1.5e-100
WP_021155103.1|398010_399675_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	95.5	2.6e-306
WP_167798287.1|399687_400440_+|tail	phage tail protein	tail	A4PE47	Ralstonia_virus	91.2	2.4e-121
WP_043885739.1|400436_400901_+	hypothetical protein	NA	A4PE48	Ralstonia_virus	98.1	1.1e-84
WP_021155106.1|400994_402170_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	98.2	5.8e-223
WP_016722208.1|402201_402711_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	79.3	9.2e-77
WP_021155107.1|402786_403113_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	99.1	8.0e-50
WP_003267618.1|403109_403211_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_021155108.1|403207_405871_+|tail	phage-related tail protein	tail	A4PE52	Ralstonia_virus	95.9	0.0e+00
WP_021155109.1|405873_406296_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	99.3	1.0e-73
WP_021155110.1|406292_407417_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.8	1.7e-203
WP_071615623.1|407729_407939_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_021155111.1|407889_408672_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	67.8	2.4e-92
WP_015985112.1|408587_409334_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	100.0	9.6e-131
WP_080672980.1|409494_409971_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	45.7	1.8e-26
WP_021155113.1|410214_410406_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
WP_016722220.1|410434_410629_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	95.3	1.3e-23
WP_015985116.1|410625_410874_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	100.0	1.0e-41
WP_043885741.1|410988_411222_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	52.6	4.7e-12
WP_021155116.1|411218_411383_+	hypothetical protein	NA	A4PE63	Ralstonia_virus	96.3	5.1e-21
WP_043885742.1|411379_411586_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	98.5	5.4e-28
WP_043885743.1|411609_411822_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.6	8.1e-35
WP_023470166.1|411814_412027_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	94.3	2.3e-29
WP_016725459.1|412046_412355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167798284.1|412356_412578_+	hypothetical protein	NA	A4PE67	Ralstonia_virus	97.3	2.4e-34
WP_023470167.1|412574_412847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021155121.1|412843_413134_+	hypothetical protein	NA	A4PE68	Ralstonia_virus	99.0	2.6e-52
WP_015985125.1|413133_415938_+	toprim domain-containing protein	NA	A4PE69	Ralstonia_virus	100.0	0.0e+00
WP_021155124.1|415924_416098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021155125.1|417028_418111_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	99.7	6.7e-210
418150:418195	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
>prophage 4
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	844671	896878	3788096	tRNA,coat,transposase	uncultured_Mediterranean_phage(37.5%)	46	NA	NA
WP_011002630.1|844671_845784_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_028853617.1|845872_847471_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016723723.1|847496_848105_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011002627.1|848338_849712_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.0	3.8e-109
WP_071507154.1|849958_850543_+	cytochrome b	NA	NA	NA	NA	NA
WP_016723720.1|850643_851210_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_019718267.1|851267_851864_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_016723719.1|851940_852909_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	8.8e-44
WP_011002622.1|852986_854867_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_063612207.1|854988_855321_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.0e-12
WP_016723717.1|855429_856581_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	9.4e-77
WP_020832657.1|856574_857663_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_020832656.1|857739_859932_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016723714.1|859950_860154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002617.1|860165_860606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162903483.1|860829_861003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962418.1|861148_862279_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_043885837.1|862421_863363_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165858402.1|863553_864777_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_028853611.1|864821_866108_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_019718276.1|866480_866942_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_165858403.1|867152_868349_-	amidohydrolase	NA	NA	NA	NA	NA
WP_165858550.1|868829_870029_-	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_058908804.1|870637_870973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858404.1|871062_875250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025505.1|875300_875765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|875764_876115_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|876146_877718_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_165858405.1|877820_882050_+	putative Ig domain-containing protein	NA	NA	NA	NA	NA
WP_165590624.1|882735_883934_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.7e-103
WP_019718280.1|884033_884351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172833497.1|884401_884611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853600.1|885143_885398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615273.1|886166_886331_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	55.1	1.2e-06
WP_011002610.1|886776_887103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002609.1|887196_887481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832642.1|888564_888702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|888819_889137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002607.1|889287_889584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853597.1|889680_890541_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_071615274.1|890557_890818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002605.1|892163_892667_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_058907884.1|892716_893220_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049842205.1|893338_894058_+	molecular chaperone	NA	NA	NA	NA	NA
WP_058907885.1|894107_896372_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_172833515.1|896389_896878_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	955411	965547	3788096		Chrysochromulina_ericina_virus(14.29%)	9	NA	NA
WP_028853574.1|955411_957370_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.7e-147
WP_011002544.1|957504_958647_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_165858408.1|958682_960563_+	chorismate-binding protein	NA	A0A0B5J984	Pandoravirus	37.3	6.1e-57
WP_011002542.1|960518_961205_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_011002541.1|961212_961920_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016724069.1|961931_962756_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
WP_011002539.1|962812_963457_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-06
WP_003271964.1|963490_964000_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_020832586.1|963999_965547_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 6
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	1194877	1247292	3788096	tRNA,capsid,transposase	Ralstonia_phage(57.69%)	51	NA	NA
