The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	19230	68656	3702722	transposase,tRNA,tail	Microbacterium_phage(22.22%)	40	NA	NA
WP_086004752.1|19230_20033_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_016726789.1|20110_20590_-	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	46.7	2.0e-28
WP_020830876.1|21870_22698_-	thiazole synthase	NA	NA	NA	NA	NA
WP_013213874.1|22707_22935_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_043897620.1|22931_24071_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172833519.1|24084_25938_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_019717362.1|26397_27582_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_020830880.1|27621_32640_-	autotransporter domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	52.9	3.9e-10
WP_016722569.1|33143_33692_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016722568.1|33701_34235_+|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	2.6e-13
WP_011000085.1|34249_34771_+|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.6e-15
WP_016722567.1|34845_35148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000087.1|35168_35663_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011000088.1|35749_37423_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016722564.1|37798_38698_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020830883.1|38715_40440_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	31.9	5.4e-60
WP_020830884.1|40897_41263_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_019719041.1|41406_42426_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020830886.1|43060_43282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144061914.1|43508_44900_-	YncE family protein	NA	NA	NA	NA	NA
WP_011000095.1|45268_45727_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830889.1|45868_46477_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011000097.1|46490_47627_-	HPP family protein	NA	NA	NA	NA	NA
WP_020830890.1|47880_49854_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_043897884.1|49874_50756_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830892.1|51064_51358_+	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_011000101.1|51430_52621_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.9	1.7e-121
WP_016726803.1|52861_53710_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_016726804.1|53727_54621_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_043885954.1|54699_55578_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011000105.1|55632_56460_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_016722549.1|56579_57260_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011000107.1|57291_58077_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_086004752.1|58492_59294_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_020829879.1|59429_60431_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011000146.1|61868_62324_+	universal stress protein	NA	NA	NA	NA	NA
WP_011000145.1|63158_64997_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	46.3	2.1e-150
WP_016722521.1|65110_66478_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.7	1.8e-34
WP_173361999.1|66649_67633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000142.1|67717_68656_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	70.1	1.5e-101
>prophage 2
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	302083	389246	3702722	head,transposase,terminase,portal,capsid,tail	Acidithiobacillus_phage(47.5%)	75	NA	NA
WP_064047877.1|302083_303472_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	81.4	8.1e-216
WP_016722453.1|303468_303918_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	8.8e-55
WP_173940729.1|304220_305399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173940730.1|305558_307796_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.2	9.7e-288
WP_064047874.1|307845_308307_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	64.1	6.9e-47
WP_089190378.1|308535_308799_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
WP_016725622.1|308809_309292_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.8	1.0e-45
WP_139233340.1|309288_309840_+	HNH endonuclease	NA	A0A172JFU7	Citrobacter_phage	39.2	2.2e-23
WP_011003123.1|309811_310717_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.2	2.4e-104
WP_016725624.1|310713_311361_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.6	7.9e-81
WP_038937632.1|311368_311881_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	66.9	4.6e-52
WP_016725626.1|311880_312429_+	HNH endonuclease	NA	A0A1B0TRC1	Escherichia_phage	39.3	3.1e-22
WP_011003119.1|312415_313174_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	62.1	1.3e-82
WP_016725627.1|313170_313431_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	8.4e-18
WP_173940731.1|313427_315716_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.6	1.1e-286
WP_118940519.1|315846_316311_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	66.9	1.7e-53
WP_011003115.1|316312_316522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021154679.1|316514_316898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|316952_317219_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_118940520.1|317218_317518_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064047870.1|318167_319568_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	8.5e-165
WP_020833017.1|319564_320785_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.5	1.4e-192
WP_020371857.1|320827_321193_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	8.5e-32
WP_016726852.1|321417_321606_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_020833014.1|321727_322243_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	68.7	2.3e-22
WP_107523986.1|322348_322687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833012.1|322706_323243_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	81.5	5.5e-72
WP_020833011.1|323242_325225_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.1	0.0e+00
WP_016727881.1|325268_325778_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	2.8e-25
WP_020833053.1|325788_326181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|326181_326403_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_058908381.1|326402_327950_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_058908382.1|327959_329210_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.1	1.0e-60
WP_071508058.1|329219_329597_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.8	2.3e-24
WP_021154689.1|329603_330608_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.2	2.5e-110
WP_021154690.1|330610_330913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727774.1|330918_331365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|331491_332265_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_016723647.1|332273_332669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938671.1|332665_332887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832998.1|332861_333506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723655.1|333548_333839_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_020832996.1|334024_335491_-	type III secretion system YopJ family effector PopP2	NA	NA	NA	NA	NA
