The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	334484	395736	5977292	protease,holin,bacteriocin	Bacillus_phage(25.0%)	57	NA	NA
WP_169774668.1|334484_334934_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_013970457.1|335076_335478_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_015268603.1|335672_336467_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_015268604.1|336589_337489_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_015268605.1|337668_339210_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	46.9	1.5e-125
WP_015268606.1|339386_339827_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015268607.1|339882_340365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268608.1|340682_343028_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_015268609.1|343033_343864_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_054573391.1|344049_344490_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_054573392.1|344602_345265_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_015268611.1|345329_345896_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_054573393.1|345892_346711_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_015268613.1|346924_347380_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015268614.1|347379_348786_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	28.7	3.9e-08
WP_054573394.1|348782_350597_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015268616.1|350639_351185_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.5	9.3e-51
WP_054573395.1|351464_352571_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.8	6.6e-104
WP_054573662.1|353087_355166_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_015268619.1|355668_356988_+	OprD family porin	NA	NA	NA	NA	NA
WP_054573663.1|357105_358773_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_054573712.1|359013_360381_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_054573664.1|360382_361102_-	response regulator	NA	W8CYM9	Bacillus_phage	34.1	3.2e-30
WP_054573665.1|361242_363540_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_015268624.1|363821_364028_-	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_015268625.1|364354_364603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015268626.1|365165_365441_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_054573666.1|365792_366998_-	methyltransferase	NA	NA	NA	NA	NA
WP_015268628.1|367126_367816_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013970485.1|367815_368508_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015268630.1|368562_369318_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003257472.1|369329_370103_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	8.4e-21
WP_013970487.1|370767_372153_+	GABA permease	NA	NA	NA	NA	NA
WP_013970488.1|372333_372777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161551498.1|372834_373707_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_054573667.1|374058_374361_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	50.0	1.3e-14
WP_003257478.1|374665_374938_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_015268633.1|374934_376002_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_054573668.1|375998_378245_-	AsmA family protein	NA	NA	NA	NA	NA
WP_054573669.1|378550_380212_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003255736.1|380495_381089_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_013970493.1|381089_381728_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003257483.1|381728_381989_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_015268636.1|382016_382754_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_013970495.1|382764_383535_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003257485.1|383655_384834_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.2	1.9e-24
WP_169774667.1|384830_385679_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_015268637.1|385760_386708_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_015268638.1|387161_388538_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_015268639.1|388995_390102_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003257487.1|390220_390478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054573671.1|390845_391322_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_139657352.1|391332_392298_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_015268642.1|392316_393201_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_015268643.1|393326_394271_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_015268644.1|394418_395363_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015268645.1|395484_395736_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	788533	828555	5977292	integrase,transposase	Enterobacteria_phage(22.22%)	41	809130:809144	830326:830340
WP_099593723.1|788533_789718_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.1	3.2e-120
WP_157765891.1|789747_790497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099593719.1|790612_790816_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_099593717.1|790818_791730_+	TrfA protein	NA	NA	NA	NA	NA