WP_016722737.1|1194877_1197223_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.5	2.5e-84
WP_011002263.1|1197311_1197959_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011002262.1|1197994_1198411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853469.1|1198481_1199831_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.6	6.7e-74
WP_165858411.1|1199897_1201214_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.4	2.3e-95
WP_015983983.1|1201436_1202027_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	100.0	1.5e-102
WP_015983982.1|1202053_1202767_+	hypothetical protein	NA	A0JC17	Ralstonia_phage	100.0	4.7e-127
WP_071623685.1|1202774_1203710_-	Rep protein	NA	A0JC16	Ralstonia_phage	99.7	1.1e-176
WP_071623686.1|1204310_1204598_+	hypothetical protein	NA	W6CM42	Ralstonia_phage	93.7	5.6e-47
WP_015983980.1|1204594_1205914_-	hypothetical protein	NA	A0JC15	Ralstonia_phage	100.0	3.0e-252
WP_071623687.1|1205918_1206248_-	DUF2523 domain-containing protein	NA	A0A097ZIJ0	Ralstonia_phage	98.2	5.1e-52
WP_015983978.1|1206260_1207757_-	hypothetical protein	NA	A0JC13	Ralstonia_phage	100.0	3.9e-216
WP_015983977.1|1207832_1208057_-	hypothetical protein	NA	A0JC12	Ralstonia_phage	100.0	9.1e-29
WP_020747891.1|1208059_1208308_-	hypothetical protein	NA	A0A1W5LU65	Ralstonia_phage	100.0	9.8e-40
WP_019718429.1|1208310_1208520_-	hypothetical protein	NA	A0A097ZIG2	Ralstonia_phage	100.0	9.4e-28
WP_015983974.1|1208519_1208729_-	hypothetical protein	NA	A0JC09	Ralstonia_phage	100.0	2.5e-28
WP_015983973.1|1208728_1209025_-	hypothetical protein	NA	A0JC08	Ralstonia_phage	100.0	2.1e-49
WP_165858412.1|1209246_1209537_-	hypothetical protein	NA	A0JC06	Ralstonia_phage	97.9	6.7e-48
WP_015983970.1|1209602_1209929_-	hypothetical protein	NA	A0JC05	Ralstonia_phage	100.0	1.7e-52
WP_165858552.1|1211396_1211777_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_165858413.1|1211943_1213782_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_165858414.1|1215006_1215459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941004.1|1215683_1216832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858415.1|1216990_1218601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858416.1|1218584_1219826_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_165858417.1|1220326_1221349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858418.1|1221380_1222466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|1222563_1223529_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|1223525_1223675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941005.1|1223704_1225708_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_103025505.1|1225758_1226223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|1226222_1226573_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|1226604_1228176_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_165858420.1|1228648_1229023_+	PHA-granule associated protein 4	NA	NA	NA	NA	NA
WP_165858421.1|1229717_1230608_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_165858422.1|1231297_1231579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858553.1|1231688_1232354_+	response regulator	NA	NA	NA	NA	NA
WP_165858554.1|1232447_1233989_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	2.0e-10
WP_165858555.1|1234635_1235967_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_165858423.1|1236646_1237393_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165858556.1|1238263_1238596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858424.1|1238685_1239657_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.4	9.8e-51
WP_173941006.1|1239729_1240728_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	39.7	2.5e-54
WP_165858425.1|1240740_1241658_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_165858426.1|1241654_1242641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858427.1|1242707_1242953_+	hypothetical protein	NA	A0A1X9SH96	Bradyrhizobium_phage	46.7	4.5e-13
WP_052328819.1|1243084_1243558_-	RidA family protein	NA	NA	NA	NA	NA
WP_165858428.1|1244001_1244727_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_165858429.1|1244876_1245353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_028862037.1|1245349_1245703_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.7	3.6e-19
WP_165858430.1|1245735_1247292_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.0	4.7e-71
>prophage 7
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	1604071	1678981	3788096	integrase,portal,holin,head,capsid,tRNA,plate,tail,terminase,transposase	Ralstonia_phage(84.91%)	83	1639073:1639092	1679121:1679140
WP_011001921.1|1604071_1604896_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016722989.1|1604892_1605597_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016722990.1|1605692_1606886_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011001918.1|1606890_1607703_+	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	37.4	1.3e-32
WP_011001917.1|1607717_1608515_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011001916.1|1608552_1609425_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011001915.1|1609506_1610805_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011001914.1|1610891_1611713_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011001913.1|1611785_1612283_+	CvpA family protein	NA	NA	NA	NA	NA
WP_011001912.1|1612377_1613913_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.0e-86
WP_020832236.1|1614039_1614861_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011001910.1|1614884_1615850_-	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.6e-24
WP_003264057.1|1616005_1616206_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011001909.1|1616628_1617120_+	phasin family protein	NA	NA	NA	NA	NA
WP_011001907.1|1617396_1617636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071623787.1|1617779_1618100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071623786.1|1618309_1619107_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011001904.1|1619134_1619548_+	heme-binding protein	NA	NA	NA	NA	NA
WP_028860715.1|1619741_1620020_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_071623785.1|1620215_1620629_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_104072933.1|1620638_1621370_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011001900.1|1621406_1622072_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_135005972.1|1622582_1624898_+	ATP-binding protein	NA	A0A0K1Y7P8	Apis_mellifera_filamentous_virus	30.7	5.2e-10
WP_011001897.1|1625025_1625382_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_135005973.1|1625365_1626325_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_118872139.1|1626370_1626712_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_011001894.1|1627178_1628465_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_118872140.1|1628585_1629419_-	glutamate racemase	NA	NA	NA	NA	NA
WP_118872141.1|1629439_1630963_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_019718621.1|1631142_1631682_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_165858444.1|1631765_1632776_-	EamA family transporter	NA	NA	NA	NA	NA
WP_028860712.1|1632940_1634923_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	1.7e-78
WP_081365333.1|1634944_1637011_+	VC_2705 family sodium/solute symporter	NA	NA	NA	NA	NA
WP_011001886.1|1638512_1638665_+	hypothetical protein	NA	NA	NA	NA	NA
1639073:1639092	attL	AATCCTGGCGGAGAGAGGGG	NA	NA	NA	NA
WP_058907201.1|1640247_1642908_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	100.0	0.0e+00
