The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	213995	265663	3854510	terminase,head,transposase,capsid,portal	Acidithiobacillus_phage(52.94%)	64	NA	NA
WP_020831502.1|213995_215324_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_058907396.1|216026_216491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725581.1|216780_217137_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	40.5	3.9e-13
WP_011003155.1|217253_217523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003154.1|217797_218478_-	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	39.8	9.0e-35
WP_016722434.1|218474_219131_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011003152.1|219332_220037_+	septal ring lytic transglycosylase RlpA family protein	NA	H2BCY4	Synechococcus_phage	51.1	1.1e-16
WP_011003151.1|220033_220936_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_058907395.1|220971_221364_+	YraN family protein	NA	NA	NA	NA	NA
WP_011003149.1|221418_222234_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011003148.1|222358_222709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907394.1|222705_224001_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023470371.1|224128_225025_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016722439.1|225182_225530_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_016722440.1|225538_226030_+	thiosulfate oxidation carrier protein SoxY	NA	NA	NA	NA	NA
WP_016722441.1|226049_226361_+	thiosulfate oxidation carrier complex protein SoxZ	NA	NA	NA	NA	NA
WP_011003142.1|226371_226830_+	DsrE family protein	NA	NA	NA	NA	NA
WP_058907447.1|226890_227664_+	sulfur oxidation c-type cytochrome SoxA	NA	NA	NA	NA	NA
WP_081365883.1|227660_228332_+	sulfur oxidation c-type cytochrome SoxX	NA	NA	NA	NA	NA
WP_058907392.1|228340_228850_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_173941429.1|228846_230565_+	thiosulfohydrolase SoxB	NA	NA	NA	NA	NA
WP_100226526.1|231321_232377_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_011003136.1|232354_232879_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_069078857.1|233169_234126_-|transposase	IS5-like element IS1420 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.4	4.6e-61
WP_086004967.1|234383_235503_+|transposase	IS3-like element ISRso12 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-50
WP_118940513.1|236207_236696_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	52.9	7.3e-39
WP_118940514.1|236692_237067_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	65.4	1.6e-41
WP_173941430.1|237063_238452_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.3	2.7e-219
WP_016725617.1|238448_238898_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	6.7e-55
WP_080624758.1|238897_239116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725619.1|239255_240050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941431.1|240128_242360_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.4	4.7e-290
WP_167810857.1|242409_242871_-	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	64.7	4.0e-47
WP_167797757.1|243099_243363_+	helix-turn-helix domain-containing protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	7.0e-20
WP_173941432.1|243373_243856_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	59.4	8.0e-46
WP_118909130.1|243852_244713_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.9	3.8e-107
WP_058907376.1|244709_245351_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.8	3.9e-80
WP_038962123.1|245358_245835_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	65.6	8.7e-53
WP_058907375.1|245834_246572_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	6.4e-111
WP_118871947.1|246568_246829_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	6.5e-18
WP_118871948.1|246825_249114_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.4	1.2e-285
WP_075463046.1|249244_249709_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
WP_011003115.1|249710_249920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725340.1|249912_250296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|250350_250617_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_011003112.1|250616_250916_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_173941433.1|251566_252967_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.6	9.1e-167
WP_173941434.1|252963_254184_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.2	4.9e-193
WP_020371857.1|254226_254592_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	8.5e-32
WP_016726852.1|254816_255005_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_020833014.1|255126_255642_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	68.7	2.3e-22
WP_107523986.1|255747_256086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833012.1|256105_256642_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	81.5	5.5e-72
WP_020833011.1|256641_258624_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.1	0.0e+00
WP_173941435.1|258667_259177_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	46.5	4.8e-25
WP_058908380.1|259187_259580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|259580_259802_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_058908381.1|259801_261349_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_173941436.1|261358_262609_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	40.8	1.7e-60
WP_071508058.1|262618_262996_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.8	2.3e-24
WP_021154689.1|263002_264007_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.2	2.5e-110
WP_021154690.1|264009_264312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727774.1|264317_264764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|264889_265663_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
>prophage 2
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	275196	284217	3854510		Ralstonia_phage(50.0%)	9	NA	NA
WP_119417478.1|275196_278787_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.3	0.0e+00