WP_009405708.1|792665_792983_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_009405710.1|792979_793315_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_099593710.1|795419_795656_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_099593707.1|795648_796011_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_099593705.1|796010_796427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099593703.1|796447_798130_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	1.2e-35
WP_099593701.1|798164_798599_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_099593699.1|798611_798890_-	mercury resistance system periplasmic binding protein MerP	NA	A0A218MNH0	uncultured_virus	47.8	2.6e-09
WP_099593697.1|798903_799254_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_099593695.1|799325_799745_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_157765890.1|801458_801905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172959809.1|801987_803901_+	CHASE domain-containing protein	NA	G3MA91	Bacillus_virus	35.0	1.6e-20
WP_099593687.1|804480_805350_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_099593685.1|805418_806165_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099593683.1|806161_806674_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_099593681.1|806670_807018_-	DUF3703 domain-containing protein	NA	NA	NA	NA	NA
WP_099593679.1|807328_807742_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_173895560.1|807842_808736_+	cation transporter	NA	NA	NA	NA	NA
WP_099593675.1|809122_810094_-	ExeA family protein	NA	NA	NA	NA	NA
809130:809144	attL	GGCAGCCCCGCCGCC	NA	NA	NA	NA
WP_099593673.1|810083_811745_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_110765430.1|811725_812301_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.9	1.2e-43
WP_000845048.1|812602_813616_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003108247.1|813782_814583_+	subclass B1 metallo-beta-lactamase VIM-2	NA	NA	NA	NA	NA
WP_001261740.1|814670_815462_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000846390.1|815496_816297_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_032488579.1|816328_816883_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_003155741.1|817045_817669_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
WP_173895562.1|817730_818948_-	TniQ family protein	NA	NA	NA	NA	NA
WP_173895564.1|818944_819853_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|819855_821535_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_009405714.1|822326_822632_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029380191.1|822642_823848_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_157765889.1|824654_824888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099594188.1|824884_825769_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099593658.1|825803_826046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074198791.1|826267_827023_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.4	2.7e-72
WP_074198792.1|827040_828555_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	1.4e-144
830326:830340	attR	GGCGGCGGGGCTGCC	NA	NA	NA	NA
>prophage 3
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	1161632	1169411	5977292		Thermobifida_phage(16.67%)	10	NA	NA
WP_013971076.1|1161632_1162487_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.8	6.2e-09
WP_015269060.1|1162489_1162954_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003255135.1|1162966_1163275_-	ribosome-associated translation inhibitor RaiA	NA	A0A0K1LP60	Escherichia_phage	34.1	4.4e-05
WP_054573146.1|1163354_1164848_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_015269062.1|1165023_1165749_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.9e-23
WP_015269063.1|1165749_1166274_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003257918.1|1166260_1166833_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_015269064.1|1166841_1167366_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	47.8	2.4e-27
WP_003257920.1|1167378_1168353_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	3.6e-37
WP_012270662.1|1168601_1169411_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	4.5e-25
>prophage 4
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	1378344	1461328	5977292	holin,integrase,terminase,tail,portal,protease,head,capsid,tRNA	Pseudomonas_phage(33.33%)	99	1406921:1406940	1462009:1462028
WP_054573193.1|1378344_1379697_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_013971256.1|1379771_1382132_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_015269197.1|1382176_1382680_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_013971258.1|1382681_1383737_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_004375427.1|1383851_1384292_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_015269198.1|1384288_1385065_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_015269199.1|1385066_1386194_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_013971261.1|1386195_1386819_+	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	32.9	5.0e-16
