The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	1830278	1839720	5056572		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|1830278_1831205_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_022645871.1|1831209_1831941_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1831921_1832029_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1832088_1832820_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1833041_1834727_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|1834723_1835443_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1835489_1835960_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1836000_1836462_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_022645869.1|1836586_1838587_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001329822.1|1838583_1839720_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 2
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	2440158	2532545	5056572	tail,terminase,holin,lysis,protease,portal	Enterobacteria_phage(37.25%)	99	NA	NA
WP_022645727.1|2440158_2442585_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2442783_2443089_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2443196_2443907_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2443909_2444470_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2444504_2444846_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|2444980_2445307_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001295394.1|2445512_2446727_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2446738_2447758_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2447815_2447944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2447945_2449226_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_000005552.1|2449260_2449512_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_024946566.1|2449584_2452056_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|2452148_2452340_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2452336_2452525_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|2453027_2453228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241299.1|2453196_2453574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2453573_2453726_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2453918_2454326_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2454403_2454631_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2454614_2455136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|2455116_2456082_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|2456122_2456524_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|2456723_2457746_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001546200.1|2458608_2458716_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|2458760_2458973_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2459189_2459441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|2459507_2459786_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001376415.1|2459787_2460837_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_000904111.1|2460849_2461206_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|2461220_2462042_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|2462937_2463069_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_022645723.1|2463435_2463864_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2464035_2464410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|2464661_2464877_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000196128.1|2464881_2465193_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_001092966.1|2465189_2465723_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2465719_2466217_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2466580_2466793_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2466803_2466992_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2467139_2467295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2467467_2467641_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2467936_2468143_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_022645722.1|2468695_2469190_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934104.1|2469189_2471292_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|2471288_2471501_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|2471500_2473009_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_173860287.1|2472953_2474981_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|2475067_2475391_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2475383_2475659_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677120.1|2475670_2476261_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|2476257_2476659_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_022645720.1|2476669_2477413_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|2477473_2477860_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_063815218.1|2477868_2478186_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_022645718.1|2478169_2481235_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447253.1|2481234_2481564_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_021531318.1|2481573_2482272_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.5e-133
WP_089602183.1|2482276_2483020_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.0e-149
WP_001531692.1|2482917_2483565_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	7.8e-113
WP_129666805.1|2483625_2487105_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
WP_173860288.1|2487163_2489509_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.0	2.1e-91
WP_000654156.1|2489505_2489787_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_129666810.1|2489796_2490498_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
WP_033868794.1|2490511_2490799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|2491470_2492136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097437676.1|2492135_2492534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129666813.1|2492526_2493372_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	1.1e-34
WP_001019920.1|2494762_2495377_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|2495626_2495956_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001361803.1|2496268_2496979_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_022645232.1|2496947_2498591_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_022645233.1|2498580_2501106_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716409.1|2501131_2501800_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730982.1|2501857_2502445_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_129666844.1|2502519_2503062_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000866436.1|2504145_2504286_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|2504285_2504549_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|2504913_2505015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182338.1|2505488_2506631_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860025.1|2506875_2507796_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001328123.1|2507952_2508879_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012311907.1|2509078_2509972_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172285.1|2510002_2510992_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174452.1|2511018_2511870_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_022645237.1|2512435_2516689_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_022645238.1|2516809_2517667_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022645239.1|2517914_2518784_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_129666816.1|2518940_2519537_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474002.1|2519548_2519785_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_022645240.1|2519893_2521219_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	2.3e-111
WP_001361807.1|2521445_2522300_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_022645241.1|2522825_2523545_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023918.1|2523555_2524983_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_022645242.1|2524975_2525671_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_022645243.1|2525913_2526414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645244.1|2526607_2528296_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.2e-59
WP_022645245.1|2528309_2529782_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022645246.1|2529795_2530383_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|2530511_2532545_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 3
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	3086232	3160317	5056572	tail,head,terminase,integrase,lysis,plate,capsid,protease,portal	Salmonella_phage(68.0%)	80	3086132:3086158	3120511:3120537
3086132:3086158	attL	ATAAATTTCAGGCAACAAAAAACCCAC	NA	NA	NA	NA
WP_001595551.1|3086232_3087285_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