WP_107523971.1|1642912_1643782_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	100.0	1.5e-164
WP_081049899.1|1643862_1644624_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	100.0	1.9e-142
WP_058907204.1|1644629_1646870_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	100.0	0.0e+00
WP_071507000.1|1646936_1648022_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	100.0	1.2e-211
WP_071507001.1|1648018_1649800_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	100.0	0.0e+00
WP_023470163.1|1649943_1650783_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	98.9	9.4e-151
WP_021155090.1|1650836_1651853_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	99.7	8.0e-189
WP_020832909.1|1651849_1652572_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	100.0	3.6e-127
WP_058907235.1|1652668_1653148_+|head	head completion/stabilization protein	head	A0A077K9R2	Ralstonia_phage	100.0	1.0e-85
WP_011001871.1|1653147_1653354_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_015985092.1|1653369_1653774_+|holin	phage holin family protein	holin	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_020832906.1|1653770_1654082_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	100.0	5.9e-50
WP_071507003.1|1654078_1654885_+	DUF3380 domain-containing protein	NA	A0A077K808	Ralstonia_phage	100.0	2.9e-149
WP_071507004.1|1654881_1655382_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	100.0	8.5e-83
WP_015985096.1|1655378_1655813_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	100.0	2.9e-79
WP_021155098.1|1655809_1656256_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	99.3	2.2e-74
WP_173940983.1|1656278_1656617_-	hypothetical protein	NA	A0A077KER3	Ralstonia_phage	99.1	8.3e-58
WP_016723619.1|1657005_1657971_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_021155099.1|1658148_1658766_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	100.0	2.7e-115
WP_021155100.1|1658762_1659110_+	GPW/gp25 family protein	NA	A0A077K8R5	Ralstonia_phage	100.0	1.9e-57
WP_071507511.1|1659112_1660021_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	100.0	1.2e-162
WP_071507512.1|1660013_1660631_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	100.0	2.8e-104
WP_071507513.1|1660635_1662300_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	100.0	0.0e+00
WP_071507514.1|1662312_1663065_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	100.0	2.1e-133
WP_038962047.1|1663061_1663526_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	100.0	5.3e-87
WP_071507516.1|1663624_1664800_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	100.0	8.6e-227
WP_011001854.1|1664831_1665341_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_071507539.1|1665416_1665743_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	97.2	4.0e-49
WP_011001852.1|1665739_1665841_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	97.0	2.1e-09
WP_071507517.1|1665837_1668501_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.5	0.0e+00
WP_071507518.1|1668503_1668926_+|tail	phage tail protein	tail	A0A077K9Y7	Ralstonia_phage	100.0	4.6e-74
WP_081365390.1|1668922_1670023_+	phage late control D family protein	NA	A0A077KES1	Ralstonia_phage	100.0	1.5e-204
WP_071507520.1|1670124_1670406_+	site-specific DNA-methyltransferase	NA	A0A077K824	Ralstonia_phage	100.0	4.6e-46
WP_147495393.1|1670410_1670962_+	hypothetical protein	NA	A0A077K9T2	Ralstonia_phage	100.0	2.2e-100
WP_071507522.1|1671631_1672102_-	helix-turn-helix transcriptional regulator	NA	A0A077K9Z1	Ralstonia_phage	100.0	3.3e-81
WP_143102279.1|1672174_1672375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653971.1|1672400_1672592_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.8	2.6e-08
WP_071507523.1|1672620_1672815_+	hypothetical protein	NA	A0A077KET0	Ralstonia_phage	100.0	2.2e-26
WP_071507524.1|1672811_1673060_+	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	100.0	1.0e-41
WP_071507525.1|1673175_1673730_+	Bro-N domain-containing protein	NA	A0A077K9T3	Ralstonia_phage	100.0	1.4e-99
WP_071507526.1|1673742_1673982_+	hypothetical protein	NA	A0A077K8S8	Ralstonia_phage	100.0	1.0e-38
WP_172833500.1|1673978_1674146_+	hypothetical protein	NA	A0A077K9Z4	Ralstonia_phage	100.0	3.4e-20
WP_071507527.1|1674142_1674358_+	hypothetical protein	NA	A0A077KET1	Ralstonia_phage	100.0	7.4e-28
WP_071507528.1|1674357_1674600_+	hypothetical protein	NA	A0A077K830	Ralstonia_phage	100.0	1.1e-40
WP_011001836.1|1674592_1674799_+	hypothetical protein	NA	A0A077K9T6	Ralstonia_phage	100.0	6.9e-31
WP_071507529.1|1674853_1677559_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	100.0	0.0e+00
WP_016721680.1|1677555_1677771_+	AlpA family phage regulatory protein	NA	A0A077K9Z8	Ralstonia_phage	100.0	2.4e-34
WP_071507530.1|1677745_1678981_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	100.0	4.3e-237
1679121:1679140	attR	AATCCTGGCGGAGAGAGGGG	NA	NA	NA	NA
>prophage 8
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	1859462	1938536	3788096	integrase,portal,head,tRNA,protease,plate,tail,terminase,transposase	Pseudomonas_phage(14.29%)	81	1862302:1862318	1901615:1901631
WP_011001577.1|1859462_1860443_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_011001578.1|1860509_1861871_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_028853106.1|1861966_1863151_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
1862302:1862318	attL	CATTGGCGGCGGCGCCG	NA	NA	NA	NA
WP_081365330.1|1863155_1863863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019718725.1|1863905_1865120_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_016721795.1|1865147_1866005_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_020832103.1|1866116_1867310_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_119889826.1|1867344_1870776_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_071507225.1|1870947_1871709_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011001586.1|1871705_1872212_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_028853112.1|1872291_1872819_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016721800.1|1872877_1873426_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_016721801.1|1873596_1874958_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003267785.1|1874995_1875718_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.8	1.4e-33
WP_020425251.1|1875997_1876348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001591.1|1876419_1878036_+	DUF1800 family protein	NA	NA	NA	NA	NA
WP_011001592.1|1878063_1879248_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_011001593.1|1879248_1880121_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_064477835.1|1880257_1881466_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_019718736.1|1881532_1884652_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_071507226.1|1884891_1886118_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	54.6	3.0e-113
WP_071507228.1|1886812_1888672_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	48.0	1.7e-160
WP_064047749.1|1888668_1888911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064047750.1|1888904_1889432_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	58.5	3.9e-46
WP_071507229.1|1889428_1889905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507230.1|1889901_1890456_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	47.7	2.1e-34
WP_028853122.1|1890508_1891360_-	DUF2303 family protein	NA	I6WAZ8	Burkholderia_virus	36.3	1.2e-28
WP_064047757.1|1891392_1891737_-	hypothetical protein	NA	C5IHK2	Burkholderia_virus	37.4	3.8e-10