WP_173941438.1|278798_279965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885695.1|279968_280451_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
WP_043885696.1|280447_280846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047650.1|280850_282695_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.1	2.4e-106
WP_064047651.1|282704_282929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003270772.1|282995_283286_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_020832987.1|283282_283759_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_043897848.1|283755_284217_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	83.0	7.8e-67
>prophage 3
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	304975	324949	3854510		Acidithiobacillus_phage(88.89%)	24	NA	NA
WP_173941443.1|304975_305662_+	S-adenosylmethionine-binding protein	NA	A0A076YNT4	Mesorhizobium_phage	72.3	2.3e-86
WP_173941444.1|305714_306194_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	46.4	1.2e-28
WP_173941445.1|306190_306565_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	63.0	1.7e-40
WP_173941446.1|306561_307950_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	81.4	2.5e-217
WP_173941447.1|307946_308396_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	3.9e-55
WP_173941448.1|308395_308614_-	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	60.3	3.8e-11
WP_043876685.1|308765_309440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003129.1|309439_309727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100226524.1|309781_310942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941449.1|311071_313309_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.4	1.2e-290
WP_167810857.1|313358_313820_-	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	64.7	4.0e-47
WP_167797757.1|314048_314312_+	helix-turn-helix domain-containing protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	7.0e-20
WP_173941432.1|314322_314805_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	59.4	8.0e-46
WP_118909130.1|314801_315662_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.9	3.8e-107
WP_058907376.1|315658_316300_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.8	3.9e-80
WP_038962123.1|316307_316784_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	65.6	8.7e-53
WP_058907375.1|316783_317521_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	6.4e-111
WP_118871947.1|317517_317778_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	6.5e-18
WP_173941450.1|317774_320063_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.4	7.9e-285
WP_071624069.1|320193_320658_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	66.2	6.5e-53
WP_011003115.1|320659_320869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624070.1|320861_321242_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_019717180.1|321257_321497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941644.1|322276_324949_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	2.5e-88
>prophage 4
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	332578	396200	3854510	transposase,protease	Acidithiobacillus_phage(46.67%)	55	NA	NA
WP_071624170.1|332578_333544_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_011003099.1|333772_333967_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	68.6	4.8e-18
WP_011003098.1|333982_334219_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.3	1.6e-20
WP_173941453.1|335649_337113_-	MFS transporter	NA	NA	NA	NA	NA
WP_028861132.1|337162_337969_-	oxidoreductase	NA	NA	NA	NA	NA
WP_071507945.1|338061_339522_-	TolC family protein	NA	NA	NA	NA	NA
WP_071507947.1|339609_340224_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003094.1|340311_341427_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011003093.1|341423_344546_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016725028.1|345330_345690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615479.1|345742_346429_+	TolC family protein	NA	NA	NA	NA	NA
WP_019717165.1|346832_347570_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071624190.1|347818_348643_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003086.1|348700_349237_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
WP_158594538.1|349395_350028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003084.1|350352_350577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624189.1|350643_350934_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	47.6	5.3e-13
WP_011003082.1|350930_351413_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.6	4.8e-59
WP_089190464.1|351483_352600_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.4	8.9e-48
WP_038962648.1|352670_353120_+	HNH endonuclease	NA	A0A290FZR9	Caldibacillus_phage	48.9	2.8e-21
WP_119889901.1|353116_353578_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	79.6	1.9e-65
WP_019719020.1|353645_353942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003078.1|353993_354326_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_173941454.1|355447_363967_+	hemagglutinin	NA	NA	NA	NA	NA
WP_058908815.1|363963_364317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615637.1|364466_364781_+	colicin	NA	NA	NA	NA	NA
WP_072633614.1|365120_365576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139274359.1|365691_365997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941455.1|366085_368626_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	3.2e-16
WP_173941456.1|368637_370389_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_167801123.1|370401_371247_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_173941457.1|371440_372532_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_107523985.1|373533_375006_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011003065.1|375146_375458_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011003064.1|375615_376080_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173941458.1|376191_376887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162915984.1|376998_378196_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.7e-103