WP_022645415.1|3087367_3089044_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_022645416.1|3089064_3089661_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_000188448.1|3089756_3089978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645417.1|3090010_3090520_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|3090527_3090728_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|3090691_3091033_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|3091100_3091334_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001399246.1|3091333_3091561_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_000104157.1|3091557_3092415_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_022645418.1|3092411_3094826_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_001154434.1|3094979_3095168_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|3095178_3095412_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_022645419.1|3095586_3096645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645420.1|3097178_3098960_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645421.1|3098996_3100031_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645422.1|3100030_3101797_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645423.1|3101939_3102773_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742503.1|3102789_3103848_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_021534472.1|3103851_3104502_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000673523.1|3104597_3105062_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|3105061_3105265_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3105268_3105484_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_022645424.1|3105464_3105977_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.0e-87
WP_022645425.1|3105978_3106356_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_022645426.1|3106352_3106781_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_001595569.1|3106876_3107308_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_021522006.1|3107300_3107747_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_022645427.1|3107688_3108495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993764.1|3108598_3109177_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177597.1|3109173_3109533_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_022645428.1|3109519_3110428_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_022645429.1|3110420_3111026_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_022645430.1|3111022_3112564_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
WP_022645431.1|3112563_3113166_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_000046146.1|3113299_3114472_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|3114481_3114997_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_022645432.1|3115051_3115354_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_000763311.1|3115368_3115488_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645433.1|3115480_3118558_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_022645434.1|3118554_3119040_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645435.1|3119036_3120137_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_000972391.1|3120227_3120446_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|3120681_3122367_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3120511:3120537	attR	ATAAATTTCAGGCAACAAAAAACCCAC	NA	NA	NA	NA
WP_000681108.1|3122636_3123014_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|3123043_3123301_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_022645436.1|3123460_3123748_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_022645437.1|3123731_3124454_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3124514_3125417_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3125504_3125981_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|3126331_3127444_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|3127538_3128672_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105436.1|3128681_3129635_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|3129631_3130477_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3130536_3131025_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149713.1|3131065_3132193_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|3132221_3132953_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464489.1|3133178_3133847_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001702.1|3133846_3134563_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|3134569_3135301_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|3135318_3136047_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270657.1|3136264_3136780_-	lipoprotein	NA	NA	NA	NA	NA
WP_022645438.1|3137427_3139197_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001160731.1|3139407_3139731_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|3139727_3140558_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|3140554_3141568_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022645439.1|3141666_3143097_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023908799.1|3143107_3144109_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_173860291.1|3144145_3145864_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.4e-31
WP_000178691.1|3145996_3146965_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_022645440.1|3146976_3148629_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_022645441.1|3148771_3149671_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|3150128_3150824_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|3151249_3152908_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001400542.1|3152904_3153861_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|3154011_3155127_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_022645444.1|3155123_3157070_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000410785.1|3157142_3157367_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3157689_3158010_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3158040_3160317_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 4
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	3548859	3634908	5056572	transposase,tail,head,terminase,holin,integrase,lysis,capsid,protease,portal	Enterobacteria_phage(33.93%)	95	3568154:3568181	3617537:3617564
WP_000483766.1|3548859_3550206_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000301651.1|3550260_3552936_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_022645592.1|3553412_3554060_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001211525.1|3554217_3554514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182039.1|3554797_3556429_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911112.1|3556514_3557435_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|3557449_3558358_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110931.1|3558369_3559383_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|3559379_3560384_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000366959.1|3560436_3560766_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|3560800_3562261_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|3562403_3562577_+	YciY family protein	NA	NA	NA	NA	NA
WP_000020078.1|3562631_3563885_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|3564185_3564482_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|3564705_3565422_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|3565461_3565860_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|3565964_3566504_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|3566533_3567277_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|3567633_3568272_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
3568154:3568181	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113696.1|3568317_3569448_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.7	2.0e-103
WP_000113189.1|3569425_3569674_-	excisionase	NA	NA	NA	NA	NA
WP_023909115.1|3569738_3572210_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_001090200.1|3572302_3572494_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|3572490_3572679_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122991287.1|3573079_3573226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016237926.1|3573211_3573586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001725971.1|3573597_3573750_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_000948454.1|3574068_3574545_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|3574669_3574993_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693906.1|3574976_3575402_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095673.1|3575424_3576387_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_001468623.1|3576427_3576850_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000403785.1|3576907_3577264_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|3577357_3577540_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|3577532_3577709_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_089541817.1|3577984_3579213_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000967408.1|3579910_3580123_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_032151993.1|3580289_3580568_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_023909113.1|3580569_3581619_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_000904174.1|3581631_3581991_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_023909112.1|3581987_3582677_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	1.8e-54