WP_155738973.1|1891992_1892157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832807.1|1892163_1892565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102254.1|1892564_1893278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162904225.1|1893286_1893442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081366751.1|1893602_1894085_-	DUF2335 domain-containing protein	NA	A0A0D4DCC1	Staphylococcus_phage	39.0	1.1e-05
WP_071507232.1|1894053_1894296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162904224.1|1894396_1895266_-	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	34.6	1.2e-20
WP_080894078.1|1895348_1895627_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081366753.1|1895799_1896309_+	hypothetical protein	NA	Q3HQZ3	Burkholderia_phage	26.3	2.2e-09
WP_016721828.1|1896301_1896526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043945175.1|1896522_1896807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507234.1|1896803_1899230_+	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	40.9	9.8e-76
WP_143102255.1|1899814_1900222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507236.1|1900323_1900914_+	hypothetical protein	NA	A0A0K1Y721	Rhodobacter_phage	38.7	3.1e-31
WP_064048047.1|1901099_1901606_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_064048048.1|1901628_1903587_+|terminase	phage terminase large subunit family protein	terminase	R9TMM4	Vibrio_phage	42.1	6.4e-126
1901615:1901631	attR	CGGCGCCGCCGCCAATG	NA	NA	NA	NA
WP_064048049.1|1903599_1903821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064048050.1|1903822_1905268_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	41.2	5.1e-80
WP_165858453.1|1905340_1907413_+|head	Mu-like prophage major head subunit gpT family protein	head	B7SYD7	Stenotrophomonas_phage	32.9	3.1e-70
WP_064048052.1|1907496_1907829_+	DUF2190 family protein	NA	A0A2I7QRW1	Vibrio_phage	37.7	1.9e-06
WP_064048053.1|1907828_1908137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064048054.1|1908133_1908715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064048055.1|1908735_1908966_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_064048056.1|1908965_1910447_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	45.3	6.8e-104
WP_020371381.1|1910495_1910858_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_064048057.1|1910857_1911187_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_064048058.1|1911266_1912988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081263866.1|1913111_1913351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064048059.1|1913616_1914795_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	27.7	6.5e-25
WP_064048060.1|1914791_1915976_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.4	1.4e-43
WP_081263867.1|1915975_1916548_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	45.4	1.1e-30
WP_064048061.1|1916547_1917006_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	46.6	1.8e-26
WP_064048062.1|1917007_1918060_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	45.4	2.6e-65
WP_064048063.1|1918050_1918647_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_064048064.1|1918643_1919843_+	hypothetical protein	NA	O22004	Shigella_phage	50.7	4.9e-12
WP_064048065.1|1919846_1920332_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_064048066.1|1920457_1920949_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	66.5	5.1e-56
WP_064048067.1|1920948_1921257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081263868.1|1921259_1921538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064048068.1|1921524_1921884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155738977.1|1922426_1923005_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_173941081.1|1923068_1923896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047758.1|1924045_1924315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064047759.1|1924379_1925417_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011001649.1|1925785_1925980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071623776.1|1926051_1928025_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_016721979.1|1928279_1929629_+	trigger factor	NA	NA	NA	NA	NA
WP_003267806.1|1929658_1930312_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	1.8e-53
WP_011001652.1|1930477_1931752_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	4.9e-135
WP_011001653.1|1931922_1934343_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	4.8e-224
WP_003267811.1|1934516_1934789_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	57.3	1.6e-19
WP_011001654.1|1935211_1937158_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016725726.1|1937207_1938536_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	2141711	2153173	3788096	coat	Ralstonia_phage(78.57%)	15	NA	NA
WP_010889950.1|2141711_2142143_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	100.0	7.1e-78
WP_010889951.1|2142184_2142811_-	hypothetical protein	NA	A0JC29	Ralstonia_phage	100.0	6.2e-107
WP_064820707.1|2142888_2143983_-	zonular occludens toxin	NA	A0JC28	Ralstonia_phage	99.5	1.7e-205
WP_015984160.1|2143979_2144255_-	DUF2523 domain-containing protein	NA	A0JC27	Ralstonia_phage	100.0	4.3e-36
WP_071623619.1|2144251_2145487_-	hypothetical protein	NA	S6BAK4	Ralstonia_phage	99.8	2.4e-211
WP_010889942.1|2145566_2145902_-	hypothetical protein	NA	A0JC24	Ralstonia_phage	100.0	1.6e-56
WP_015984157.1|2145901_2146171_-|coat	major coat protein	coat	A0JC23	Ralstonia_phage	100.0	4.9e-37
WP_010889944.1|2146170_2146482_-	hypothetical protein	NA	A0JC22	Ralstonia_phage	100.0	8.2e-52
WP_109295884.1|2146486_2147614_-	replication initiation factor domain-containing protein	NA	A0JC21	Ralstonia_phage	99.5	2.4e-218
WP_015984155.1|2147613_2147820_-	hypothetical protein	NA	A0JC20	Ralstonia_phage	100.0	2.8e-32
WP_089190813.1|2147936_2148329_+	helix-turn-helix transcriptional regulator	NA	S6B268	Ralstonia_phage	100.0	4.8e-65
WP_038938487.1|2149027_2150542_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	27.8	4.6e-47
WP_043885799.1|2150789_2151044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727461.1|2151150_2152773_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.8	2.3e-174
WP_016727460.1|2152855_2153173_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.9	1.8e-17
>prophage 10
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	2770881	2779117	3788096		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|2770881_2771934_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|2772090_2773014_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_058907684.1|2773131_2774244_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|2774324_2775227_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|2775330_2775648_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011000867.1|2775777_2776773_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_049842162.1|2776769_2777717_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2777743_2779117_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 11
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	2821998	2869448	3788096	portal,head,capsid,tail,terminase,transposase	Acidithiobacillus_phage(37.93%)	51	NA	NA
WP_058907694.1|2821998_2822460_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
WP_028860336.1|2822456_2822933_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
WP_016724633.1|2822929_2823220_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058907695.1|2823287_2823512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508023.1|2823521_2825357_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.1	1.1e-103