WP_071654057.1|378702_379638_+	type III effector protein	NA	NA	NA	NA	NA
WP_071654056.1|379619_380093_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	51.4	4.0e-34
WP_071654055.1|380089_380464_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	63.8	3.0e-40
WP_071654054.1|380460_381849_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.1	7.8e-219
WP_011003058.1|381845_382295_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	2.3e-55
WP_172833495.1|382294_382513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064478163.1|383050_384385_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_064478162.1|384495_385389_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064478161.1|385653_386772_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_019719001.1|386952_388140_+	MFS transporter	NA	NA	NA	NA	NA
WP_064478159.1|388264_388894_+	LysE family translocator	NA	NA	NA	NA	NA
WP_071654053.1|389007_389832_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071615590.1|389857_390193_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_016725374.1|390223_390841_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_016725375.1|390877_391321_-	cyanase	NA	NA	NA	NA	NA
WP_071615588.1|391462_392797_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.5	1.1e-09
WP_071615587.1|393117_394482_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_087451503.1|395395_396200_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	985076	1040744	3854510	transposase,coat,protease	Lake_Baikal_phage(25.0%)	55	NA	NA
WP_162915984.1|985076_986275_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.7e-103
WP_019718280.1|986374_986692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172833497.1|986742_986952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853600.1|987484_987739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615273.1|988507_988672_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	55.1	1.2e-06
WP_011002610.1|989117_989444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002609.1|989537_989822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832642.1|990905_991043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|991160_991478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002607.1|991628_991925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853597.1|992021_992882_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_071615274.1|992898_993159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002605.1|994504_995008_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_058907884.1|995057_995561_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049842205.1|995679_996399_+	molecular chaperone	NA	NA	NA	NA	NA
WP_058907885.1|996448_998713_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_172833515.1|998730_999219_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002600.1|999288_999831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|1000436_1001381_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_058907886.1|1001599_1001848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002597.1|1001906_1002149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271865.1|1002307_1002808_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_011002596.1|1002881_1003757_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_058907887.1|1003753_1004032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028853591.1|1004053_1004878_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011002593.1|1004912_1005635_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011002592.1|1005759_1006803_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011002591.1|1006855_1007995_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_016723685.1|1008189_1008630_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_016723684.1|1008633_1009122_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_028860948.1|1009118_1009709_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723683.1|1009705_1010734_+	PilW family protein	NA	NA	NA	NA	NA
WP_011002586.1|1010737_1011274_+	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071623704.1|1011305_1014518_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_011002584.1|1014613_1015111_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.2	5.5e-26
WP_016723680.1|1015127_1015826_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_016726000.1|1015868_1016348_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_016723678.1|1016398_1016794_-	VOC family protein	NA	NA	NA	NA	NA
WP_028853586.1|1016951_1017674_-	LrgB family protein	NA	NA	NA	NA	NA
WP_058907889.1|1017670_1018048_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_058907890.1|1018099_1019347_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_058907891.1|1019356_1020475_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_058907892.1|1020485_1021979_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_058907893.1|1022149_1023040_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165591180.1|1023050_1024469_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_019718299.1|1024589_1025147_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011002572.1|1025220_1026117_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016723669.1|1026401_1026737_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011002570.1|1026860_1027940_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
WP_165591181.1|1028332_1029793_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_165591182.1|1029820_1030690_-	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	6.3e-09
WP_173941516.1|1030695_1034973_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_043897788.1|1035152_1038020_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011002565.1|1038016_1038637_+	rhombosortase	NA	NA	NA	NA	NA