WP_000917767.1|3582890_3583088_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935536.1|3583238_3584288_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|3585089_3585221_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|3585501_3585837_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023909002.1|3586097_3587951_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	89.2	0.0e+00
WP_000284510.1|3588100_3588316_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_023909003.1|3588320_3588635_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	3.1e-51
WP_023909004.1|3588690_3589224_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	2.5e-101
WP_024946561.1|3589220_3589679_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	92.8	7.5e-70
WP_000654790.1|3590095_3590716_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
WP_023909270.1|3590657_3591725_-	beta family protein	NA	NA	NA	NA	NA
WP_000867575.1|3592135_3592684_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|3592655_3594584_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|3594567_3594774_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|3594770_3596363_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_023909006.1|3596352_3597858_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	3.6e-100
WP_000256835.1|3597894_3598242_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522601.1|3598299_3599328_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000201501.1|3599379_3599763_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204553.1|3599755_3600109_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_001575631.1|3600123_3600699_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_000683079.1|3600695_3601091_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|3601098_3601851_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|3601864_3602296_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|3602322_3602736_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_023909007.1|3602716_3605290_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000847298.1|3605286_3605616_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|3605615_3606314_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194723.1|3606324_3607068_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122997661.1|3607013_3607646_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.3	1.5e-100
WP_023909008.1|3607989_3611463_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001228314.1|3611530_3612130_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_023909009.1|3612281_3615308_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885578.1|3615307_3615892_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
WP_000240999.1|3615946_3616615_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937483.1|3616671_3616941_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|3617055_3617226_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001056491.1|3618265_3618766_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3617537:3617564	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000807651.1|3618851_3619031_-	general stress protein	NA	NA	NA	NA	NA
WP_022645611.1|3619421_3620228_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_022645612.1|3620227_3621421_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|3621432_3622791_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763524.1|3622794_3624390_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_022645613.1|3624389_3625952_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3626043_3626088_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|3626225_3627107_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3627103_3627724_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_022645614.1|3627751_3629641_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|3629851_3630727_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_022645615.1|3630896_3631919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|3631928_3632237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278893.1|3632293_3632884_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|3632880_3633639_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422059.1|3633858_3634908_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	3852269	3939671	5056572	tail,transposase,terminase,integrase,lysis,protease,portal	Enterobacteria_phage(38.33%)	88	3913161:3913176	3939876:3939891
WP_088895425.1|3852269_3853498_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_022645702.1|3859993_3861586_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|3861664_3862618_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194902.1|3862866_3864402_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
WP_022645703.1|3864395_3865424_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222725.1|3865423_3866416_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172485.1|3866427_3867450_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_022645704.1|3867476_3868352_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558525.1|3868375_3868666_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_022645705.1|3868722_3869481_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_022645706.1|3869484_3870399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645707.1|3870595_3872047_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_022645708.1|3872274_3873693_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_022645709.1|3873831_3874191_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_129666673.1|3874190_3875117_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156623.1|3875180_3876569_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366505.1|3876669_3877551_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645710.1|3877628_3878744_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|3878893_3880084_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|3880108_3880774_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_022645711.1|3880985_3881420_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|3881440_3881824_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803527.1|3881855_3882074_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087204.1|3882104_3883004_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_022645712.1|3883198_3884386_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|3884512_3884608_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592819.1|3884826_3885717_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
WP_022645713.1|3885971_3886364_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_022645714.1|3886729_3888775_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|3888911_3889658_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022645715.1|3889746_3890433_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|3890609_3890813_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527788.1|3890848_3892309_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
WP_120795384.1|3894286_3894400_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3894468_3894702_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|3895018_3895609_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001546828.1|3895836_3896130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546829.1|3896172_3897213_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546830.1|3897223_3897502_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546831.1|3897498_3899871_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001228249.1|3899935_3900535_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_022645716.1|3900602_3904082_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023277304.1|3904142_3904790_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_173860293.1|3904687_3905431_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.9e-151
WP_086525106.1|3905436_3906135_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.1e-134
WP_000447253.1|3906144_3906474_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001763914.1|3906473_3909530_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.5	0.0e+00
WP_001161009.1|3909501_3909831_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001370402.1|3909839_3910226_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001401822.1|3910286_3911030_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.8	1.9e-131
WP_001401823.1|3911040_3911442_-|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	99.2	7.0e-72
WP_000677112.1|3911438_3912017_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001283153.1|3912028_3912304_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3912296_3912620_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_129666802.1|3912706_3914734_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.1	0.0e+00
3913161:3913176	attL	GCTTTATCGAACAGAC	NA	NA	NA	NA
WP_000985939.1|3914678_3916187_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_001072973.1|3916186_3916399_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_129666799.1|3916395_3918498_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.3	0.0e+00