WP_071508022.1|2825361_2825760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727799.1|2825756_2826239_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
WP_071653957.1|2826242_2827409_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.3	7.9e-47
WP_071895561.1|2827420_2831011_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_016727790.1|2831040_2831613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727789.1|2831599_2831995_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.6e-31
WP_071653956.1|2832000_2836104_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.8	1.4e-26
WP_157698850.1|2836218_2837445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071654080.1|2837550_2838639_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.5	1.8e-98
WP_016727755.1|2839263_2839551_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_038938676.1|2841096_2842608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507988.1|2842686_2843331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507989.1|2843305_2843527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507990.1|2843523_2843913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653954.1|2843921_2844695_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_071508048.1|2844817_2845264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833003.1|2845269_2845572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653953.1|2845574_2846579_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	1.9e-110
WP_071653952.1|2846585_2846963_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_071653951.1|2846972_2848232_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.4	4.6e-61
WP_016725355.1|2848241_2849768_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_016725356.1|2849767_2849989_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016727772.1|2849989_2850382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653949.1|2850392_2850902_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
WP_172833506.1|2850945_2852928_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_038962858.1|2852927_2853464_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_038938655.1|2853483_2853822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624100.1|2853928_2854435_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.3	4.0e-24
WP_016727890.1|2854564_2855071_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	32.9	2.9e-14
WP_038938808.1|2855198_2855549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162904291.1|2855646_2855811_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	56.1	1.1e-07
WP_016725011.1|2855892_2856189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725010.1|2856185_2856566_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_071653948.1|2856548_2857823_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.1	6.3e-199
WP_071508043.1|2857819_2859223_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.5	8.3e-160
WP_058908853.1|2859621_2860029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725004.1|2860018_2860228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858490.1|2860462_2862760_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	71.9	0.0e+00
WP_165858491.1|2862743_2863142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858492.1|2863147_2863615_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	52.3	1.7e-37
WP_165858493.1|2863624_2864257_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	66.9	1.4e-61
WP_016727901.1|2864275_2865148_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	2.9e-102
WP_071653946.1|2865144_2865642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653945.1|2865638_2865929_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071615617.1|2866676_2868341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069078857.1|2868491_2869448_+|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
>prophage 12
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	2874178	2917490	3788096	transposase	Leptospira_phage(25.0%)	37	NA	NA
WP_087451503.1|2874178_2874984_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_165858494.1|2875026_2875197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722468.1|2875803_2876259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025505.1|2876346_2876811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|2876810_2877161_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|2877192_2878764_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_016722467.1|2878895_2879474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102315.1|2879497_2879707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102316.1|2879832_2880153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653943.1|2880236_2880767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507981.1|2880812_2881637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102317.1|2882077_2882398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102318.1|2882394_2883024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081366778.1|2883741_2884182_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_165858495.1|2884214_2885597_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.4	1.0e-133
WP_038938302.1|2885593_2886091_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	9.2e-21
WP_165858562.1|2886785_2888219_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_071508017.1|2888242_2890009_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071653941.1|2890087_2890906_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_081365362.1|2900556_2901504_+	HrgA protein	NA	NA	NA	NA	NA
WP_071624179.1|2901956_2902295_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_155772883.1|2902365_2902737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633620.1|2902756_2903701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507983.1|2904757_2904997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049800424.1|2905712_2906429_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_071624182.1|2907097_2907313_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_071615547.1|2907709_2907925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941015.1|2908898_2909114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|2909223_2910189_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_127592213.1|2910589_2911018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135006064.1|2910992_2911625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069078857.1|2911857_2912814_-|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
WP_135006014.1|2913396_2913939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858496.1|2914644_2914989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|2914993_2915959_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_165858563.1|2916185_2916269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119889849.1|2916328_2917490_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.2	2.7e-79
>prophage 13
NZ_CP052112	Ralstonia solanacearum strain FJAT15244.F1 chromosome, complete genome	3788096	3639014	3700842	3788096	protease,holin,tail,transposase	Klosneuvirus(22.22%)	48	NA	NA
WP_019719041.1|3639014_3640034_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043885957.1|3641004_3642729_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	31.9	1.8e-60