WP_054573192.1|1387006_1390531_+	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	35.9	2.6e-194
WP_015269200.1|1390637_1391585_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_054573191.1|1391723_1393007_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_004375437.1|1393276_1394905_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.9	1.2e-157
WP_015269202.1|1394908_1395754_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	6.5e-51
WP_015269203.1|1395907_1397197_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.4	9.7e-139
WP_004375443.1|1397365_1397647_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_015269204.1|1397643_1398351_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015269205.1|1398420_1399317_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013971270.1|1399424_1400537_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.5	8.0e-33
WP_054573190.1|1400545_1401400_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_015269207.1|1401601_1402075_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_015269208.1|1402071_1403130_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_013971274.1|1403117_1403867_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	4.4e-67
WP_015269209.1|1403902_1404541_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	1.7e-40
WP_054573189.1|1404761_1405619_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
WP_013971277.1|1405727_1406735_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
1406921:1406940	attL	GGGCTGCAAAGCAGCCCCAA	NA	NA	NA	NA
WP_004375459.1|1407352_1407676_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_173895615.1|1407816_1410390_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.6	9.9e-26
WP_084296974.1|1410533_1411208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895617.1|1411453_1412467_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VP19	Pseudomonas_phage	68.9	3.7e-125
WP_039614784.1|1412482_1412674_-	DUF4224 domain-containing protein	NA	A0A1B0VMB6	Pseudomonas_phage	62.9	1.4e-17
WP_173895619.1|1412712_1413189_-	hypothetical protein	NA	A0A1B0VM52	Pseudomonas_phage	57.5	1.2e-33
WP_173895621.1|1413251_1413512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895623.1|1413555_1413930_-	hypothetical protein	NA	A0A2H4J8S0	uncultured_Caudovirales_phage	89.4	3.0e-16
WP_173895625.1|1413926_1414322_-	DUF2591 domain-containing protein	NA	A0A1B0VMD7	Pseudomonas_phage	40.9	1.6e-15
WP_173895627.1|1414318_1414642_-	hypothetical protein	NA	A0A2H4J0N7	uncultured_Caudovirales_phage	92.5	2.0e-53
WP_173895629.1|1414638_1414992_-	DUF4884 domain-containing protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	44.4	5.5e-12
WP_173895631.1|1414988_1415318_-	hypothetical protein	NA	A0A023NGB2	Nitrincola_phage	47.9	2.5e-22
WP_173895633.1|1415400_1416558_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.2	1.2e-44
WP_173895635.1|1417163_1417736_-	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	44.9	1.3e-26
WP_173895636.1|1417852_1418329_-	hypothetical protein	NA	H2BDH2	Pseudomonas_virus	51.3	1.4e-31
WP_173895638.1|1418739_1419237_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	69.2	2.2e-46
WP_173895640.1|1419233_1419572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895642.1|1419590_1419974_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	63.0	2.3e-24
WP_021782745.1|1420216_1420435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895644.1|1420421_1420583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008099710.1|1420913_1421591_-	helix-turn-helix domain-containing protein	NA	A0A2H4J8I0	uncultured_Caudovirales_phage	56.0	4.6e-39
WP_173895646.1|1421693_1421930_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	53.8	4.2e-16
WP_173896063.1|1422269_1422956_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	59.8	1.4e-27
WP_173895648.1|1422948_1424328_+	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	51.9	2.0e-118
WP_173895650.1|1424324_1424753_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	75.0	1.8e-49
WP_173895652.1|1424749_1426048_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	54.6	6.3e-122
WP_135002667.1|1426044_1426365_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	60.6	1.1e-27
WP_121757708.1|1426376_1426718_+	antitermination protein Q	NA	A0A2D1GNB4	Pseudomonas_phage	80.7	4.6e-48
WP_054892292.1|1426917_1427241_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	64.2	1.0e-28
WP_173895654.1|1427240_1427579_+	HNH endonuclease	NA	C4ML58	Xanthomonas_virus	47.7	2.5e-22
WP_173895657.1|1427737_1428283_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	36.8	3.3e-16
WP_173895659.1|1428279_1429968_+|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	81.3	2.9e-252
WP_173895661.1|1429970_1431182_+|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	74.0	1.2e-170
WP_173895663.1|1431168_1431810_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	74.6	3.0e-88
WP_173895664.1|1431806_1433003_+|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	64.7	1.3e-145
WP_015271424.1|1433052_1433271_+	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	44.3	8.9e-05
WP_173895666.1|1433270_1433570_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	74.7	3.5e-36