WP_071895622.1|336100_337228_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.6	9.1e-101
WP_173940732.1|337293_341397_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	27.8	3.5e-25
WP_020832994.1|341402_341798_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	1.6e-31
WP_173940733.1|341798_345389_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.2	0.0e+00
WP_173940734.1|345400_346567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940735.1|346570_347053_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	32.4	9.8e-12
WP_173940736.1|347049_347448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940737.1|347452_349297_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.4	1.3e-107
WP_058907698.1|349306_349531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003270772.1|349598_349889_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_020832987.1|349885_350362_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_058907697.1|350358_350820_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.0	4.3e-65
WP_020832985.1|350887_351187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885536.1|351249_351588_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_143012824.1|361039_361759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075463064.1|362520_365061_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.2	7.5e-18
WP_075463066.1|365072_366824_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071893100.1|366836_367682_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016726423.1|368182_368971_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_043897847.1|369719_370220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043876768.1|371735_372536_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011003055.1|372714_373293_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_020832973.1|373289_374192_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081049985.1|374204_375368_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_043897846.1|375364_377467_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_043897845.1|377629_380668_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016724436.1|380832_381528_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043897844.1|381593_383525_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_020832966.1|383851_384982_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020832965.1|385023_386304_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011003046.1|386589_387426_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831502.1|387917_389246_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	921012	963392	3702722	transposase,coat,tRNA	uncultured_Mediterranean_phage(42.86%)	42	NA	NA
WP_011002630.1|921012_922125_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_028853617.1|922213_923812_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016723723.1|923837_924446_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011002627.1|924679_926053_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.0	3.8e-109
WP_020832660.1|926299_926884_+	cytochrome b	NA	NA	NA	NA	NA
WP_016723720.1|926984_927551_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_019718267.1|927608_928205_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_016725726.1|928338_929667_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_016723719.1|929726_930695_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	8.8e-44
WP_011002622.1|930772_932653_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_063612207.1|932774_933107_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.0e-12
WP_016723717.1|933215_934367_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	9.4e-77
WP_020832657.1|934360_935449_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_020832656.1|935525_937718_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016723714.1|937736_937940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002617.1|937951_938392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081263796.1|938615_938795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832653.1|938938_940069_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_043897937.1|940211_941153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020832651.1|941343_942567_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_020832650.1|942611_943898_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_020832649.1|944263_944725_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020832648.1|944935_946132_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016721870.1|946602_947589_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_043897800.1|948694_949237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172833515.1|949306_949795_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_020832638.1|949812_952077_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_020832639.1|952126_952846_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011002604.1|952964_953468_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002605.1|953517_954021_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723696.1|955366_955627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853597.1|955643_956504_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_011002607.1|956600_956897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|957047_957365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832642.1|957483_957621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832643.1|958704_958989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002610.1|959082_959409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081263795.1|959851_960016_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	3.2e-07
WP_028853600.1|960785_961040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940760.1|961571_961781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723702.1|961831_962149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|962405_963392_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
>prophage 4
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	1033758	1043897	3702722		Hokovirus(14.29%)	9	NA	NA
WP_021155204.1|1033758_1035720_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_011002544.1|1035854_1036997_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_020832589.1|1037032_1038913_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	2.7e-57
WP_011002542.1|1038868_1039555_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_016724068.1|1039562_1040270_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016724069.1|1040281_1041106_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