WP_016722564.1|3642746_3643646_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011000088.1|3644021_3645695_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016726797.1|3645781_3646276_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016726796.1|3646296_3646599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000085.1|3646673_3647195_-|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.6e-15
WP_016722568.1|3647209_3647743_-|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	2.6e-13
WP_016722569.1|3647752_3648301_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_165858323.1|3648804_3653823_+	autotransporter domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	52.9	3.9e-10
WP_028852449.1|3653862_3655047_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_172833519.1|3655506_3657360_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011000079.1|3657373_3658513_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013213874.1|3658509_3658737_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_058908149.1|3658746_3659574_+	thiazole synthase	NA	NA	NA	NA	NA
WP_071624005.1|3659570_3660722_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011000074.1|3660848_3661328_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	46.0	7.5e-28
WP_071624004.1|3661780_3662605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633634.1|3662927_3663752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633635.1|3664074_3664896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858538.1|3665160_3670950_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_011000068.1|3671151_3671514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000067.1|3671548_3672454_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_016722587.1|3672524_3673223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028860050.1|3673304_3674708_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_058907975.1|3674727_3676179_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_038938143.1|3676545_3676977_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_071624024.1|3676973_3677525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000060.1|3677773_3679198_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.0	3.2e-42
WP_011000059.1|3679264_3679606_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011000058.1|3679619_3680450_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_011000057.1|3680458_3680917_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_058907973.1|3681008_3681614_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_028852442.1|3681652_3683605_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	32.9	6.2e-12
WP_011000054.1|3683767_3684772_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_028852441.1|3684964_3685654_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_071624025.1|3685650_3686940_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.0	2.7e-80
WP_071624026.1|3686943_3687849_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071624027.1|3687924_3688770_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_020830859.1|3688766_3690119_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.0	2.6e-17
WP_020830858.1|3690149_3691052_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000047.1|3691256_3691562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907979.1|3691800_3694188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907963.1|3694563_3695283_-	response regulator	NA	NA	NA	NA	NA
WP_019717341.1|3695319_3697755_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_020830856.1|3697751_3698552_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_058907961.1|3698565_3699891_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011000041.1|3699981_3700842_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 1
NZ_CP052113	Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence	2134027	89723	119818	2134027	protease,transposase	Vibrio_phage(33.33%)	27	NA	NA
WP_086005422.1|89723_90874_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_173941026.1|93075_93330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069078857.1|93373_94330_+|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
WP_173941027.1|94352_95030_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_071623827.1|95034_96135_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_087451503.1|96186_96991_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016723619.1|97058_98024_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_139274350.1|98201_98552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908830.1|98541_98784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615619.1|98835_99270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908828.1|99321_99840_+	DUF2247 family protein	NA	NA	NA	NA	NA
WP_071615620.1|99888_100095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615618.1|100259_100613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858694.1|101442_101790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069078857.1|101879_102836_+|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
WP_165858568.1|103003_105544_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	2.4e-16
WP_058908831.1|105641_106256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190929.1|106260_108030_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_089190928.1|108042_108888_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_028854671.1|109133_109520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725441.1|109519_109987_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_043885670.1|110601_112749_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_028854668.1|112861_113899_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_058907852.1|114272_114770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907851.1|114932_116183_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_058907850.1|116208_117534_-	DUF3500 domain-containing protein	NA	Q7Y402	Yersinia_phage	45.5	4.5e-06
WP_165858569.1|118108_119818_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP052113	Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence	2134027	292373	386098	2134027	transposase,integrase	Ralstonia_phage(16.67%)	68	357577:357592	365555:365570
WP_165858583.1|292373_293740_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.4	1.6e-75
WP_016725410.1|294216_294675_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_089191141.1|294805_295546_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_011004625.1|295542_295845_+	AzlD family protein	NA	NA	NA	NA	NA
WP_016721735.1|298010_298976_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|298972_299122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158655383.1|299276_299897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139274363.1|299902_300148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624144.1|310531_318070_-	type III effector protein skwp2	NA	NA	NA	NA	NA
WP_016723619.1|318140_319106_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_058908591.1|319667_320198_-	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_058908592.1|320194_321019_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019719967.1|321015_321960_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	1.3e-28
WP_016727950.1|321943_323215_-	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_058908596.1|323211_325830_-	regulatory protein NosR	NA	NA	NA	NA	NA
WP_058908593.1|325887_327828_-	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_011004617.1|328056_328464_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_058908594.1|328468_329491_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_011004615.1|329603_330506_+	acyltransferase	NA	NA	NA	NA	NA