WP_173895668.1|1433569_1433896_+|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	64.6	3.9e-28
WP_173895670.1|1433904_1434081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895672.1|1434084_1434660_+	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	56.3	8.0e-53
WP_173895674.1|1434652_1435039_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	83.6	5.8e-55
WP_173895676.1|1435094_1435595_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	84.7	1.4e-74
WP_173895678.1|1435634_1435964_+	hypothetical protein	NA	A0A2D1GNT5	Pseudomonas_phage	57.8	1.6e-26
WP_173896065.1|1436005_1436215_+	hypothetical protein	NA	A0A2D1GNK2	Pseudomonas_phage	68.6	8.6e-13
WP_173895680.1|1436264_1436900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895682.1|1436953_1440178_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	39.1	1.6e-94
WP_103462142.1|1440223_1440808_+	hypothetical protein	NA	A0A2H4IYI9	uncultured_Caudovirales_phage	54.1	1.2e-56
WP_173895684.1|1440807_1441413_+	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	77.3	4.8e-88
WP_173895686.1|1441415_1441814_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	75.0	7.5e-58
WP_173895687.1|1441810_1444990_+	DUF1983 domain-containing protein	NA	A0A2H4J0B1	uncultured_Caudovirales_phage	76.6	0.0e+00
WP_173895689.1|1444989_1446045_+	hypothetical protein	NA	A0A2H4JA10	uncultured_Caudovirales_phage	75.5	3.9e-154
WP_173895691.1|1446053_1446641_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	43.2	1.6e-24
WP_173895693.1|1446643_1447195_+|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	66.7	9.5e-19
WP_173895695.1|1447252_1447705_+	structural protein P5	NA	A0A2R3UAM8	Myoviridae_environmental_samples	58.2	3.4e-38
WP_173895697.1|1447701_1448082_+	ammonia monooxygenase	NA	G8GWD9	Rhodobacter_phage	51.3	1.6e-28
WP_173895699.1|1448066_1448579_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_173895701.1|1448592_1448802_+	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	60.0	8.0e-11
WP_039615154.1|1448921_1449230_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	70.5	7.6e-34
WP_173895702.1|1449219_1449435_+	hypothetical protein	NA	A0A2H4J7A7	uncultured_Caudovirales_phage	41.8	3.6e-06
WP_015269212.1|1449934_1450588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015269213.1|1450783_1451266_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	78.0	7.4e-60
WP_015269214.1|1451369_1452437_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.0	6.4e-112
WP_054573188.1|1452458_1452929_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_015269216.1|1452978_1454097_-	LOG family protein	NA	NA	NA	NA	NA
WP_004375471.1|1454259_1454469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013971343.1|1454483_1454903_-	quorum-sensing-regulated virulence factor family protein	NA	NA	NA	NA	NA
WP_173895704.1|1455123_1455834_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_015269217.1|1455912_1456563_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015269218.1|1456636_1457002_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_004375481.1|1456998_1457925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004375483.1|1458046_1458826_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_013971347.1|1459014_1459509_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_003252385.1|1459641_1460241_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_012270926.1|1460503_1461328_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	71.6	1.5e-105
1462009:1462028	attR	TTGGGGCTGCTTTGCAGCCC	NA	NA	NA	NA
>prophage 5
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	1567494	1640349	5977292	terminase,holin,integrase,tail,portal,protease,head,capsid,transposase,tRNA	Pseudomonas_phage(41.46%)	82	1562494:1562527	1610933:1610966
1562494:1562527	attL	GCCCAATCGCCGGCAAGCCAGCTCCCACAGGGAC	NA	NA	NA	NA
WP_173895718.1|1567494_1568685_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0Z061	Pseudomonas_phage	55.4	4.9e-113
WP_012315790.1|1568921_1569164_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	49.1	2.0e-05
WP_173895720.1|1569153_1569711_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_173895722.1|1569707_1569851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895724.1|1569847_1570243_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_047594881.1|1570328_1570808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895726.1|1570807_1571374_-	hypothetical protein	NA	A0A1B1PDB7	Escherichia_phage	46.3	1.1e-43
WP_173895728.1|1571960_1572350_-	response regulator transcription factor	NA	A0A1W6JTA9	Pseudomonas_phage	53.2	1.3e-22
WP_060709464.1|1572473_1573253_-	S24 family peptidase	NA	J7I0S2	Pseudomonas_phage	35.3	1.7e-21
WP_060709463.1|1573351_1573687_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173895730.1|1573683_1574289_+	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_012313226.1|1574703_1575009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895732.1|1575005_1575242_+	hypothetical protein	NA	A0A1B0VMK4	Pseudomonas_phage	44.6	7.2e-08