WP_000373425.1|3918497_3918992_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001139675.1|3919667_3919820_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|3919807_3920275_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|3920271_3920769_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|3920768_3920984_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799705.1|3921051_3922104_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	6.1e-208
WP_000917723.1|3922254_3922458_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_001033965.1|3922728_3923175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|3923259_3923625_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_001577384.1|3923642_3924632_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001061386.1|3924639_3925437_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_000767115.1|3925456_3925846_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210170.1|3925842_3926169_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|3926165_3926819_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_011478357.1|3926818_3927313_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	2.6e-84
WP_000061519.1|3927309_3928128_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000620696.1|3928124_3928349_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087313.1|3928345_3929497_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000526665.1|3929493_3930045_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001191669.1|3930037_3930298_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|3930395_3931088_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135680.1|3931790_3932153_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|3932218_3933043_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_052978458.1|3933170_3933707_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	2.2e-100
WP_001242749.1|3933697_3934060_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3934059_3934365_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_000051893.1|3934591_3935755_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_022645230.1|3935959_3937213_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
WP_022645229.1|3937224_3938328_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
WP_022645228.1|3938615_3939671_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
3939876:3939891	attR	GCTTTATCGAACAGAC	NA	NA	NA	NA
>prophage 6
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	4578902	4620921	5056572	tail,tRNA,head,terminase,holin,integrase,lysis,capsid,protease,portal	Escherichia_phage(34.0%)	56	4579464:4579479	4600717:4600732
WP_000918363.1|4578902_4580318_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
4579464:4579479	attL	ACGGATTTTAGTCTGG	NA	NA	NA	NA
WP_022646433.1|4580400_4581384_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891408.1|4581549_4581792_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543825.1|4581925_4582963_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332260.1|4583051_4584149_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
WP_001217539.1|4584210_4584459_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_022646432.1|4584569_4584857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595444.1|4584867_4585572_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_022646431.1|4585581_4585863_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_022646430.1|4585859_4588208_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
WP_001228252.1|4588272_4588872_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_024946503.1|4588939_4592419_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_000741576.1|4592479_4593127_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_032152077.1|4593024_4593768_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_021543563.1|4593772_4594471_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.8e-131
WP_023908869.1|4594470_4594812_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	66.4	7.9e-40
WP_024946502.1|4594804_4598047_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	88.8	0.0e+00
WP_021543566.1|4598092_4598434_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	64.5	7.6e-35
WP_021543567.1|4598492_4598771_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	80.4	1.5e-33
WP_021543568.1|4598794_4599166_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	90.2	3.1e-58
WP_023908871.1|4599180_4599885_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	90.6	1.8e-110
WP_021543570.1|4599944_4600289_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	94.7	1.9e-54
WP_021543571.1|4600285_4600735_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	1.3e-61
4600717:4600732	attR	CCAGACTAAAATCCGT	NA	NA	NA	NA
WP_021543572.1|4600731_4601070_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
WP_021543573.1|4601079_4601385_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
WP_023908872.1|4601396_4601585_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	93.5	8.8e-25
WP_023908873.1|4601634_4602840_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	1.7e-222
WP_001193633.1|4602854_4603505_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_023908874.1|4603482_4604724_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.9e-241
WP_000605605.1|4604723_4604906_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_065312442.1|4604917_4606414_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929184.1|4606647_4607142_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_024946501.1|4607268_4607619_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
WP_000699783.1|4607684_4607888_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
WP_021543580.1|4608005_4608380_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
WP_023908876.1|4608418_4608862_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	2.3e-71
WP_021543581.1|4608858_4609335_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
WP_024946499.1|4609338_4609674_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
WP_001181554.1|4609803_4610007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908878.1|4610199_4610952_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	4.2e-134
WP_024946498.1|4610965_4611955_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_023908880.1|4611962_4612772_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	8.2e-152
WP_000767133.1|4612791_4613181_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210154.1|4613177_4613504_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001401088.1|4613500_4614154_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_023908881.1|4614153_4614642_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.6e-80
WP_023908882.1|4614638_4615580_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.3	3.2e-139
WP_071789194.1|4615569_4615749_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_024946496.1|4615924_4616482_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_021527487.1|4616525_4616726_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.3e-31
WP_021530636.1|4616816_4617491_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	100.0	3.5e-132
WP_000135680.1|4618158_4618521_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023908886.1|4618586_4619411_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_024946495.1|4619629_4620382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093916.1|4620418_4620700_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_023908888.1|4620747_4620921_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.7	1.4e-21
>prophage 7
NZ_CP046396	Escherichia coli strain ampC_0069 chromosome, complete genome	5056572	4650075	4666596	5056572	plate,tail	Burkholderia_phage(33.33%)	22	NA	NA
WP_000619864.1|4650075_4650423_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|4650960_4651248_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|4651250_4651856_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4651868_4652183_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|4652327_4652783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4652779_4652977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|4652966_4654391_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|4654390_4654915_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|4654965_4655283_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4655242_4655371_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646414.1|4655472_4657848_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_022646413.1|4657847_4658801_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4658800_4659010_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|4658997_4660038_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_000679403.1|4660047_4660749_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|4660847_4661207_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|4661197_4662313_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646409.1|4662305_4663022_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|4663024_4664635_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646407.1|4664631_4665339_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646406.1|4665335_4665791_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|4665804_4666596_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