WP_058908595.1|331176_333774_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_028854568.1|334021_335653_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.7e-20
WP_011003443.1|336154_337486_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_089191010.1|338701_340141_-	MFS transporter	NA	NA	NA	NA	NA
WP_011004606.1|340137_341202_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_089191011.1|341393_342314_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081263853.1|342710_343064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898132.1|343134_344100_-	lipoprotein	NA	NA	NA	NA	NA
WP_087451503.1|344241_345047_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_028854566.1|345490_345868_+	RidA family protein	NA	NA	NA	NA	NA
WP_058908652.1|346190_346673_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_019719980.1|346665_347001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028854564.1|347250_347835_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173941029.1|349382_349940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941030.1|350023_350290_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_173941031.1|350418_350877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941032.1|351606_351945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941033.1|352152_352377_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071624213.1|352412_353984_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|354015_354366_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|354365_354830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173941034.1|355395_356196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941035.1|356432_359087_+	AAA family ATPase	NA	NA	NA	NA	NA
357577:357592	attL	GCAACCCATTCGAGAA	NA	NA	NA	NA
WP_173941036.1|359395_360634_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	55.2	1.6e-119
WP_019719983.1|360928_361423_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_165858584.1|361526_362567_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_020425386.1|362608_363046_+	RidA family protein	NA	NA	NA	NA	NA
WP_118872766.1|363090_364050_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_019719987.1|364283_364553_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_071014333.1|364585_365746_+	sialidase	NA	NA	NA	NA	NA
365555:365570	attR	TTCTCGAATGGGTTGC	NA	NA	NA	NA
WP_049832956.1|366083_366293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118872764.1|367011_368397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653901.1|368526_368715_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_071507169.1|368829_369519_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014631877.1|369557_369920_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_118872763.1|370049_370766_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_118872762.1|370801_372424_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016726292.1|372437_374015_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.0	5.5e-11
WP_020830396.1|374145_374856_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	5.0e-12
WP_019719996.1|374852_375602_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-16
WP_020830395.1|375598_376567_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014631870.1|376563_377433_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_118872761.1|377481_378741_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074960931.1|379693_380992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139180419.1|381155_381542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069078857.1|381771_382728_-|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
WP_087451503.1|383002_383807_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|383833_384658_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003443.1|384766_386098_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP052113	Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence	2134027	885402	917720	2134027	transposase,integrase	Shigella_phage(33.33%)	27	908128:908146	933789:933807
WP_086005422.1|885402_886553_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_071615345.1|887197_887470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043885802.1|887648_889586_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.8	7.7e-148
WP_038938484.1|889758_890145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020371926.1|890344_890911_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_016727451.1|891096_891504_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	32.1	7.3e-08
WP_020830062.1|891519_891960_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_086706442.1|892259_893969_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058908723.1|893974_896959_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_173941039.1|897235_898711_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_071507962.1|899954_900203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507963.1|900202_901072_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016723104.1|901113_901776_-	membrane protein	NA	NA	NA	NA	NA
WP_016723105.1|901829_902399_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071507964.1|902792_904778_-	GALA protein 1	NA	NA	NA	NA	NA
WP_028854351.1|904990_906097_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011004209.1|906394_907336_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_165858607.1|907417_907855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858608.1|907851_908622_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
908128:908146	attL	ATTGCCGCCGTCGGCGCCG	NA	NA	NA	NA
WP_016723109.1|908761_909691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_118872676.1|909793_910462_+	DsbA family protein	NA	NA	NA	NA	NA
WP_081350379.1|910538_911453_+	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_011004204.1|911556_911940_+	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
WP_058908707.1|912388_914089_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_119889937.1|914087_914273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723128.1|915376_916852_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_071653928.1|916895_917720_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
933789:933807	attR	CGGCGCCGACGGCGGCAAT	NA	NA	NA	NA
>prophage 4
NZ_CP052113	Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence	2134027	1092420	1150898	2134027	transposase,plate,tRNA	uncultured_Caudovirales_phage(33.33%)	39	NA	NA
WP_173941072.1|1092420_1094373_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.7	1.2e-42
WP_165858624.1|1094359_1095901_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_016723215.1|1096125_1098135_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019719459.1|1098276_1098831_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1099042_1099759_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_016721870.1|1101226_1102213_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016723220.1|1102738_1103020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858625.1|1103137_1104094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858705.1|1104292_1104811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086004752.1|1104846_1105649_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_158000583.1|1106289_1107207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858626.1|1107299_1108964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858627.1|1108979_1112000_-	DUF2345 domain-containing protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	22.8	3.2e-15