WP_173941517.1|1038692_1040744_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.1e-10
>prophage 6
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	1057750	1067889	3854510		Hokovirus(14.29%)	9	NA	NA
WP_021155204.1|1057750_1059712_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_011002544.1|1059846_1060989_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_028860933.1|1061024_1062905_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	4.6e-57
WP_058907902.1|1062860_1063547_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	8.8e-14
WP_011002541.1|1063554_1064262_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011002540.1|1064273_1065098_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	1.9e-34
WP_011002539.1|1065154_1065799_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-06
WP_003271964.1|1065832_1066342_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_020832586.1|1066341_1067889_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 7
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	1886662	1963935	3854510	terminase,capsid,tRNA,tail,head,protease,transposase,integrase,portal	Burkholderia_virus(23.08%)	83	1912019:1912045	1950943:1950969
WP_011001577.1|1886662_1887643_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_011001578.1|1887709_1889071_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_028853106.1|1889166_1890351_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_081365330.1|1890355_1891063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019718725.1|1891105_1892320_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_016721795.1|1892347_1893205_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_020832103.1|1893316_1894510_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_173941545.1|1894544_1897976_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_019718729.1|1898147_1898909_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011001586.1|1898905_1899412_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_173941546.1|1899491_1900019_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016721800.1|1900077_1900626_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_016721801.1|1900797_1902159_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003267785.1|1902196_1902919_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.8	1.4e-33
WP_020425251.1|1903198_1903549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001591.1|1903620_1905237_+	DUF1800 family protein	NA	NA	NA	NA	NA
WP_011001592.1|1905264_1906449_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_011001593.1|1906449_1907322_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_064477835.1|1907458_1908667_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_019718736.1|1908733_1911853_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
1912019:1912045	attL	GGGGTTCGAGTCCCCTCCCTCGCACCA	NA	NA	NA	NA
WP_072633553.1|1912092_1913319_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	54.1	2.5e-112
WP_072633555.1|1913476_1914355_-	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	54.9	3.5e-31
WP_072633556.1|1914356_1915157_-	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_081373585.1|1915153_1915939_-	PRTRC system protein A	NA	NA	NA	NA	NA
WP_072633557.1|1915940_1916663_-	PRTRC system protein B	NA	NA	NA	NA	NA
WP_072633558.1|1916670_1917720_-	PRTRC system protein F	NA	NA	NA	NA	NA
WP_072633559.1|1917716_1918106_-	PRTRC system protein C	NA	NA	NA	NA	NA
WP_072633560.1|1918118_1918712_-	PRTRC system protein E	NA	NA	NA	NA	NA
WP_072633561.1|1918737_1918974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072633562.1|1918970_1919402_-	hypothetical protein	NA	A0A291LIA5	Streptomyces_phage	35.5	4.7e-05
WP_072633644.1|1919411_1919627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172833501.1|1919632_1919785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941547.1|1919781_1920219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025748.1|1920215_1920590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772885.1|1921284_1921905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072633566.1|1922181_1922706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072633567.1|1923262_1923766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633568.1|1923762_1924173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633569.1|1924181_1924376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633570.1|1924372_1925407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633571.1|1925403_1925700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633572.1|1925723_1926326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001621.1|1926509_1926884_+	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	43.1	2.8e-22
WP_049832880.1|1927315_1927657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633573.1|1927701_1929372_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	63.0	4.4e-208
WP_011001622.1|1929374_1929533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633574.1|1929529_1930753_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	69.6	4.5e-162
WP_072633575.1|1930760_1931372_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	61.9	9.4e-60
WP_011001625.1|1931382_1932621_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	56.8	2.5e-128
WP_011001626.1|1932654_1932978_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_072633576.1|1932985_1933312_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_173941548.1|1933314_1933818_+	HK97 gp10 family phage protein	NA	I7GSL4	Xanthomonas_virus	32.7	1.4e-08
WP_072633578.1|1933807_1934161_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_072633579.1|1934224_1934878_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	54.0	3.4e-55
WP_072633580.1|1934884_1935205_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	40.0	3.6e-10