WP_016724070.1|1041162_1041807_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.3	8.3e-06
WP_003271964.1|1041840_1042350_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_021155205.1|1042349_1043897_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 5
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	1134067	1143351	3702722	protease	Phage_21(16.67%)	9	NA	NA
WP_016725925.1|1134067_1135318_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	7.4e-11
WP_016724132.1|1135544_1135757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002384.1|1135945_1136566_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_011002383.1|1137215_1137419_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.8	1.7e-21
WP_011002382.1|1137972_1138299_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	37.4	7.9e-13
WP_011002381.1|1138295_1140584_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	7.1e-169
WP_011002380.1|1140653_1141100_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.7	5.1e-47
WP_020832525.1|1141096_1142149_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020832524.1|1142145_1143351_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	3.4e-37
>prophage 6
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	1708946	1716085	3702722	transposase,integrase	Synechococcus_phage(16.67%)	8	1710816:1710835	1725612:1725631
WP_020832213.1|1708946_1709813_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.4	2.0e-10
WP_016727001.1|1709830_1710559_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.9	2.8e-34
1710816:1710835	attL	TGGGGGTATTTTTGGGGGTA	NA	NA	NA	NA
WP_173940768.1|1710867_1712085_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	53.8	1.2e-119
WP_016721735.1|1712298_1713264_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|1713260_1713410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940769.1|1713724_1713919_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	48.0	2.9e-07
WP_173940770.1|1713918_1714293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940771.1|1714279_1716085_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	3.5e-70
1725612:1725631	attR	TGGGGGTATTTTTGGGGGTA	NA	NA	NA	NA
>prophage 7
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	1789105	1816191	3702722	transposase,integrase	Leptospira_phage(33.33%)	24	1801319:1801366	1816470:1816517
WP_020830182.1|1789105_1789930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_173940775.1|1790010_1790979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832175.1|1790975_1791980_+	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_064047844.1|1793237_1794296_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081282089.1|1794974_1796066_+	DUF262 domain-containing protein	NA	A0A1V0SDN5	Indivirus	30.4	2.0e-07
WP_052328807.1|1796068_1796575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043897749.1|1796883_1797117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832173.1|1797394_1798951_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.6	7.0e-75
WP_020829705.1|1798983_1799337_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	1.2e-19
WP_043885814.1|1799333_1799816_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_144061896.1|1799853_1800750_-	hypothetical protein	NA	NA	NA	NA	NA
1801319:1801366	attL	TTGGCCTGCCCAGAGGGATTCGAACCCCCGACCGTCGGCTTAGAAGGC	NA	NA	NA	NA
WP_020832172.1|1801478_1802498_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	36.0	2.7e-51
WP_144061895.1|1802531_1803578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043897746.1|1803990_1804452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043897652.1|1804689_1805895_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_173940776.1|1806265_1807126_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_043897745.1|1807240_1807849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052328806.1|1807941_1808598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043897744.1|1809377_1809956_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	42.6	3.4e-27
WP_043897743.1|1810666_1811473_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_043897741.1|1811571_1811877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144061894.1|1811905_1812586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144061893.1|1812621_1814925_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_043897920.1|1815135_1816191_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	56.9	3.8e-101
1816470:1816517	attR	TTGGCCTGCCCAGAGGGATTCGAACCCCCGACCGTCGGCTTAGAAGGC	NA	NA	NA	NA
>prophage 8
NZ_CP052076	Ralstonia solanacearum strain FJAT445.F50 chromosome, complete genome	3702722	2766948	2827637	3702722	transposase	Acidithiobacillus_phage(26.32%)	47	NA	NA
WP_020831502.1|2766948_2768277_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011000869.1|2768411_2769314_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|2769417_2769735_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_020831501.1|2769864_2770860_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	7.0e-28
WP_019717811.1|2770856_2771804_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2771830_2773204_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
WP_011000864.1|2773263_2774541_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_043897668.1|2774544_2774874_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_016723345.1|2775059_2775482_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_011000861.1|2775518_2777207_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_011000860.1|2777346_2778039_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_020831497.1|2778062_2779373_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_029240256.1|2779394_2780291_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_016723348.1|2780387_2781512_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	27.7	1.2e-15
WP_011000856.1|2781570_2782686_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_064047660.1|2782774_2783911_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.6	4.4e-87
WP_016723349.1|2784025_2784586_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_064047659.1|2784712_2787370_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.0e-102
WP_011000852.1|2787778_2788435_+	OmpA family protein	NA	NA	NA	NA	NA
WP_020831496.1|2788592_2789084_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019717804.1|2789245_2789962_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011000849.1|2789958_2790648_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_020831495.1|2790756_2794542_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_058908849.1|2795444_2796344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|2797527_2798514_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016721735.1|2798670_2799636_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|2799632_2799782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081282099.1|2800535_2800976_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_064820716.1|2801008_2802391_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.9	1.5e-134