WP_165858628.1|1112137_1112884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858629.1|1113170_1114019_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011004063.1|1114058_1114328_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	1.8e-10
WP_020830172.1|1114338_1115826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020830173.1|1115863_1119793_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_019719447.1|1119789_1120776_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011004059.1|1120778_1121612_+	OmpA family protein	NA	NA	NA	NA	NA
WP_043898207.1|1121710_1122679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624176.1|1122751_1123831_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_016725644.1|1123964_1125308_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_019719442.1|1126060_1126444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165858631.1|1127007_1130358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118872649.1|1130388_1131027_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_118872648.1|1131234_1132341_-	MFS transporter	NA	NA	NA	NA	NA
WP_089191096.1|1135107_1136241_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_071623901.1|1136258_1139015_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.5	3.5e-37
WP_028861634.1|1139035_1141753_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_165858632.1|1141785_1142877_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_165858633.1|1142840_1144691_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011004044.1|1144753_1145227_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011004043.1|1145287_1145791_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_058908677.1|1145879_1147370_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011004041.1|1147362_1147875_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011004040.1|1147911_1148559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020371629.1|1148833_1149508_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011004038.1|1149551_1150898_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP052113	Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence	2134027	1363765	1385784	2134027	transposase	Leptospira_phage(42.86%)	19	NA	NA
WP_071624208.1|1363765_1365274_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_045579185.1|1365263_1366061_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.6	2.9e-32
WP_165592216.1|1366415_1366748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858707.1|1367510_1369145_-	glycoside hydrolase family 6 protein	NA	NA	NA	NA	NA
WP_071624213.1|1369519_1371091_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|1371122_1371473_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|1371472_1371937_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_058908424.1|1373139_1373361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160329291.1|1374810_1374954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005422.1|1374946_1376097_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_135006101.1|1376157_1376352_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	87.5	1.1e-27
WP_058908422.1|1376484_1377147_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	59.5	1.8e-64
WP_011003870.1|1377537_1378110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049842290.1|1378457_1378898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719041.1|1380106_1381126_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058908419.1|1381743_1382121_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_058908418.1|1382211_1383255_+	transporter	NA	NA	NA	NA	NA
WP_011003864.1|1383244_1383802_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_071624213.1|1384212_1385784_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
>prophage 6
NZ_CP052113	Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence	2134027	1412836	1465120	2134027	transposase,integrase	Acidithiobacillus_phage(54.55%)	39	1408079:1408094	1435820:1435835
1408079:1408094	attL	CAAGCGCTGATACCCA	NA	NA	NA	NA
WP_118888167.1|1412836_1413205_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_118888166.1|1413529_1414066_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_028852788.1|1414332_1415757_+	amino acid permease	NA	NA	NA	NA	NA
WP_118888165.1|1417876_1419418_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_118888164.1|1419431_1420340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118888163.1|1420336_1421182_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_173940981.1|1421194_1422946_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_118888161.1|1422957_1425498_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.0	1.4e-16
WP_118888160.1|1425587_1426163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118888159.1|1426577_1427015_-	replication initiation protein	NA	NA	NA	NA	NA
WP_104073129.1|1435910_1436405_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	57.3	1.8e-21
1435820:1435835	attR	CAAGCGCTGATACCCA	NA	NA	NA	NA
WP_013211002.1|1436526_1436715_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	64.2	4.5e-13
WP_118888158.1|1436939_1437305_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.8	2.9e-32
WP_118888157.1|1437346_1438567_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.5	6.0e-191
WP_118888156.1|1438563_1439964_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.6	1.3e-165
WP_118888155.1|1440190_1441429_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.5	2.4e-33
WP_118888153.1|1442265_1442673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064477618.1|1442662_1442875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118888152.1|1443106_1445404_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	65.2	1.1e-294
WP_118888151.1|1445387_1445786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162904297.1|1445791_1446259_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	52.9	1.3e-37
WP_019717722.1|1446268_1446901_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	3.6e-62
WP_118888149.1|1446919_1447792_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.1	5.4e-101
WP_118888148.1|1447788_1448286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118888147.1|1448282_1448537_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_118888146.1|1448919_1449174_+	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_118888145.1|1449148_1450336_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_118888144.1|1450322_1450751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086004752.1|1450799_1451602_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_019719041.1|1452043_1453063_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162904296.1|1454350_1454497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118888141.1|1454704_1455748_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_162904295.1|1455956_1456508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118888139.1|1456659_1457634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118888250.1|1457630_1458860_-	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_011003443.1|1459894_1461226_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_162904294.1|1461383_1461524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165858658.1|1461577_1463503_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_071624208.1|1463611_1465120_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