WP_173895734.1|1575238_1575532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895736.1|1575525_1575822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895738.1|1575818_1576592_+	Rha family transcriptional regulator	NA	A0A1V0E838	Vibrio_phage	49.1	3.2e-28
WP_015271444.1|1576588_1576903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271443.1|1576899_1577463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271442.1|1577459_1577690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895740.1|1577686_1578460_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	60.0	1.4e-23
WP_080604923.1|1578626_1579265_+	ATP-binding protein	NA	A0A2H4J2L2	uncultured_Caudovirales_phage	48.3	1.2e-44
WP_015271440.1|1579261_1580674_+	AAA family ATPase	NA	A0A0A0YUG7	Pseudomonas_phage	74.7	3.0e-186
WP_015271439.1|1580660_1581167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271438.1|1581163_1581463_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	50.6	1.7e-17
WP_015271437.1|1581459_1582008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271436.1|1582365_1582875_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	95.3	1.1e-85
WP_015271435.1|1583191_1583380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895742.1|1583497_1584319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047594930.1|1585192_1585516_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	64.2	1.3e-28
WP_123083831.1|1585519_1585738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052110538.1|1585785_1586265_+	HNH endonuclease	NA	I7HBD4	Xanthomonas_virus	46.9	1.7e-32
WP_173896069.1|1586502_1586691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009685291.1|1586690_1587029_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.9	2.9e-26
WP_102059533.1|1587178_1587652_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	41.5	3.4e-17
WP_102059534.1|1587648_1589346_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	58.2	3.5e-181
WP_102059535.1|1589342_1590743_+|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	84.4	9.3e-228
WP_102059536.1|1590756_1591632_+|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	72.5	1.1e-112
WP_102059537.1|1591646_1592861_+|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	80.8	1.1e-179
WP_102059538.1|1592903_1593293_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	64.4	2.8e-09
WP_102059539.1|1593296_1593773_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_102059553.1|1593802_1594093_+|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	41.6	5.3e-13
WP_102059540.1|1594089_1594560_+	HK97 gp10 family phage protein	NA	A4JX05	Burkholderia_virus	47.0	6.2e-27
WP_102059541.1|1594564_1594912_+	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	31.8	2.1e-08
WP_102059542.1|1594920_1595391_+	hypothetical protein	NA	Q3HQT6	Burkholderia_phage	47.7	3.2e-31
WP_100413833.1|1595390_1595858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100413842.1|1595881_1596178_+	DUF4035 domain-containing protein	NA	Q4FAS6	Burkholderia_phage	50.5	1.3e-14
WP_121757750.1|1596240_1596597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158239720.1|1596820_1600012_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	42.6	9.3e-74
WP_100413835.1|1600011_1600350_+|tail	phage tail protein	tail	A0A0R6PIG5	Moraxella_phage	32.7	6.5e-10
WP_100413836.1|1600357_1601041_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	44.1	6.6e-54
WP_162998281.1|1601037_1601814_+	Mov34/MPN/PAD-1 family protein	NA	A0A2D1GNP8	Pseudomonas_phage	49.8	2.8e-69
WP_100413843.1|1601819_1602410_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	49.5	3.8e-42
WP_173895744.1|1602465_1606191_+	DUF1983 domain-containing protein	NA	A0A1B0VMH5	Pseudomonas_phage	47.8	0.0e+00
WP_173895746.1|1606187_1607243_+	hypothetical protein	NA	A0A2H4JA10	uncultured_Caudovirales_phage	76.6	5.5e-156
WP_173895747.1|1607251_1607839_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	42.7	1.4e-23
WP_173895749.1|1607841_1608384_+|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	62.3	1.8e-17
WP_173896071.1|1608622_1608802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895751.1|1608857_1609346_+	glycoside hydrolase family 104 protein	NA	H2BD99	Pseudomonas_phage	66.7	1.9e-55
WP_173895753.1|1609342_1609705_+	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	53.7	2.1e-19
WP_102082349.1|1609988_1610513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054573482.1|1610988_1612953_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
1610933:1610966	attR	GTCCCTGTGGGAGCTGGCTTGCCGGCGATTGGGC	NA	NA	NA	NA
WP_173895755.1|1613106_1614600_+	polyphosphate:AMP phosphotransferase	NA	NA	NA	NA	NA
WP_015269294.1|1614855_1615821_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054573483.1|1615952_1617347_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003259051.1|1617502_1618027_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_003252644.1|1618037_1618334_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013971443.1|1618560_1619493_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_054573484.1|1619496_1620129_+	DsbA family protein	NA	NA	NA	NA	NA
WP_054573485.1|1620121_1621954_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	1.3e-40