WP_173941549.1|1935252_1935513_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	43.9	2.1e-08
WP_173941550.1|1935514_1938388_+|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	33.7	1.5e-91
WP_072633583.1|1938390_1938729_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	50.5	1.3e-23
WP_072633584.1|1938725_1939361_+|tail	phage tail protein	tail	A0A088FQW7	Escherichia_phage	39.4	7.3e-31
WP_072633585.1|1939366_1939963_+|tail	tail fiber assembly protein	tail	A0A0A0YSY3	Erwinia_phage	47.8	2.2e-05
WP_072633586.1|1939959_1940661_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	61.5	1.4e-75
WP_072633587.1|1940662_1941373_+	C40 family peptidase	NA	D6PG99	uncultured_phage	54.5	9.0e-70
WP_072633645.1|1941376_1941979_+|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	56.0	4.6e-51
WP_028853154.1|1942048_1942387_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_072633588.1|1942383_1942638_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_173941551.1|1942688_1945844_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	56.6	0.0e+00
WP_028853157.1|1946180_1946837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001641.1|1946905_1947397_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	67.7	8.7e-56
WP_011001642.1|1947396_1947705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081373587.1|1947707_1947977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633592.1|1947973_1948333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633593.1|1948486_1949269_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_081373591.1|1949356_1949659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072633594.1|1949693_1950731_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011001649.1|1951100_1951295_+	hypothetical protein	NA	NA	NA	NA	NA
1950943:1950969	attR	GGGGTTCGAGTCCCCTCCCTCGCACCA	NA	NA	NA	NA
WP_071623776.1|1951366_1953340_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_011001651.1|1953594_1954944_+	trigger factor	NA	NA	NA	NA	NA
WP_003267806.1|1954973_1955627_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	1.8e-53
WP_011001652.1|1955792_1957067_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	4.9e-135
WP_011001653.1|1957237_1959658_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	4.8e-224
WP_003267811.1|1959831_1960104_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	57.3	1.6e-19
WP_011001654.1|1960526_1962473_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_020831502.1|1962606_1963935_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	2164106	2170730	3854510	coat	Ralstonia_phage(100.0%)	11	NA	NA
WP_021155768.1|2164106_2164538_-	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	100.0	1.2e-77
WP_165591397.1|2164579_2165212_-	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	70.4	1.9e-71
WP_165591398.1|2165289_2166384_-	zonular occludens toxin	NA	A0JC28	Ralstonia_phage	99.2	8.6e-205
WP_015984160.1|2166380_2166656_-	DUF2523 domain-containing protein	NA	A0JC27	Ralstonia_phage	100.0	4.3e-36
WP_173941576.1|2166652_2167888_-	hypothetical protein	NA	S6BAK4	Ralstonia_phage	98.8	1.0e-209
WP_010889942.1|2167967_2168303_-	hypothetical protein	NA	A0JC24	Ralstonia_phage	100.0	1.6e-56
WP_015984157.1|2168302_2168572_-|coat	major coat protein	coat	A0JC23	Ralstonia_phage	100.0	4.9e-37
WP_010889944.1|2168571_2168883_-	hypothetical protein	NA	A0JC22	Ralstonia_phage	100.0	8.2e-52
WP_015984156.1|2168887_2170015_-	replication initiation factor domain-containing protein	NA	A0JC21	Ralstonia_phage	100.0	1.3e-219
WP_015984155.1|2170014_2170221_-	hypothetical protein	NA	A0JC20	Ralstonia_phage	100.0	2.8e-32
WP_089190813.1|2170337_2170730_+	helix-turn-helix transcriptional regulator	NA	S6B268	Ralstonia_phage	100.0	4.8e-65
>prophage 9
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	2531273	2617084	3854510	terminase,tRNA,tail,head,plate,holin,protease,integrase,capsid,portal	Ralstonia_phage(43.48%)	87	2562926:2562950	2605419:2605443
WP_058906991.1|2531273_2532671_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016722164.1|2532844_2533804_+	patatin-like phospholipase family protein	NA	H8ZJB8	Ostreococcus_tauri_virus	28.3	5.0e-07
WP_011001127.1|2533877_2534546_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_019718013.1|2534835_2536491_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	3.2e-17
WP_058906992.1|2536487_2537612_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058906993.1|2537618_2538674_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_058906994.1|2538692_2540570_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011001122.1|2540835_2541630_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011001121.1|2542031_2543282_-	aspartate kinase	NA	NA	NA	NA	NA
WP_172833504.1|2543410_2544799_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011001119.1|2544806_2545775_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_058906996.1|2545861_2546737_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_019718008.1|2546721_2548119_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.3	8.0e-38
WP_016722170.1|2548361_2549021_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058906997.1|2549074_2549647_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_019718005.1|2549685_2550192_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_058906998.1|2550188_2550995_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016725822.1|2551016_2551763_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_087451881.1|2551899_2552763_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011001110.1|2552876_2553689_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011001109.1|2553734_2554283_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058907000.1|2554375_2555104_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_058907001.1|2555100_2555826_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_071507421.1|2555834_2557637_-	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_058907003.1|2557712_2559584_-	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	6.1e-09