WP_038938302.1|2802387_2802885_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	9.2e-21
WP_071895564.1|2802885_2803125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069078908.1|2804941_2806708_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_118872359.1|2806786_2807605_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_016725636.1|2818677_2819628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079307.1|2820082_2820421_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_064048075.1|2820483_2820783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003080.1|2820850_2821312_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	1.1e-65
WP_071895569.1|2821308_2821791_-	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	48.3	4.7e-22
WP_011003082.1|2821777_2822260_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.6	4.8e-59
WP_064047856.1|2822256_2822547_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	47.6	7.0e-13
WP_011003084.1|2822613_2822838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830964.1|2823072_2824092_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	2.1e-43
WP_155738951.1|2824117_2824267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|2824263_2825229_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738996.1|2825427_2826060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003086.1|2826218_2826755_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
WP_173940790.1|2826812_2827637_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP052077	Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence	1981426	538950	605045	1981426	transposase	uncultured_Caudovirales_phage(16.67%)	49	NA	NA
WP_019719041.1|538950_539970_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020829739.1|540214_540385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173940845.1|540393_543132_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.4	7.7e-85
WP_144061944.1|543134_543458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019719248.1|543573_544617_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	8.4e-16
WP_020829737.1|544890_546219_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_020829735.1|546384_548169_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.6	3.8e-85
WP_173959071.1|548179_550045_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011003826.1|550179_550845_+	response regulator	NA	NA	NA	NA	NA
WP_011003827.1|550841_552320_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	3.3e-18
WP_016724461.1|552449_553061_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003829.1|553163_553595_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016724459.1|553765_554275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043898037.1|554383_555739_+	TolC family protein	NA	NA	NA	NA	NA
WP_016724457.1|556948_560098_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.9	1.8e-66
WP_011003834.1|560094_560418_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_020829729.1|560509_562756_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	2.6e-54
WP_020829727.1|563417_563858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898035.1|564361_565141_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_020829725.1|565293_566205_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	47.3	5.3e-75
WP_028854170.1|566369_567692_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	50.0	4.6e-104
WP_086004752.1|567905_568707_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_043898033.1|568890_569292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003842.1|569556_570699_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173940846.1|570879_581538_+	hemagglutinin repeat-containing protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	36.8	4.1e-09
WP_081263828.1|581537_582038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043898032.1|582068_582569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081263829.1|582572_582992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940847.1|583729_584101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100243798.1|584320_584506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144061942.1|584502_585024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047948.1|585066_586836_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_052328822.1|587508_588876_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016725378.1|589168_590296_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_011003854.1|590397_590670_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011003855.1|590802_591774_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_011003856.1|591792_592998_+	chromate transporter	NA	NA	NA	NA	NA
WP_016725380.1|593051_593558_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_173877492.1|593775_594000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003864.1|595174_595732_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_020371953.1|595721_596765_-	transporter	NA	NA	NA	NA	NA
WP_038938585.1|596855_597233_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_086004752.1|597623_598425_+|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_019719041.1|598798_599818_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043898030.1|601040_601481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064820709.1|601824_602139_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020831836.1|602187_603315_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081263830.1|603335_603908_-	mannose-binding lectin protein	NA	NA	NA	NA	NA
WP_016721870.1|604058_605045_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
>prophage 2
NZ_CP052077	Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence	1981426	807732	829093	1981426	transposase,plate	Vibrio_phage(33.33%)	15	NA	NA
WP_019719429.1|807732_809079_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_043898101.1|809122_809797_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011004040.1|810071_810719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724835.1|810755_811268_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011004042.1|811260_812751_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011004043.1|812839_813343_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_016724834.1|813403_813877_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016726997.1|813939_815790_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_020371627.1|815753_816845_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020830186.1|816877_819595_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_020830185.1|819615_822372_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.6	2.1e-37