WP_054573486.1|1622192_1624649_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	3.5e-20
WP_015269299.1|1624679_1625465_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_102083829.1|1625586_1626327_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_054573488.1|1626419_1627091_-	N-acetylmuramic acid 6-phosphate phosphatase MupP	NA	NA	NA	NA	NA
WP_003260863.1|1627093_1627792_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_015269302.1|1627903_1628980_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_015269303.1|1629538_1632304_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	43.1	1.6e-98
WP_162491229.1|1632571_1633657_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.5	1.6e-89
WP_013971453.1|1633656_1634751_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_081013957.1|1634929_1637170_+	bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003260862.1|1637166_1637853_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003252673.1|1637977_1639654_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_039614560.1|1639893_1640349_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	2042549	2048684	5977292	lysis	Pseudomonas_phage(33.33%)	7	NA	NA
WP_054572223.1|2042549_2042825_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	58.3	4.1e-23
WP_054572224.1|2043155_2043710_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	46.2	8.6e-28
WP_054572225.1|2043861_2044656_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	68.6	2.6e-102
WP_081013928.1|2044580_2045345_-	SOS response-associated peptidase family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	48.0	1.3e-53
WP_054572226.1|2045447_2045876_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	43.4	4.8e-18
WP_081013930.1|2047420_2048371_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_054572229.1|2048477_2048684_-	hypothetical protein	NA	A0A2D1GNR5	Pseudomonas_phage	39.7	2.9e-05
>prophage 8
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	3795053	3803925	5977292	tRNA	uncultured_Caudovirales_phage(75.0%)	10	NA	NA
WP_003251184.1|3795053_3795725_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	2.1e-105
WP_013973275.1|3796042_3797422_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	1.6e-27
WP_054573031.1|3797701_3798094_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.8	1.9e-53
WP_054573030.1|3798095_3798455_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	60.8	8.9e-34
WP_054573029.1|3798454_3798751_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	63.6	1.0e-27
WP_015270963.1|3798747_3799083_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	1.7e-42
WP_015270964.1|3799079_3800084_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	79.2	3.1e-153
WP_013973281.1|3800176_3801136_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_013973282.1|3801252_3802644_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003258877.1|3802644_3803925_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.4	2.6e-96
>prophage 9
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	4481687	4525338	5977292	terminase,holin,integrase,tail,portal,protease,head,capsid,transposase	Pseudomonas_phage(48.89%)	63	4483334:4483393	4523656:4523720
WP_038410099.1|4481687_4483049_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.9	4.8e-64
4483334:4483393	attL	TATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAA	NA	NA	NA	NA
WP_173895935.1|4483590_4483917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895937.1|4484021_4484744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895939.1|4484865_4485432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895941.1|4485474_4485972_-	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	76.2	1.2e-41
WP_173895943.1|4485968_4486457_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	64.2	1.7e-51
WP_173895945.1|4486512_4486851_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	66.7	5.8e-19
WP_173895947.1|4486903_4487062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895948.1|4487064_4487652_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	42.7	1.0e-23
WP_054572334.1|4487660_4488716_-	hypothetical protein	NA	A0A2H4JA10	uncultured_Caudovirales_phage	76.9	1.9e-156
WP_173895950.1|4488712_4491919_-	DUF1983 domain-containing protein	NA	A0A2H4J0B1	uncultured_Caudovirales_phage	81.4	0.0e+00
WP_103462627.1|4491918_4492317_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	92.4	5.0e-70
WP_173895952.1|4492319_4492925_-	hypothetical protein	NA	A0A2H4J0R3	uncultured_Caudovirales_phage	85.9	3.3e-97
WP_054572681.1|4492924_4493509_-	hypothetical protein	NA	A0A2H4IYI9	uncultured_Caudovirales_phage	54.6	1.4e-57
WP_173895954.1|4493554_4496800_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	32.4	7.8e-52
WP_173895956.1|4496853_4497084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895957.1|4497143_4497359_-	hypothetical protein	NA	A0A2D1GNK2	Pseudomonas_phage	62.0	5.9e-09
WP_173895959.1|4497382_4497724_-	hypothetical protein	NA	A0A2D1GNT5	Pseudomonas_phage	53.6	1.6e-24
WP_173895961.1|4497736_4498237_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	81.7	4.4e-71