WP_058907004.1|2559717_2560533_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	32.6	1.0e-29
WP_071507420.1|2560565_2561768_-	MFS transporter	NA	NA	NA	NA	NA
WP_011001102.1|2561880_2562774_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2562926:2562950	attL	CAAGCACACGCCGATGATGCAGCAG	NA	NA	NA	NA
WP_071895526.1|2564837_2567699_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.2	2.7e-40
WP_071895527.1|2567709_2569716_+	phospholipase	NA	NA	NA	NA	NA
WP_016723932.1|2569719_2571027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907760.1|2571048_2571339_+	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	35.6	4.1e-05
WP_071653990.1|2571375_2572023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722186.1|2572468_2572807_+	DUF1484 family protein	NA	NA	NA	NA	NA
WP_071895528.1|2572828_2573908_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	92.0	1.8e-194
WP_071895529.1|2573904_2575686_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	91.2	0.0e+00
WP_071895530.1|2575822_2576665_+|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	77.9	7.0e-122
WP_016722191.1|2576703_2577756_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	74.0	4.0e-143
WP_016722192.1|2577752_2578475_+|terminase	terminase endonuclease subunit	terminase	A4PE31	Ralstonia_virus	77.5	8.7e-97
WP_038962045.1|2578572_2579052_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	84.3	9.6e-68
WP_058907767.1|2579051_2579255_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	86.8	7.2e-25
WP_071895531.1|2579270_2579678_+	hypothetical protein	NA	A0A077K9X1	Ralstonia_phage	91.1	3.4e-21
WP_071895532.1|2579674_2579992_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	94.1	5.2e-46
WP_071895533.1|2579988_2580792_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	84.2	3.2e-124
WP_038961971.1|2580788_2581223_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	86.8	1.2e-69
WP_071895534.1|2581219_2581690_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	81.6	6.1e-59
WP_135005999.1|2581669_2582083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135006000.1|2582416_2583064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127591872.1|2583162_2584185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895535.1|2584485_2585103_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	94.6	1.4e-108
WP_016722200.1|2585099_2585447_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	99.1	1.7e-58
WP_089190568.1|2585449_2586358_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	97.4	1.7e-158
WP_023470164.1|2586350_2586968_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	96.2	1.5e-100
WP_173941583.1|2586974_2588639_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	96.4	6.7e-310
WP_127591875.1|2588651_2589404_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	89.2	5.5e-118
WP_118891147.1|2589400_2589865_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	91.6	2.4e-79
WP_118891148.1|2589958_2591134_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	94.6	5.8e-215
WP_118891149.1|2591165_2591675_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	84.6	1.2e-81
WP_118891150.1|2591750_2592077_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	94.4	9.8e-48
WP_003267618.1|2592073_2592175_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_173941584.1|2592171_2594835_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.6	0.0e+00
WP_028853264.1|2594837_2595260_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	99.3	1.4e-73
WP_071895542.1|2595256_2596384_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.0	4.6e-201
WP_071654013.1|2596494_2596689_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	69.2	1.6e-13
WP_071895543.1|2596651_2597518_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	59.2	5.6e-50
WP_127591879.1|2597666_2598035_-	hypothetical protein	NA	A0A077K8S5	Ralstonia_phage	85.1	2.7e-54
WP_080606373.1|2598158_2598629_-	helix-turn-helix transcriptional regulator	NA	A0A077K9Z1	Ralstonia_phage	60.4	9.8e-41
WP_127591882.1|2598702_2598912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721650.1|2598973_2599222_+	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	82.9	4.7e-34
WP_071895544.1|2599339_2599894_+	Bro-N domain-containing protein	NA	A0A077K9T3	Ralstonia_phage	85.2	8.5e-84
WP_155773171.1|2599904_2600081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907787.1|2600080_2600317_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	80.8	5.1e-30
WP_071895545.1|2600309_2600519_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	72.9	5.5e-20
WP_071895546.1|2600933_2603618_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	92.8	0.0e+00
WP_016721659.1|2603677_2603905_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	73.1	7.6e-23
WP_071895636.1|2603905_2605189_-|integrase	tyrosine-type recombinase/integrase	integrase	C7BGE7	Burkholderia_phage	55.9	4.0e-137
WP_148668915.1|2606643_2608011_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	30.1	9.9e-25
2605419:2605443	attR	CAAGCACACGCCGATGATGCAGCAG	NA	NA	NA	NA
WP_058907006.1|2608010_2609075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001099.1|2609130_2609655_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011001098.1|2609666_2610896_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_127591883.1|2611070_2611454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019717992.1|2611538_2612324_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.5	1.4e-26
WP_058907008.1|2612358_2613555_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_028852909.1|2613595_2614480_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_028852908.1|2614598_2615171_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831674.1|2615190_2616393_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019717989.1|2616406_2617084_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 10