WP_043898209.1|822389_823523_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_020830182.1|825807_826632_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_144061949.1|826694_827144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173940856.1|828290_829093_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.2	3.1e-26
>prophage 3
NZ_CP052077	Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence	1981426	1022148	1056069	1981426	integrase,transposase	Salmonella_phage(20.0%)	24	1014275:1014291	1047602:1047618
1014275:1014291	attL	GCATCGCGGTCCGGCGC	NA	NA	NA	NA
WP_086706442.1|1022148_1023858_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058908723.1|1023863_1026848_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.5	2.8e-80
WP_165591970.1|1026908_1029131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633711.1|1029361_1029547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719551.1|1029545_1031246_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	25.2	2.6e-06
WP_029240537.1|1031465_1031960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719553.1|1032065_1034009_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_020425328.1|1034028_1034820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898203.1|1034882_1035896_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011004204.1|1036304_1036688_-	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
WP_080511113.1|1036791_1037706_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_016723110.1|1037782_1038451_-	DsbA family protein	NA	NA	NA	NA	NA
WP_011004207.1|1038553_1039483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830058.1|1039622_1040816_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011004209.1|1040897_1041839_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_016727628.1|1042135_1043242_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_043898082.1|1045618_1046188_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723104.1|1046239_1046902_+	membrane protein	NA	NA	NA	NA	NA
WP_043885814.1|1047373_1047856_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1047602:1047618	attR	GCGCCGGACCGCGATGC	NA	NA	NA	NA
WP_020829705.1|1047852_1048206_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_020832173.1|1048238_1049795_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.6	7.0e-75
WP_043898081.1|1050625_1051585_-	type III effector protein	NA	NA	NA	NA	NA
WP_086004752.1|1054204_1055007_-|transposase	IS5-like element IS1421 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	3.6e-27
WP_020829649.1|1055052_1056069_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	2.1e-43
>prophage 4
NZ_CP052077	Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence	1981426	1767188	1837615	1981426	protease,coat,transposase	Bacillus_phage(27.27%)	52	NA	NA
WP_011004747.1|1767188_1767710_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723579.1|1768212_1768797_-	SCO family protein	NA	NA	NA	NA	NA
WP_020830504.1|1768793_1769585_-	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_020830505.1|1769604_1771098_-	nitrite reductase, copper-containing	NA	NA	NA	NA	NA
WP_011004751.1|1771375_1771678_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_011004752.1|1771721_1773992_+	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_016723583.1|1774250_1774973_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004754.1|1775031_1775817_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	3.0e-34
WP_011004755.1|1775806_1776703_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020830507.1|1776750_1777791_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011004757.1|1777824_1778223_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_019719870.1|1778721_1780125_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.6	2.3e-21
WP_011004758.1|1780310_1780529_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_020830508.1|1780636_1781335_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011004760.1|1781416_1781854_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_020830509.1|1781967_1782852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004762.1|1782928_1783321_-	RidA family protein	NA	NA	NA	NA	NA
WP_020830510.1|1783317_1784289_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_020830511.1|1784285_1784930_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020371801.1|1786063_1787974_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_020830514.1|1789058_1790762_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	4.9e-13
WP_064048019.1|1790770_1791469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155598.1|1791583_1793407_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_064048021.1|1793403_1796055_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_014632055.1|1796387_1796576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043898155.1|1796921_1798439_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_043898156.1|1798638_1800348_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_019719859.1|1800922_1802248_+	DUF3500 domain-containing protein	NA	A0A0H3UCT5	Escherichia_phage	51.3	7.4e-09
WP_020830519.1|1802273_1803524_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_020830520.1|1803686_1804184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020830521.1|1804557_1805595_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_043885670.1|1805709_1807857_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_016725441.1|1808471_1808939_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_016725440.1|1808938_1809325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064048022.1|1809564_1810404_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_064048023.1|1810421_1812173_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_173940869.1|1812184_1814725_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.0	4.6e-15
WP_016721870.1|1815233_1816220_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_038937983.1|1816514_1817087_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_071653919.1|1817119_1817596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725060.1|1826247_1826463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011004794.1|1826689_1827202_+	DUF1993 family protein	NA	NA	NA	NA	NA
WP_011004795.1|1827359_1827689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725058.1|1827852_1828374_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011004797.1|1828470_1828833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725057.1|1829022_1830495_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	1.6e-25
WP_019719841.1|1830657_1831974_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	3.6e-16
WP_016725055.1|1831980_1832712_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	1.3e-28
WP_043898158.1|1832850_1835031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155738951.1|1835286_1835436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|1835432_1836398_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_086005097.1|1836464_1837615_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