WP_121757697.1|4498292_4498679_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	80.5	2.4e-53
WP_173895963.1|4498671_4499247_-	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	56.3	1.8e-52
WP_173895965.1|4499251_4499431_-	hypothetical protein	NA	A0A2D1GNQ5	Pseudomonas_phage	44.6	7.3e-05
WP_173895967.1|4499439_4499766_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	60.4	1.6e-26
WP_016715891.1|4499765_4500065_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	74.7	5.5e-37
WP_173895969.1|4500065_4500284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009681829.1|4500335_4501538_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	63.4	3.2e-144
WP_009681830.1|4501534_4502176_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	77.0	2.3e-88
WP_173895971.1|4502162_4503374_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.4	3.4e-170
WP_173895973.1|4503376_4505065_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	81.7	1.9e-251
WP_173895975.1|4505061_4505607_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	43.8	2.9e-20
WP_173895977.1|4505764_4506103_-	HNH endonuclease	NA	C4ML58	Xanthomonas_virus	47.7	4.3e-22
WP_173895979.1|4506105_4506297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047594930.1|4506300_4506624_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	64.2	1.3e-28
WP_173895742.1|4507497_4508319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015271435.1|4508436_4508625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015271436.1|4508941_4509451_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	95.3	1.1e-85
WP_054572660.1|4509676_4510066_-	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	59.4	2.5e-37
WP_103469962.1|4510062_4510350_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	42.5	3.4e-12
WP_173895981.1|4510342_4511677_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	47.8	3.7e-109
WP_103469964.1|4511673_4512018_-	Lar family restriction alleviation protein	NA	A0A0H5ARQ3	Pseudomonas_phage	57.9	8.0e-32
WP_103469965.1|4512014_4513379_-	replicative DNA helicase	NA	A0A2H4J8N1	uncultured_Caudovirales_phage	58.7	1.9e-140
WP_173895983.1|4513375_4514176_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	48.4	5.0e-61
WP_129932392.1|4514156_4514888_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	43.0	3.7e-34
WP_173896092.1|4514892_4515120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895985.1|4515413_4516160_-	phage antirepressor	NA	A0A1W6JTB2	Pseudomonas_phage	40.6	8.9e-28
WP_173895987.1|4516156_4516453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895989.1|4516446_4516743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895991.1|4516739_4517054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173895993.1|4517189_4517489_-	helix-turn-helix domain-containing protein	NA	A0A2H4J114	uncultured_Caudovirales_phage	60.0	1.9e-13
WP_103469971.1|4517580_4518411_+	helix-turn-helix transcriptional regulator	NA	H2BD63	Pseudomonas_phage	45.4	1.7e-56
WP_103469972.1|4518444_4518762_-	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	61.0	1.1e-24
WP_009681853.1|4518919_4519309_+	LuxR family transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	56.6	1.9e-26
WP_103469974.1|4519392_4519641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054890605.1|4519637_4520471_+|transposase	transposase	transposase	A0A0A0YRT7	Pseudomonas_phage	89.1	1.4e-111
WP_173895994.1|4520523_4520841_+	carbon storage regulator CsrA	NA	L7TH77	Pseudomonas_virus	45.9	5.7e-08
WP_173895996.1|4520827_4521151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173895999.1|4521147_4521291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103469977.1|4521287_4521692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173896000.1|4521688_4521937_+	hypothetical protein	NA	B5WZU8	Pseudomonas_phage	57.9	5.8e-16
WP_019438261.1|4521933_4522551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173896002.1|4522569_4523547_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	69.5	1.2e-125
WP_004375217.1|4523838_4524549_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	37.9	1.9e-40
4523656:4523720	attR	TATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAATCCGT	NA	NA	NA	NA
WP_015271459.1|4524579_4525338_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	28.3	1.3e-18
>prophage 10
NZ_CP045553	Pseudomonas sp. 13159349 chromosome, complete genome	5977292	5920658	5925707	5977292		uncultured_Caudovirales_phage(100.0%)	7	NA	NA
WP_054572039.1|5920658_5921207_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	67.7	2.5e-56
WP_054572040.1|5921199_5922282_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	66.5	1.4e-106
WP_054572041.1|5922307_5922811_-	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_023048559.1|5922815_5923529_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	89.5	1.8e-118
WP_054572043.1|5923552_5924023_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	82.1	4.7e-67
WP_054572044.1|5924037_5925321_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	85.5	4.0e-201
WP_054572045.1|5925350_5925707_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	65.8	7.0e-39