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	2828656	2836892	3854510		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|2828656_2829709_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|2829865_2830789_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_058907684.1|2830906_2832019_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|2832099_2833002_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|2833105_2833423_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011000867.1|2833552_2834548_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_049842162.1|2834544_2835492_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2835518_2836892_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 11
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	2879773	2893879	3854510	tail	Ralstonia_phage(55.56%)	12	NA	NA
WP_058907694.1|2879773_2880235_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
WP_028860336.1|2880231_2880708_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
WP_016724633.1|2880704_2880995_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058907695.1|2881062_2881287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508023.1|2881296_2883132_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.1	1.1e-103
WP_071508022.1|2883136_2883535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727799.1|2883531_2884014_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
WP_071653957.1|2884017_2885184_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.3	7.9e-47
WP_071895561.1|2885195_2888786_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_016727790.1|2888815_2889388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727789.1|2889374_2889770_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.6e-31
WP_071653956.1|2889775_2893879_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.8	1.4e-26
>prophage 12
NZ_CP052086	Ralstonia solanacearum strain FJAT15353.F50 chromosome, complete genome	3854510	2901696	2922913	3854510	terminase,capsid,portal,head	Acidithiobacillus_phage(44.44%)	28	NA	NA
WP_071653954.1|2901696_2902470_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_071508048.1|2902592_2903039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833003.1|2903044_2903347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653953.1|2903349_2904354_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	1.9e-110
WP_071653952.1|2904360_2904738_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_071653951.1|2904747_2906007_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.4	4.6e-61
WP_016725355.1|2906016_2907543_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_016725356.1|2907542_2907764_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016727772.1|2907764_2908157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653949.1|2908167_2908677_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
WP_172833506.1|2908720_2910703_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_038962858.1|2910702_2911239_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_038938655.1|2911258_2911597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624100.1|2911703_2912210_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.3	4.0e-24
WP_016727890.1|2912339_2912846_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	32.9	2.9e-14
WP_038938808.1|2912973_2913324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162904291.1|2913421_2913586_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	56.1	1.1e-07
WP_143102330.1|2913634_2913964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725010.1|2913960_2914341_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_071653948.1|2914323_2915598_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.1	6.3e-199
WP_071508043.1|2915594_2916998_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.5	8.3e-160
WP_058908894.1|2917395_2917803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727896.1|2917792_2918002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064047862.1|2918236_2920534_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
WP_021156153.1|2920517_2920907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938742.1|2920912_2921380_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	53.5	5.9e-38
WP_016727900.1|2921389_2922022_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	61.0	3.8e-64
WP_016727901.1|2922040_2922913_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	2.9e-102
>prophage 1
NZ_CP052087	Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence	1975963	29651	39119	1975963	transposase	Ralstonia_phage(33.33%)	8	NA	NA
WP_111395307.1|29651_32312_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	84.0	0.0e+00
WP_089191146.1|32334_33234_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	76.1	1.5e-117
WP_086005422.1|34797_35947_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_089190946.1|36710_36977_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	56.5	5.2e-07
WP_028852826.1|37600_37867_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	50.6	1.4e-12
WP_089190947.1|37882_38602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829484.1|38625_38844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080511052.1|38891_39119_+	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	56.6	7.4e-10
>prophage 2
NZ_CP052087	Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence	1975963	674148	745990	1975963	transposase	Mycobacterium_phage(50.0%)	60	NA	NA
WP_011003886.1|674148_674280_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038937658.1|674511_675342_+	oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.8	4.8e-06
WP_016723906.1|675419_676439_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_028854180.1|677792_678203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908790.1|678199_678625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723910.1|679427_679589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908789.1|679764_680607_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_058908788.1|680848_681346_-	VOC family protein	NA	NA	NA	NA	NA
WP_016723912.1|681693_682635_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_011003897.1|682803_683448_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908793.1|683573_684005_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_058908787.1|684087_684519_+	VOC family protein	NA	NA	NA	NA	NA
WP_058908818.1|684887_685277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908819.1|685851_687843_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_019719336.1|688407_689436_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_011003903.1|689447_689735_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_011003904.1|689744_690551_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_058908820.1|690544_691099_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_016727726.1|691131_692223_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	M4QRZ2	Synechococcus_phage	41.8	2.2e-11
WP_058908821.1|692244_692625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049997.1|692779_693301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615527.1|693651_693999_+	immunity protein 58	NA	NA	NA	NA	NA
WP_071624086.1|694002_694518_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016723918.1|694770_695103_+	DUF2322 family protein	NA	NA	NA	NA	NA
WP_058908654.1|695215_695818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028854186.1|695875_697183_-	MFS transporter	NA	NA	NA	NA	NA
WP_058908655.1|697499_697868_-	DUF2784 domain-containing protein	NA	NA	NA	NA	NA
WP_135006099.1|697895_698267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908664.1|698270_698888_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003912.1|699108_699759_-	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
WP_058908656.1|699755_701072_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_011003914.1|701074_701677_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	35.3	3.3e-17
WP_058908657.1|701708_702812_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_058908658.1|702816_704376_-	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_058908659.1|704372_705137_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_019719324.1|705133_705949_-	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_011003919.1|705945_706677_-	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_021155658.1|706673_707825_-	cobalamin biosynthesis protein CbiD	NA	NA	NA	NA	NA
WP_058908660.1|707827_709432_-	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_011003922.1|709428_710136_-	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_058908661.1|710873_712790_-	putative cobaltochelatase	NA	NA	NA	NA	NA
WP_173941693.1|712786_716908_-	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_016723929.1|716904_717234_-	ferredoxin protein	NA	NA	NA	NA	NA
WP_071507931.1|717230_718304_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_173941694.1|718924_721798_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_058908767.1|721808_723818_+	phospholipase	NA	NA	NA	NA	NA
WP_172833527.1|723821_725129_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_058908766.1|725158_727150_+	phospholipase	NA	NA	NA	NA	NA
WP_172833528.1|727153_728461_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_064478391.1|728475_728766_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_071508014.1|728863_729514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908765.1|730024_731023_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_058908769.1|731854_733090_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_087451503.1|733451_734257_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.7	1.4e-26
WP_087451503.1|735446_736252_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.7	1.4e-26
WP_087451503.1|738002_738808_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.7	1.4e-26
WP_173941695.1|738871_739834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162915984.1|739886_741084_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.7e-103
WP_173941696.1|741331_744940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|745185_745990_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.7	1.4e-26
>prophage 3
NZ_CP052087	Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence	1975963	895760	916052	1975963	plate,transposase	Leptospira_phage(50.0%)	18	NA	NA
WP_173941703.1|895760_896237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173941704.1|896233_896587_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_021156267.1|896619_898176_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.4	2.0e-74
WP_028854792.1|898307_898622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908039.1|899713_900631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615268.1|900674_901733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507473.1|901729_903304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908676.1|903300_906093_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.7	4.6e-45
WP_028854259.1|906151_906943_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011004038.1|906939_908286_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_072633706.1|908329_909004_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011004040.1|909278_909926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011004041.1|909962_910475_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_058908677.1|910467_911958_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011004043.1|912046_912550_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011004044.1|912610_913084_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_058908678.1|913146_914997_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058908679.1|914960_916052_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
